Nanocomposite HA / PEI / Fe3O4 (at) siRNA and preparation method and application thereof

Abstract

The invention discloses a nanocomposite HA / PEI / Fe3O4 (at) siRNA and a preparation method and application thereof, and belongs to the technical field of antitumor drugs. The nano-composite HA / PEI / Fe3O4 coated siGPX4 is successfully prepared, the serum stability is high, the blood compatibility is good, siGPX4 can be efficiently released when the nano-composite reaches a tumor acidic microenvironment, then the anti-tumor effect is exerted, triple negative breast cancer cells can be specifically targeted, the internalization ability of MDA-MB-468 cells on the nano-composite is greatly improved, and the delivery efficiency of siGPX4 is remarkably improved; in the presence of H2O2, the nano-composite can down-regulate expression of GPX4, released ferrous ions and H2O2 are subjected to Fenton reaction, ROS in cells is remarkably increased, mitochondrial membrane potential is reduced, ferroptosis is triggered, MDA-MB-468 cell proliferation is remarkably inhibited, and the anti-tumor effect is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of anti-tumor drugs, and particularly relates to a nano-complex HA / PEI / Fe3O4@siRNA and its preparation method and application. Background Art

[0002] At present, breast cancer has become the second most common cancer globally, second only to lung cancer in terms of incidence. The molecular typing of breast cancer is an important basis for guiding clinical treatment. According to the expression differences of biomarkers such as estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), and Ki67, breast cancer is mainly divided into Luminal A type, Luminal B type, HER2 overexpression type, and triple-negative breast cancer (TNBC).

[0003] Among them, TNBC is a special subtype in which tumor cells do not express ER, PR, and HER2. Pathological characteristics show that TNBC patients have larger tumor volumes, higher pathological grades, and more active cell proliferation. Clinical studies have shown that TNBC patients face an extremely high risk of early recurrence. Approximately 30% of early-stage patients relapse within 3 years after diagnosis, and 6% - 10% of patients already have metastatic lesions at the time of initial diagnosis. Once in the advanced stage, the prognosis of patients is extremely poor.

[0004] The treatment dilemma of TNBC mainly stems from the lack of relevant specific treatment targets. At present, chemotherapy is still the main treatment method for TNBC patients, but patients are prone to develop drug resistance to conventional chemotherapy drugs, significantly restricting the curative effect. Therefore, finding more effective treatment methods to improve drug targeting, overcome drug resistance, and reduce systemic toxicity has become the focus of TNBC research.

[0005] The targeted therapy strategy of ferroptosis provides a new idea for the precise treatment of TNBC. Ferroptosis triggers the accumulation of lipid reactive oxygen species through iron-dependent Fenton reaction, and its core regulatory factor glutathione peroxidase 4 (GPX4) is highly expressed in TNBC cells and mediates chemotherapy resistance. Summary of the Invention

[0006] The purpose of the present invention is to provide a nano-complex HA / PEI / Fe3O4@siRNA and its preparation method and application, and to provide a new targeted drug candidate complex with good effects, strong targeting, and low toxicity to normal tissues for the targeted treatment of TNBC.

[0007] To achieve the above purpose, the present invention provides a preparation method of a nano-complex HA / PEI / Fe3O4@siRNA, including the following steps: S1. Prepare hydrophobic Fe3O4 nanoparticles. Add iron(III) acetylacetonate, 1,2-dodecanediol, oleic acid, oleylamine, and benzyl ether into a container in sequence for pyrolysis reaction. After the reaction is completed, cool to room temperature to obtain a black mixture. Add absolute ethanol and centrifuge. Disperse the precipitate in a mixed solvent and centrifuge. Take the supernatant, add absolute ethanol and centrifuge. After the precipitate is dried, it is the hydrophobic Fe3O4 nanoparticles. S2. Perform phase transfer on the obtained hydrophobic Fe3O4 nanoparticles. Dissolve 3,4-dihydroxycinnamic acid in tetrahydrofuran, and then dropwise add the tetrahydrofuran dispersion of the hydrophobic Fe3O4 nanoparticles obtained in S1 into it under a protective atmosphere and stirring conditions. After the addition is completed, continue the reaction for 3 h under the same conditions. After the reaction is completed, cool to room temperature, then add 0.5 M NaOH solution, centrifuge and take the precipitate, and freeze-dry to obtain hydrophilic Fe3O4 nanoparticles. S3. Prepare the PEI / Fe3O4 composite. Dissolve polyethyleneimine and the hydrophilic Fe3O4 nanoparticles obtained in S2 in ultrapure water respectively, and then dropwise add the aqueous solution of Fe3O4 nanoparticles into the aqueous solution of polyethyleneimine. After the reaction is completed, freeze-dry to obtain the PEI / Fe3O4 composite. S4. Prepare the PEI / Fe3O4@siRNA nanocomposite. Mix the DEPC aqueous solution of the PEI / Fe3O4 composite obtained in S3 with the aqueous solution of siRNA evenly, and then incubate at room temperature to obtain the PEI / Fe3O4@siRNA nanocomposite. S5. Prepare the HA / PEI / Fe3O4@siRNA nanocomposite. Stir and mix the aqueous solution of hyaluronic acid with the PEI / Fe3O4@siRNA nanocomposite obtained in S4 and react. After the reaction is completed, the HA / PEI / Fe3O4@siRNA nanocomposite is obtained.

[0008] Preferably, in S1, the molar ratio of iron(III) acetylacetonate: 1,2-dodecanediol: oleic acid: oleylamine: benzyl ether is 1:5:3:3:53; the conditions of the pyrolysis reaction are to react at 200 °C for 2 h under stirring and protective atmosphere conditions, and then react at 300 °C for 1 h; the volume ratio of the black mixture to absolute ethanol is 1:2 - 3.

[0009] Preferably, in S1, the mixed solvent is a mixture of oleic acid, oleylamine, and n-hexane, and the volume ratio of oleic acid: oleylamine: n-hexane is 1:1:200; the volume ratio of the supernatant to absolute ethanol is 1:2 - 3; the precipitate is dried by blowing with nitrogen.

[0010] Preferably, in S2, the mass-volume ratio of hydrophobic Fe3O4 nanoparticles: tetrahydrofuran: 3,4-dihydroxycinnamic acid is 20 mg: 11 mL: 50 mg; the volume ratio of 0.5 M NaOH solution: the mixed solution cooled to room temperature is 1:22; before freeze-drying, the precipitate needs to be dried with nitrogen and dispersed in ultrapure water before freeze-drying.

[0011] Preferably, in S3, the mass-volume ratio of hydrophilic Fe3O4 nanoparticles: polyethyleneimine: ultrapure water is 5 mg: 25 mg: 22 mL; the aqueous solution of polyethyleneimine is stirred for 5 min and then the aqueous solution of Fe3O4 nanoparticles is added dropwise. After the addition is completed, stirring is continued for 30 min.

