Composition and method for improving spawning induction efficiency of scatophagus argus and application

Abstract

The invention discloses a composition and method for improving spawning induction efficiency of scatophagus argus and application, the composition comprises Nicol1-17 polypeptide, gonadotropin releaser A4GnRH-A4, domperidone maleate DOM and chorionic gonadotropin HCG, and the amino acid sequence of the Nicol1-17 polypeptide is shown as SEQ ID NO: 6. The Nicol1-17 polypeptide disclosed by the invention has the characteristics of low toxicity and low residue of a polypeptide preparation, side effects and risks possibly brought by a traditional hormone induced spawning scheme are remarkably reduced, and the safety is good; the Nicol1-17 polypeptide realizes efficient targeted regulation and control by accurately activating key reproductive hormone expression of an HPG axis, and breaks through the limitation of traditional hormone broad-spectrum intervention, so that the spawning induction effect is more efficient, stable and reliable.

Description

Technical Field

[0001] The present invention belongs to the fields of aquaculture and biotechnology, and particularly relates to a composition, method and application for improving the induced spawning efficiency of Scatophagus argus. Background Art

[0002] Scatophagus argus is a euryhaline fish with both edible and ornamental values. Due to its delicious meat, low aquaculture cost and strong adaptability, it has important economic value in the aquaculture industry. In recent years, with the growth of market demand, the contradiction between supply and demand of Scatophagus argus fry has become increasingly prominent. However, there are still many limitations in traditional artificial induced spawning techniques, such as low induced spawning success rate, unstable fertilization rate and poor post-spawning survival rate. These factors seriously restrict the large-scale production of fry, and new induced spawning strategies are urgently needed to improve the reproductive efficiency.

[0003] The ovarian development of fish is mainly regulated by the hypothalamic-pituitary-gonadal axis (HPG axis). Among them