[0012] Preferably, in S4, the N / P ratio of the PEI / Fe3O4 complex to siRNA is 10:1; the siRNA is a specific sequence targeting a specific tumor CD44 or CD44 receptor.

[0013] Preferably, in S5, the mass ratio of hyaluronic acid: PEI / Fe3O4@siRNA nanocomplex is 0.5:1; the reaction condition is incubation at room temperature for 1 h.

[0014] The nanocomplex HA / PEI / Fe3O4@siRNA prepared by the preparation method of a nanocomplex HA / PEI / Fe3O4@siRNA as described above.

[0015] The application of the nanocomplex HA / PEI / Fe3O4@siRNA as described above in the preparation of a triple-negative breast cancer therapeutic drug, the drug comprising the nanocomplex HA / PEI / Fe3O4@siRNA; the siRNA in the nanocomplex HA / PEI / Fe3O4@siRNA is siGPX4.

[0016] The application of the nanocomplex HA / PEI / Fe3O4@siRNA as described above in the preparation of a tumor therapeutic drug, the drug comprising the nanocomplex HA / PEI / Fe3O4@siRNA.

[0017] At physiological pH, the amino part of the cationic polymer PEI is protonated and positively charged, so it can bind to negatively charged siRNA through electrostatic interaction. At this time, the complex structure is stable and can protect siRNA from degradation. When the carrier enters the tumor microenvironment, the pH is relatively low. At this time, the amino group of PEI is further protonated, triggering the proton sponge effect, increasing the internal osmotic pressure of the carrier, attracting a large amount of water molecules to enter, resulting in the disintegration of the carrier, creating favorable conditions for the release of siRNA; at the same time, due to the swelling or dissociation of the polymer conformation, the effective surface positive charge density decreases, weakening the electrostatic binding force, and siRNA is more likely to be released from the nanocomplex.

[0018] Ferroptosis is an iron-dependent form of programmed cell death, and its core mechanism is that ferrous ions in cells catalyze lipid peroxidation through the Fenton reaction, thereby leading to cell death. Therefore, an increase in the intracellular ferrous ion content helps to promote the occurrence of ferroptosis. After the HA / PEI / Fe3O4@siGPX4 nanocomposite enters tumor cells, it will be encapsulated in organelles such as endosomes or lysosomes. The acidic environment and abundant hydrolytic enzymes inside these organelles will further promote the dissociation of Fe3O4, prompting the release of Fe 2+ and Fe 3+ to be released.

[0019] Therefore, a nanocomposite HA / PEI / Fe3O4@siRNA provided by the present invention, its preparation method and application have the following specific technical effects: (1) The nanocomposite HA / PEI / Fe3O4@siRNA was successfully prepared by the method provided by the present invention, with a hydrodynamic diameter of 77.28 nm, a PDI of 0.210, and a zeta potential of 5.54 mV; (2) The nanocomposite HA / PEI / Fe3O4@siRNA provided by the present invention has high serum stability, stably exists under physiological conditions, has low cytotoxicity to normal tissue cells, and can efficiently release siGPX4 when reaching the acidic tumor microenvironment, thereby exerting an anti-tumor effect and having good blood compatibility; (3) The nanocomposite HA / PEI / Fe3O4@siGPX4 provided by the present invention can specifically target triple-negative breast cancer cells, greatly enhance the internalization ability of triple-negative breast cancer MDA-MB-468 cells, improve the uptake rate of triple-negative breast cancer MDA-MB-468 cells, and thereby significantly improve the delivery efficiency of siGPX4; (4) In the presence of H2O2, the nanocomposite HA / PEI / Fe3O4@siGPX4 provided by the present invention can down-regulate the expression of GPX4. The released ferrous ions can react with H2O2 through the Fenton reaction, resulting in a significant increase in intracellular ROS, a decrease in mitochondrial membrane potential, and thereby triggering ferroptosis and significantly inhibiting the proliferation of MDA-MB-468 cells, thereby exerting an anti-tumor effect.

[0020] The technical solutions of the present invention will be further described in detail below with reference to the accompanying drawings and examples. Description of the Drawings

[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other accompanying drawings can be obtained based on these drawings without creative efforts.

[0022] Figure 1 are the TEM photos of hydrophobic Fe3O4 nanoparticles, hydrophilic Fe3O4 nanoparticles and PEI / Fe3O4 composites in Example 1 of the present invention; among them, (a) is the hydrophobic Fe3O4 nanoparticles; (b) is the hydrophilic Fe3O4 nanoparticles; (c) is the PEI / Fe3O4 composite; Figure 2 is the detection result of the complexing ability of PEI / Fe3O4 composite to siRNA under different N / P conditions in Example 1 of the present invention; Figure 3 are the TEM and DLS detection results of PEI / Fe3O4@siGPX4 nanocomposite in Example 1 of the present invention; among them, (a) is the TEM photo; (b) is the DLS detection result; Figure 4 is the influence of HA on the siRNA complexing ability of PEI / Fe3O4 composite in Example 1 of the present invention; Figure 5 are the characterization results of HA / PEI / Fe3O4@siGPX4 nanocomposite in Test 1 of the present invention; among them, (a) is the TEM image; (b) are the particle size and PDI measured by DLS analysis; (c) is the TEM element mapping image; Figure 6 is the detection result of Zeta potential in Test 1 of the present invention; Figure 7 are the serum stability detection results in Test 2 of the present invention; among them, (a) is the medium containing 10% FBS; (b) is the medium containing 50% FBS; Figure 8 is the cytotoxicity determination result in Test 3 of the present invention; Figure 9 are the red blood cell compatibility evaluation results in Test 4 of the present invention; among them, (a) is the photo of the centrifuge tube after centrifugation of each treatment group; (b) is the quantitative analysis result of hemolysis rate; Figure 10 is the in vitro release curve of siGPX4 in Test 5 of the present invention; Figure 11It is the Western blot detection result in Test 6 of the effects of the present invention; among them, (a) is the picture of the Western blot detection result; (b) is the quantitative analysis result of the Western blot detection result picture using Image J software; Figure 12 It is the detection result of cell internalization behavior in Test 6 of the effects of the present invention; among them, (a) is the green fluorescence photo; (b) is the quantitative analysis result of the green fluorescence using Image J software; I is the blank medium control; II is the double-antibody-free DMEM medium containing free siGPX4; III is the double-antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is the double-antibody-free DMEM medium containing HA+HA / PEI / Fe3O4@siGPX4 nanocomposite; V is the double-antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale bar is 50 μm; Figure 13 It is the investigation result of the gene silencing efficiency of GPX4 in Test 6 of the effects of the present invention; among them, (a) is the detection of the silencing efficiency of GPX4 at the mRNA level by fluorescence quantitative PCR; (b) is the detection of the silencing efficiency of GPX4 at the protein level by Western blot; (c) is the protein quantitative analysis result of the band gray value in figure (b) using Image J software; (d) is the detection of the expression of GPX4 by immunofluorescence staining method, FITC-labeled fluorescent secondary antibody (green); DAPI stains cell nuclei (blue); I is the blank medium control; II is the double-antibody-free DMEM medium containing free siGPX4; III is the double-antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is the double-antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale bar is 100 μm; Indicates P <0.001; Figure 14 It is the result of detecting cell proliferation by MTT method in Test 7 of the effects of the present invention; among them, (a) is without adding H2O2; (b) is adding H2O2; Figure 15Results of evaluating cell proliferation by EdU staining method in Test 7 of the effects of the present invention; among them, (a) is a representative image obtained by laser scanning confocal microscopy; (b) is the quantitative result without adding H2O2; (c) is the quantitative result with adding H2O2; I is the blank medium control; II is the antibiotic-free DMEM medium containing free siGPX4; III is the antibiotic-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposites; IV is the antibiotic-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposites; the scale bar is 100 μm; Figure 16 Results of measuring the content of ferrous ions in Test 7 of the effects of the present invention; among them, I is the blank medium control; II is the antibiotic-free DMEM medium containing free siGPX4; III is the antibiotic-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposites; IV is the antibiotic-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposites; Figure 17 Results of measuring the ability to generate hydroxyl radicals in Test 7 of the effects of the present invention; Figure 18 Results of detecting the ROS content in Test 7 of the effects of the present invention; among them, (a) is a laser confocal microscopy photograph; (b) is the result of flow cytometry analysis; (c) is the quantitative result of the laser confocal microscopy photograph; (d) is the quantitative result of the flow cytometry analysis result; I is the blank medium control; II is the antibiotic-free DMEM medium containing free siGPX4; III is the antibiotic-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposites; IV is the antibiotic-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposites; the scale bar is 100 μm; Figure 19 Results of detecting the mitochondrial membrane potential in Test 7 of the effects of the present invention; among them, (a) is a laser confocal microscopy photograph; (b) is the quantitative result without adding H2O2; (c) is the quantitative result with adding H2O2; I is the blank medium control; II is the antibiotic-free DMEM medium containing free siGPX4; III is the antibiotic-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposites; IV is the antibiotic-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposites; the scale bar is 200 μm; Figure 20 Results of detecting the mitochondrial morphology in Test 7 of the effects of the present invention. Detailed implementation manners

[0023] The technical solutions of the present invention are further described below with reference to the accompanying drawings and embodiments.

[0024] In order to make the purpose, technical solution and advantages of the present application more clear, thorough and complete, the technical solution of the present invention will be clearly and completely described below through the accompanying drawings and embodiments. The following detailed descriptions are all descriptions of embodiments, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the art to which this application belongs.

[0025] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels; the method steps not described in detail were all conventional technical means in the art.

[0026] Example 1 Prepare a nanocomposite HA / PEI / Fe3O4@siGPX4, and the specific steps are as follows: S1. Prepare hydrophobic Fe3O4 nanoparticles.

[0027] Accurately weigh ferric acetylacetonate (0.3532 g, 1 mmol) and 1,2-dodecanediol (1.0117 g, 5 mmol), respectively measure oleic acid (1.022 mL, 3 mmol), oleylamine (0.99 mL, 3 mmol) and benzyl ether (10 mL, 53 mmol) and add them to a three-necked flask in sequence, and carry out a pyrolysis reaction under magnetic stirring at 10000 rpm and high-purity nitrogen protection with a programmed temperature rise (200°C / 2 h → 300°C / 1 h).

[0028] After the reaction is completed, cool to room temperature, add 20 mL of absolute ethanol, centrifuge at 14000 rpm for 20 min, and discard the supernatant. The precipitate is dispersed with a mixture of oleic acid (25 μL) + oleylamine (25 μL) + n-hexane (5 mL), centrifuged at 6000 rpm for 10 min, and the supernatant is retained. Add 10 mL of absolute ethanol to the supernatant, centrifuge at 10000 rpm for 20 min, and dry the precipitate by nitrogen blowing to obtain hydrophobic Fe3O4 nanoparticles.

[0029] S2. Carry out phase transfer on the hydrophobic Fe3O4 nanoparticles obtained in step S1.

[0030] Mix 20 mg of the hydrophobic Fe3O4 nanoparticles obtained in step S1 with 1 mL of tetrahydrofuran (THF) to form an organic phase dispersion. Dissolve 50 mg of 3,4-dihydroxycinnamic acid in 6 mL of THF, and under the protection of high-purity nitrogen and stirring at 50°C, gradually add the prepared organic phase dispersion dropwise and react at 50°C for 3 h.

[0031] After the reaction, it was cooled to room temperature, then 0.5M NaOH (500 μL) was added, and the supernatant was discarded by centrifugation at 3000 rpm for 10 min. The precipitate was dried by nitrogen blowing, dispersed in ultrapure water and then freeze-dried to obtain hydrophilic Fe3O4 nanoparticles.

[0032] S3. Preparation of PEI / Fe3O4 complex.

[0033] 25 mg of PEI and 5 mg of the hydrophilic Fe3O4 nanoparticles obtained in step S2 were respectively dissolved in 3 mL of ultrapure water to obtain a PEI aqueous solution and an Fe3O4 nanoparticle aqueous solution. The PEI aqueous solution was transferred to a round-bottom flask, and ultrapure water was added to make up the total volume to 22 mL. After magnetic stirring for 5 min, the Fe3O4 nanoparticle aqueous solution was added dropwise and vigorously stirred (200 rpm) for 30 min to complete self-assembly. The reaction solution was concentrated by ultrafiltration centrifugation (MWCO 3 kDa) and then freeze-dried to obtain the PEI / Fe3O4 complex.

[0034] (1) The morphological characteristics of the hydrophobic Fe3O4 nanoparticles, hydrophilic Fe3O4 nanoparticles and PEI / Fe3O4 complex prepared in Example 1 were characterized by transmission electron microscopy (TEM), and their surface charge characteristics were measured using a nanoparticle size and zeta potential analyzer (DLS). The results are as Figure 1 shown. The Fe3O4 nanoparticles were relatively uniformly distributed, with a particle size of about 10 nm and a surface charge of 23.97 ± 0.33 mV. In addition, the PEI / Fe3O4 complex was also relatively uniformly distributed and had good dispersibility. The results indicated that we successfully synthesized the PEI / Fe3O4 complex.

[0035] (2) The complexation ability of the PEI / Fe3O4 complex prepared in Example 1 with siRNA was detected by gel retardation assay as follows: ① Dilute the PEI / Fe3O4 complex to 40 μg / mL and 4 μg / mL with DEPC water for standby.

[0036] ② Dilute the siRNA dry powder to 5 μM according to the instructions, and then mix the PEI / Fe3O4 complex and siRNA in different N / P ratios (0.5:1, 1:1, 2:1, 3:1, 5:1, 7.5:1, 10:1, 12.5:1, 20:1) in a 200 μL centrifuge tube. Then the centrifuge tube was incubated at room temperature for 30 min.

[0037] ③ Make up the total volume to 10 μL with DEPC water and perform agarose gel electrophoresis. The results are as Figure 2As shown, as the N / P ratio increases, the siRNA band gradually darkens. When the N / P is greater than or equal to 7.5:1, the electrophoresis band completely disappears, confirming that the PEI / Fe3O4 complex completely complexes with siRNA. Based on this, N / P = 10:1 was selected for subsequent experiments.

[0038] S4. Prepare the PEI / Fe3O4@siGPX4 nanocomposite.

[0039] Dilute the PEI / Fe3O4 complex obtained in step S3 with DEPC water to 40 μg / mL for standby. Dilute the siGPX4 dry powder to 5 μM according to the instructions. Subsequently, add the PEI / Fe3O4 complex (2.36 μL) and siRNA (1 μL) (N / P ratio is 10:1) to a 200 μL centrifuge tube and mix well, then let the centrifuge tube stand at room temperature for incubation for 30 min to obtain the PEI / Fe3O4@siGPX4 nanocomposite.

[0040] (1) Characterize the morphology, particle size and PDI of the PEI / Fe3O4@siGPX4 nanocomposite by TEM and DLS techniques. The results are as Figure 3 shown. The hydrodynamic diameter is 63.01 nm, which is much larger than the particle size measured by TEM. This data shows that the particle size and potential of this nanocomposite meet the requirements for entering cells, creating favorable conditions for the efficient delivery of siRNA.

[0041] (2) Detect the effect of HA on the siRNA complexing ability of the PEI / Fe3O4 complex by gel retardation assay.

[0042] ① Dilute the PEI / Fe3O4 complex to 40 μg / mL and 4 μg / mL with DEPC water, dilute HA to 400 μg / mL and 40 μg / mL, and dilute the siRNA dry powder to 5 μM according to the instructions for standby.

[0043] ② Complex the PEI / Fe3O4 complex and siRNA at an N / P ratio of 10:1 in a 200 μL centrifuge tube for 30 min.

[0044] ③ Then complex HA with PEI in the PEI / Fe3O4@siRNA complex at different mass ratios (m HA / m PEI = 0:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 2:1, 3:1, 5:1, 7:1, 10:1) for 1 h.

[0045] ④ After the complexation was completed, the total volume was made up to 10 μL with DEPC water. Then, 2 μL of DNA Loading buffer containing 1% SDS was added to the centrifuge tube of the PEI / Fe3O4@siRNA nanocomplex without adding HA, and agarose gel electrophoresis was carried out. The results are as Figure 4 shown. As the ratio of m HA / m PEI increased, the band of siRNA gradually became brighter, indicating that under the action of HA at this time, siRNA would fall off from the nanocomplex. When the ratio of m HA / m PEI was less than 0.5:1, the band of released and detached siRNA could not be detected, indicating that the introduction of HA did not affect the complexation of siRNA at this mass ratio. Based on the above situation, we decided to use the condition with a ratio of m HA / m PEI of 0.5:1 to complex siRNA for subsequent experiments.

[0046] S5. Preparation of HA / PEI / Fe3O4@siGPX4 nanocomplex.

[0047] HA was diluted with water to 40 μg / mL. Then, 1.13 μL of the HA solution was statically complexed with the PEI / Fe3O4@siGPX4 nanocomplex obtained in step S4 at room temperature for 1 h according to the mass ratio (m HA / m PEI ) of 0.5:1 to obtain the HA / PEI / Fe3O4@siGPX4 nanocomplex.

[0048] Effect test 1 The HA / PEI / Fe3O4@siGPX4 nanocomplex prepared in Example 1 was characterized as follows: (1) The morphology, elemental composition, particle size and PDI of the HA / PEI / Fe3O4@siGPX4 nanocomplex prepared in Example 1 were characterized by transmission electron microscope elemental imaging technology and dynamic light scattering (DLS) technology. From Figure 5 shown, Figure 5 (a) of it, the specific morphology of the HA / PEI / Fe3O4@siGPX4 nanocomplex could be observed; Figure 5 (b) of it, the hydrodynamic diameter of the HA / PEI / Fe3O4@siGPX4 nanocomplex was 77.28 nm and the PDI was 0.210. Figure 5(c) is the element mapping image obtained, and it can be seen that the HA / PEI / Fe3O4@siRNA nanocomposite contains five elements: carbon (C), nitrogen (N), oxygen (O), iron (Fe), and phosphorus (P). The above results show that the HA / PEI / Fe3O4@siGPX4 nanocomposite was successfully prepared.

[0049] (2) The zeta potential of the water-soluble Fe3O4 nanoparticles, PEI, PEI / Fe3O4 complex, PEI / Fe3O4@siRNA nanocomplex, HA, and HA / PEI / Fe3O4@siRNA nanocomplex prepared in Example 1 was tested. The results are shown in FIG. Figure 6 As shown in Table 1, it can be seen that the potential of Fe3O4 nanoparticles is -34.17mV, the potential of PEI is 15.00mV, the potential of the prepared PEI / Fe3O4 complex becomes 23.97mV, the potential of the PEI / Fe3O4@siRNA complex obtained after the PEI / Fe3O4 complex is complexed with siRNA is 20.93mV, and the potential of the final product HA / PEI / Fe3O4@siRNA nanocomplex after the PEI / Fe3O4@siRNA complex is complexed with HA is 5.54mV. It can be seen that the introduction of HA reduces the surface charge of the PEI / Fe3O4@siRNA nanocomplex. The results of the Zeta potential also show that the HA / PEI / Fe3O4@siRNA nanocomplex was successfully prepared.

[0050] Table 1 Zeta potential detection results ;

[0051] Effect test 2 The serum stability of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1 was investigated as follows: Since free siRNA has poor stability, it is easily degraded in the serum environment. Therefore, agarose gel electrophoresis was used to investigate whether HA / PEI / Fe3O4@siRNA nanocomplexes can enhance the serum stability of siRNA. The experimental group (HA / PEI / Fe3O4@siRNA nanocomplex) and the control group (free siRNA) were diluted to 10 μL with DMEM culture medium containing 10% and 50% fetal bovine serum (FBS), respectively, and incubated at 37°C for different times. After the incubation was terminated, 2 μL DNA Loading Buffer (without / with 1% SDS) was added for agarose gel electrophoresis. The results are shown in the figure. Figure 7As shown, the bands of free siRNA gradually weakened over time in media containing 10% and 50% serum, and completely disappeared at 96 h and 12 h respectively, indicating that free siRNA was completely degraded. However, the siRNA bands could still be observed after incubation of the HA / PEI / Fe3O4@siRNA nanocomplexes in systems containing 10% and 50% serum for 96 h and 72 h respectively. The results showed that the prepared HA / PEI / Fe3O4@siRNA nanocomplexes could protect siRNA from degradation in a serum environment, thus significantly improving the serum stability of siRNA.

[0052] Effect Test 3 The cytotoxicity of the HA / PEI / Fe3O4 complex prepared in Example 1 was investigated as follows: The toxicity of PEI, PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex to triple-negative breast cancer cells MDA-MB-468 was detected by MTT assay. The results were as Figure 8 shown. After incubation of MDA-MB-468 cells with the three materials for 48 h, their cell viability showed a regular decreasing trend with the increase of the concentration gradient. It is worth noting that under the same experimental conditions, the cell viability of the PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex treatment groups was always better than that of the group using PEI material alone, and this difference was verified at all concentrations. It is worth noting that when the PEI concentration was 10 μM, the survival rate of MDA-MB-468 cells treated with the HA / PEI / Fe3O4 complex was still as high as 76.66%, while the cell viabilities of the PEI / Fe3O4 and PEI treatment groups were 65.82% and 12.15% respectively. The results showed that compared with PEI, the cytotoxicity of the PEI / Fe3O4 complex was significantly reduced, and due to the introduction of negatively charged and biocompatible HA, the cytotoxicity of the HA / PEI / Fe3O4 complex was further reduced, making it more suitable for siRNA delivery.

[0053] Effect Test 4 The hemolysis of the HA / PEI / Fe3O4 complex prepared in Example 1 was investigated as follows: Due to the high positive charge characteristics on the surface of the cationic polymer PEI, it is easy to destroy the lipid bilayer structure of the red blood cell membrane through electrostatic interaction, triggering a dose-dependent hemolytic effect, which severely restricts its applicability in systemic drug delivery. Therefore, a hemolysis experiment was used to systematically evaluate the red blood cell compatibility of PEI, PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex. Equal volumes of red blood cell suspensions were incubated with complex solutions at different concentrations (2.5 μM, 5 μM, 10 μM), and then the hemolysis of red blood cells was observed and the hemolysis rate was detected. The results were asFigure 9 As shown Figure 9 Figure (a) is a photo of the centrifuge tubes after centrifugation of each treatment group. It can be seen that there is no precipitate at the bottom of the tube in the 0.1% Triton treatment group, indicating that the red blood cells have ruptured and hemolysis has occurred. Similarly, there is very little red precipitate at the bottom of the tube in the PEI treatment group. A red precipitate of red blood cells can be seen at the bottom of the tube in the negative control PBS group, and more red precipitate can also be observed at the bottom of the tube in the HA / PEI / Fe3O4 complex treatment group. Figure 9 Figure (b) is the quantitative analysis result of the hemolysis rate. Under the treatment of three concentrations, both the PEI / Fe3O4 complex and the HA / PEI / Fe3O4 complex reduced the red blood cell hemolysis rate of PEI, and the effect of the HA / PEI / Fe3O4 complex was more obvious. It is worth noting that when the PEI concentration was 10 μM, the hemolysis rate after treatment with the HA / PEI / Fe3O4 complex was 6.63%, while the hemolysis rates of the PEI / Fe3O4 complex and the PEI treatment group were 15.61% and 18.94% respectively. This result confirms that the HA / PEI / Fe3O4 complex has good blood compatibility and effectively balances the gene loading capacity and biological safety of the cationic carrier PEI.

[0054] Effect Test 5 Examine the in vitro release rate of siGPX4 of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1. The specific steps are as follows: The FAM-labeled HA / PEI / Fe3O4@siGPX4 nanocomposite was placed in environments with pH 7.4 and 6.5 respectively, simulating the physiological environment and the tumor acidic microenvironment. Subsequently, it was placed in a 37°C cell culture incubator and incubated for different times, and then centrifuged to collect the supernatant. The fluorescence intensity of siGPX4 in the supernatant collected at different time periods was detected by a fluorescence microplate reader, and the in vitro release rate of siGPX4 was calculated accordingly. The results are as Figure 10 shown. Under the condition of simulating the tumor acidic microenvironment at pH 6.5, siGPX4 in the HA / PEI / Fe3O4@siGPX4 nanocomposite was completely released at the 12th h. Under physiological conditions (pH 7.4), the cumulative release amount was only 9.05% at 48 h, indicating that the nanocomposite stably exists under physiological conditions and can reduce the toxicity to normal tissues; when it reaches the tumor acidic microenvironment, it can efficiently release siGPX4 and then exert an anti-tumor effect.

[0055] Effect Test 6 Examine the delivery performance and gene silencing efficiency of siGPX4 of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1. The details are as follows: (1)The expression of GPX4 in logarithmically growing MCF-7 and MDA-MB-468 breast cancer cells was detected at the protein level by Western blot. The results are as Figure 11 shown. Compared with MCF-7 cells, the expression level of GPX4 was significantly higher in triple-negative breast cancer MDA-MB-468 cells. The results of quantitative analysis showed that the relative expression level of GPX4 in MCF-7 cells was 0.34, while that in MDA-MB-468 cells was 0.97. These results fully demonstrated that GPX4 had a higher expression level in triple-negative breast cancer MDA-MB-468 cells.

[0056] Therefore, MDA-MB-468 cells with high expression of GPX4 were selected for subsequent experiments.

[0057] (3)Cell internalization behavior of HA / PEI / Fe3O4@siGPX4 nanocomposites.

[0058] 1) Special cover slips for cell culture slides soaked in alcohol were irradiated with ultraviolet light for half an hour in a laminar flow hood in advance. Subsequently, the cover slips were placed in 12-well plates, and MDA-MB-468 cells were seeded into the 12-well plates and cultured adherently for 12 hours at 37 °C and 5% CO2.

[0059] 2) siGPX4 labeled with FAM was used to prepare antibiotic-free DMEM media containing free siGPX4, PEI / Fe3O4@siGPX4 nanocomposites, and HA / PEI / Fe3O4@siGPX4 nanocomposites, respectively. The final concentration of siGPX4 was 50 nM. All subsequent steps were carried out in the dark from this step.

[0060] 3) Three wells in the 12-well plates were selected, the original medium was discarded, and pretreated with antibiotic-free DMEM medium containing HA for 2 h. The final concentration of HA was 10 mg / mL. After 2 h, the DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposites was added. The original media in the remaining wells of the 12-well plates were discarded, and the media containing nanocomposites prepared in step 2) were added respectively and incubated in the dark in a cell culture incubator for 12 h.

[0061] 4) After the incubation time ended, the media containing nanocomposites were discarded, and PBS was added to wash three times gently. Subsequently, 4% paraformaldehyde fixative (200 μL / well) was added and left to stand in the dark for 30 min to fix the cells.

[0062] 5) After 30 min, the fixative was discarded, and PBS was added again to wash gently three times. DAPI (200 μL / well) was added and left to stand in the dark for 10 min to stain the cell nuclei.

[0063] 6) After the staining is completed, recover DAPI and continue to gently wash three times with PBS.

[0064] 7) Finally, add an anti-fluorescence quenching mounting medium dropwise on the glass slide. Use special tweezers to take out the cover glass from the well plate, place the cell-attached side face down on the position where the anti-fluorescence quenching agent is dropped. After completing the mounting operation, place it aside and wait for it to dry naturally. After drying, use a laser scanning confocal microscope to observe and record the cell uptake status of each treatment group after treatment.

[0065] 8) Use Image J software to quantitatively analyze the FAM fluorescence intensity. The calculation formula is: FAM relative fluorescence intensity (%) = (green fluorescence intensity labeled by FAM / blue fluorescence intensity labeled by DAPI) × 100%.

[0066] The results are as Figure 12 shown. DAPI staining makes the cell nucleus blue, and siGPX4 labeled with FAM is green. The green fluorescence in the free siGPX4 group is weak, indicating that it is difficult to be effectively taken up by cells. The green fluorescence in the PEI / Fe3O4@siGPX4 nanocomposite treatment group is enhanced, which is 13.35 times that of the free siGPX4 group. The green fluorescence in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group is the strongest, which is 22.64 times that of the free siGPX4 group. It can be observed that the green fluorescence of the HA / PEI / Fe3O4@siGPX4 nanocomposite is significantly reduced after HA pretreatment (HA + HA / PEI / Fe3O4@siGPX4), and its fluorescence intensity is close to that of the PEI / Fe3O4@siGPX4 nanocomposite treatment group, which is 15.38 times that of the free siGPX4 group. This is because the CD44 receptor is highly expressed on the surface of MDA-MB-468 cells, and HA can specifically bind to the CD44 receptor. When the cells are pretreated with HA, the binding of the HA / PEI / Fe3O4@siGPX4 nanocomposite to the CD44 receptor on the cell surface is competitively inhibited. Based on the above phenomena, it can be known that the HA / PEI / Fe3O4@siGPX4 nanocomposite can enhance the uptake of the nanocomposite by MDA-MB-468 cells through CD44 receptor-mediated endocytosis, and then significantly improve the delivery efficiency of siGPX4.

[0067] (4) Analyze the gene silencing efficiency of HA / PEI / Fe3O4@siGPX4 on GPX4 at the mRNA and protein levels by qPCR and Western blot, respectively.

[0068] MDA-MB-468 cells were seeded into 6-well cell culture plates and cultured adherently for 12 hours at 37°C and 5% CO2. After discarding the old medium, DMEM medium without antibiotics containing free siGPX4, PEI / Fe3O4@siGPX4 nanocomposites, and HA / PEI / Fe3O4@siGPX4 nanocomposites (where the siGPX4 concentration was set at 25 nM and 50 nM) was prepared and added to different wells, and then it was placed in an incubator and incubated for another 48 h.

[0069] RNA of each group of cells was extracted using a kit. High-quality RNA was reverse transcribed into cDNA using a kit, and RT-PCR was performed using the following primers. The primers for GPX4 are shown in SEQ ID NO.1 and SEQ ID NO.2, and the primers for GAPDH are shown in SEQ ID NO.3 and SEQ ID NO.4. Program settings: 94°C for 2 min; 94°C for 15 s, 60°C for 15 s, 72°C for 30 s, for 40 cycles.

[0070] SEQ ID NO.1: ACAAGAACGGCTGCGTGGTGAA SEQ ID NO.2: GCCACACACTTGTGGAGCTAGA SEQ ID NO.3: AAGGTCGGAGTCAACGGATTT SEQ ID NO.4: CCTGGAAGATGGTGATGGGATT Cells were cultured using the above method with the siGPX4 concentration set at 50 nM. After incubation, proteins of each group of cells were extracted using a kit for Western blot.

[0071] The results are as Figure 13 shown. At concentrations of 25 nM and 50 nM, compared with other treatment groups, the HA / PEI / Fe3O4@siGPX4 nanocomposites showed the strongest gene knockout efficiency, with the relative mRNA levels being 0.64 and 0.38, respectively; while the relative mRNA levels of the PEI / Fe3O4@siGPX4 nanocomposite treatment group were 0.84 and 0.75, respectively. It indicates that under the guidance of HA, the nanocomposites can effectively deliver siGPX4 to tumor cells, thereby significantly inhibiting the expression of GPX4 at the mRNA level.

[0072] The Western blot detection results further showed that after treatment with the HA / PEI / Fe3O4@siGPX4 nanocomposites, the expression level of GPX4 was significantly reduced.

[0073] The gray-scale analysis of the Western blot detection results was performed using Image J software ( Figure 13 as shown in (c)), and the results showed that the relative expression level of GPX4 in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group was 0.41, which was significantly lower than that of other treatment groups.

[0074] Effect Test 7 The anti-tumor activity of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1 was evaluated as follows: (1) MTT method was used to evaluate cell proliferation. The original culture medium in the MDA-MB-468 cells cultured to adherent state was removed, and free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposites diluted with fresh DMEM medium without antibiotics and added or not added with H2O2 (H2O2 concentration: 100 μM) were added respectively. The final concentrations of siGPX4 in each of the above treatment groups were set to 100 nM, 200 nM, and 400 nM. After the addition, they were placed in an incubator, and the cell viability was detected by MTT colorimetric method after 48 h of culture. The results were as Figure 14 shown. The cell survival rates of each group decreased in a dose-dependent manner. When the concentration of siGPX4 was 400 nM, in the absence of H2O2, the survival rate of the HA / PEI / Fe3O4@siGPX4 nanocomposite group decreased to 58.51%, and further decreased to 41.73% in the simulated tumor microenvironment containing H2O2; the survival rates of the PEI / Fe3O4@siGPX4 nanocomposite group were 77.80% (without H2O2) and 67.82% (with H2O2) respectively; while the survival rates of the free siGPX4 group were higher than 87% and there was no significant difference under the two conditions. These results indicate that in the simulated tumor microenvironment with the presence of H2O2, the HA / PEI / Fe3O4@siGPX4 nanocomposite can significantly inhibit the proliferation of MDA-MB-468 cells.

[0075] (4) EdU staining method was used to evaluate cell proliferation.

[0076] Under the two conditions of not adding H2O2 and adding H2O2, MDA-MB-468 cells were incubated with free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposites respectively for 48 hours. Subsequently, the effects of inhibiting cell proliferation in different treatment groups were detected by further using an EdU cell proliferation kit. The results were as Figure 15As shown, compared with the control group and other treatment groups, the red fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group was significantly weakened whether in the presence or absence of H2O2. The results of quantitative analysis showed that the EdU positive rate of the control group was 42.35% without H2O2 and 41.99% with H2O2; in the free siGPX4 group, the EdU positive rate decreased to 37.49% and 36.32% respectively under the two conditions of without H2O2 and with H2O2; in the PEI / Fe3O4@siGPX4 nanocomposite group, the EdU positive rate decreased to 29.32% and 23.25% respectively without H2O2 and with H2O2; the EdU positive rate of the HA / PEI / Fe3O4@siGPX4 nanocomposite group was 20.42% under the condition of without H2O2 and further decreased to 8.31% under the condition of with H2O2. The results of EdU staining were consistent with the experimental detection results of the Calcein-AM / PI double staining method, also indicating that the HA / PEI / Fe3O4@siGPX4 nanocomposite could efficiently kill MDA-MB-468 cells, and in the presence of H2O2, the cell killing effect of the HA / PEI / Fe3O4@siGPX4 nanocomposite was more prominent.

[0077] (5)Detect the content of ferrous ions in MDA-MB-468 cells after treatment with HA / PEI / Fe3O4@siGPX4 nanocomposite.

[0078] After incubating free siGPX4, PEI / Fe3O4@siGPX4 nanocomposite and HA / PEI / Fe3O4@siGPX4 nanocomposite with MDA-MB-468 cells for 48 h, the content was detected using a ferrous ion content detection kit. According to the concentration and absorbance ΔA of the standard tubes in the kit, a standard curve y = 0.0076x - 0.0008 was established. Then, the absorbance of the measurement tubes was substituted to calculate the content of ferrous ions. The results are as Figure 16 shown. Compared with the control group, the content of ferrous ions in the free siGPX4 treatment group hardly changed, both being around 6 µmol / 10 6 cells, with no significant difference; the content of ferrous ions in the PEI / Fe3O4@siGPX4 nanocomposite treatment group increased to 9.97 µmol / 10 6 cells; while the content of ferrous ions in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group increased significantly, reaching 13.38 µmol / 10 6 cells. This result was consistent with the results of the cell uptake experiment, indicating that the more the cells took up the nanocomposite, the more ferrous ions entered the cells to participate in the Fenton reaction, which was more conducive to ferroptosis of the cells.

[0079] (6) The hydroxyl radical generation ability of the HA / PEI / Fe3O4@siGPX4 nanocomposite was detected using a spectrophotometer.

[0080] After the HA / PEI / Fe3O4@siGPX4 nanocomposite enters tumor cells, it will be encapsulated in organelles such as endosomes or lysosomes. The acidic environment and abundant hydrolytic enzymes inside these organelles will further promote the decomposition of Fe3O4 to generate Fe 2+ and Fe 3+ , Fe 2+ reacts with the accumulated H2O2 in tumor cells to produce highly toxic ·OH through the Fenton reaction, as shown in the following reaction equation. High levels of reactive oxygen species in the body can cause oxidative damage to cell components and cell metabolic dysfunction, thereby triggering ferroptosis.

[0081] ; ; ; To detect the ability of the nanocomposite to generate hydroxyl radicals, each treatment group with different concentrations was co-incubated with H2O2 and MB in an acidic environment for 1 hour, and then the absorbance of MB at 664 nm was detected using a spectrophotometer. The content or generation of ·OH in the system was indirectly inferred from the degree of decrease in absorbance. The results are as Figure 17 shown. The absorbance was 1.877 when only MB was present; the absorbance did not change in the free siGPX4 group at two concentrations, remaining around 1.87. When the siGPX4 concentration was 200 nM, the absorbance of the PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomposite treatment groups was around 1.6; when the siGPX4 concentration was 400 nM, the absorbance of these two groups was around 1.4. The above results indicate that the nanocomposite can generate more hydroxyl radicals under weakly acidic conditions in the presence of H2O2, which is more conducive to the occurrence of ferroptosis.

[0082] (7) Detection of ROS content.

[0083] An increase in ROS content is a hallmark event of ferroptosis. Downregulation of GPX4 expression and Fe 2+The H2O2-mediated Fenton reaction can synergistically induce the accumulation of intracellular ROS. To systematically evaluate the ROS regulation effect of the HA / PEI / Fe3O4@siGPX4 nanocomposite, MDA-MB-468 cells were incubated with free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposite (final concentration of siGPX4: 200 nM) for 48 h, and then the production of ROS was detected using the DCFH-DA fluorescent probe. The DCFH-DA probe itself has no fluorescence and is hydrolyzed to DCFH by intracellular esterase, and then can be oxidized by ROS to generate the green fluorescent product DCF, and its fluorescence intensity is positively correlated with the ROS level. Subsequently, the intracellular ROS level was detected by laser confocal microscopy and flow cytometry. The results are as Figure 18 shown. In the cells treated with the HA / PEI / Fe3O4@siGPX4 nanocomposite, bright green fluorescent signals were presented, especially with the highest fluorescence intensity in the presence of H2O2. The fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 nanocomposite group treated with H2O2 was normalized to 100%. Compared with the control group and other treatment groups, there were significant differences in the fluorescence intensity, indicating that the accumulation of ROS in this treatment group was the most significant. Flow cytometry analysis ( Figure 18 b of Figure 18 and d of 2+ further confirmed the above trend: there were no obvious differences in the fluorescence intensity of the free siGPX4 group compared with the control group under both conditions; the fluorescence intensity of the PEI / Fe3O4@siGPX4 group increased by 155 times compared with the control group without H2O2, and further increased to 288 times in the presence of H2O2. The fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 group increased by 352 times (without H2O2) and 508 times (with H2O2) compared with the control group. Based on the above results, it can be known that the HA / PEI / Fe3O4@siGPX4 nanocomposite synergistically induces ferroptosis through a dual mechanism: ① siRNA silences the expression of GPX4, weakening the cellular antioxidant defense system; ② Fe 2+ released from Fe3O4 reacts with H2O2 to continuously generate reactive oxygen species such as ·OH. The two together lead to an explosive accumulation of ROS, ultimately triggering cellular ferroptosis.

[0084] (8) Detect the mitochondrial membrane potential by JC-1 staining method.

[0085] The decrease in mitochondrial membrane potential is also a significant feature of ferroptosis. When the mitochondrial membrane potential is high, JC-1 exists in the form of polymers and can produce red fluorescence; when the mitochondrial membrane potential decreases, JC-1 transforms into the monomer form and can produce green fluorescence. Therefore, after incubating MDA-MB-468 cells with free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposites (final concentration of siGPX4 is 200 nM) for 48 h, the change in mitochondrial membrane potential was detected by JC-1 staining method. The results are as Figure 19 shown. Compared with the control group and other treatment groups, a large amount of green fluorescence could be observed in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group, especially under the condition of adding H2O2, where the green fluorescence was the strongest. The quantitative analysis results showed that there was no significant difference in the fluorescence intensity of JC-1 monomers in the free siGPX4 group under the two conditions compared with the control group; in the PEI / Fe3O4@siGPX4 group, the fluorescence intensity of JC-1 monomers increased to 15.19% under the condition without H2O2; under the condition containing H2O2, the fluorescence intensity of JC-1 monomers further increased to 21.09%. The fluorescence intensity of JC-1 monomers in the HA / PEI / Fe3O4@siGPX4 group increased to 68.12% (without H2O2) and 88.96% (with H2O2), respectively. This result indicates that the HA / PEI / Fe3O4@siGPX4 nanocomposite can induce ferroptosis in tumor cells, leading to a decrease in mitochondrial membrane potential, and the effect is stronger in the presence of H2O2.

[0086] (9)Detect the mitochondrial morphology by TEM.

[0087] When ferroptosis occurs, typical changes will occur in the morphology of cell mitochondria, such as the disappearance of mitochondrial cristae, the decrease in volume, and the increase in membrane density. To explore the effects of each treatment group on the morphology of MDA-MB-468 cells, transmission electron microscopy was used to observe the changes in mitochondrial morphology. The results are as Figure 20 shown. Compared with the control group, after incubating free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposites with cells for 48 hours respectively, the morphology of cell mitochondria changed to varying degrees, showing typical features of ferroptosis such as the disappearance of mitochondrial cristae, the decrease in volume, and the increase in membrane density. Among them, the above changes were the most significant in the cells treated with HA / PEI / Fe3O4@siGPX4 nanocomposites. This indicates that the HA / PEI / Fe3O4@siGPX4 nanocomposite can cause cell death by inducing ferroptosis.

[0088] Therefore, the present invention successfully prepared the nanocomposite HA / PEI / Fe3O4@siRNA, with a hydrodynamic diameter of 77.28 nm, a PDI of 0.210, and a potential of 5.54 mV; it has high serum stability, low cytotoxicity to normal tissue cells, and can efficiently release siGPX4 when reaching the acidic tumor microenvironment, thereby exerting an anti-tumor effect and having good blood compatibility; it can specifically target triple-negative breast cancer cells, significantly improve the internalization ability of triple-negative breast cancer MDA-MB-468 cells, increase the uptake rate of triple-negative breast cancer MDA-MB-468 cells, and thus significantly improve the delivery efficiency of siGPX4; in the presence of H2O2, this nanocomposite can down-regulate the expression of GPX4, and the released ferrous ions can undergo Fenton reaction with H2O2, resulting in a significant increase in intracellular ROS, a decrease in mitochondrial membrane potential, and then triggering ferroptosis and significantly inhibiting the proliferation of MDA-MB-468 cells, thereby exerting an anti-tumor effect.

[0089] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify or equivalently replace the technical solutions of the present invention, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A preparation method of a nano - composite HA / PEI / Fe3O4@siRNA, characterized in that, It includes the following steps: S1. Prepare hydrophobic Fe3O4 nanoparticles. Add iron acetylacetonate, 1,2-dodecanediol, oleic acid, oleylamine, and benzyl ether into a container in sequence for pyrolysis reaction. After the reaction ends, cool it to room temperature to obtain a black mixture. Add absolute ethanol and centrifuge. Disperse the precipitate in a mixed solvent and centrifuge. Take the supernatant, add absolute ethanol and centrifuge. The precipitate is dried to obtain hydrophobic Fe3O4 nanoparticles; S2. Conduct phase transfer on the obtained hydrophobic Fe3O4 nanoparticles. Dissolve 3,4-dihydroxycinnamic acid in tetrahydrofuran, and then dropwise add the tetrahydrofuran dispersion of the hydrophobic Fe3O4 nanoparticles obtained in S1 under a protective atmosphere and stirring conditions. After the dropping is completed, continue the reaction for 3 h under the same conditions. After the reaction ends, cool it to room temperature, then add 0.5 M NaOH solution, centrifuge to take the precipitate, and freeze-dry to obtain hydrophilic Fe3O4 nanoparticles; S3. Prepare the PEI / Fe3O4 composite. Dissolve polyethyleneimine and the hydrophilic Fe3O4 nanoparticles obtained in S2 in ultrapure water respectively, and then dropwise add the aqueous solution of Fe3O4 nanoparticles into the aqueous solution of polyethyleneimine. After the reaction ends, freeze-dry to obtain the PEI / Fe3O4 composite; S4. Prepare the PEI / Fe3O4@siRNA nanocomposite. Mix the DEPC aqueous solution of the PEI / Fe3O4 composite obtained in S3 with the aqueous solution of siRNA evenly, and then incubate at room temperature to obtain the PEI / Fe3O4@siRNA nanocomposite; S5. Prepare the HA / PEI / Fe3O4@siRNA nanocomposite. Stir and mix the aqueous solution of hyaluronic acid with the PEI / Fe3O4@siRNA nanocomposite obtained in S4 for reaction. After the reaction ends, the HA / PEI / Fe3O4@siRNA nanocomposite is obtained.

2. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S1, the molar ratio of iron acetylacetonate: 1,2-dodecanediol: oleic acid: oleylamine: benzyl ether is 1:5:3:3:53; the conditions of the pyrolysis reaction are to react at 200 °C for 2 h under stirring and protective atmosphere conditions, and then react at 300 °C for 1 h; the volume ratio of the black mixture to absolute ethanol is 1:2 - 3.

3. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S1, the mixed solvent is a mixed solution of oleic acid, oleylamine, and n-hexane, and the volume ratio of oleic acid: oleylamine: n-hexane is 1:1:200; the volume ratio of the supernatant to absolute ethanol is 1:2 - 3; the precipitate is dried by blowing with nitrogen.

4. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S2, the mass-volume ratio of hydrophobic Fe3O4 nanoparticles: tetrahydrofuran: 3,4-dihydroxycinnamic acid is 20 mg: 11 mL: 50 mg; the volume ratio of 0.5 M NaOH solution to the mixed solution cooled to room temperature is 1:22; before freeze-drying, the precipitate needs to be blown dry with nitrogen, dispersed in ultrapure water and then freeze-dried.

5. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S3, the mass-volume ratio of hydrophilic Fe3O4 nanoparticles: polyethyleneimine: ultrapure water is 5 mg: 25 mg: 22 mL; the aqueous solution of polyethyleneimine is stirred for 5 min and then the aqueous solution of Fe3O4 nanoparticles is added dropwise. After the dropping is completed, continue to stir for 30 min.

6. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S4, the N / P ratio of the PEI / Fe3O4 complex to siRNA is 10:1; the siRNA is a specific sequence targeting the specific tumor CD44 or CD44 receptor.

7. The preparation method of a nano - composite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S5, the mass ratio of hyaluronic acid to PEI in the PEI / Fe3O4@siRNA nanocomplex is 0.5:1; the reaction condition is incubation at room temperature for 1 h.

8. A nanocomplex HA / PEI / Fe3O4@siRNA prepared by the preparation method of a nanocomplex HA / PEI / Fe3O4@siRNA according to any one of claims 1 to 7.

9. Use of the nano - composite HA / PEI / Fe3O4@siRNA as claimed in claim 8 in the preparation of a therapeutic drug for triple - negative breast cancer, characterized in that: The drug comprises the nanocomplex HA / PEI / Fe3O4@siRNA; the siRNA in the nanocomplex HA / PEI / Fe3O4@siRNA is siGPX4.

10. Use of the nano - composite HA / PEI / Fe3O4@siRNA as claimed in claim 8 in the preparation of a tumor - treating drug, characterized in that: The drug comprises the nanocomplex HA / PEI / Fe3O4@siRNA.

Images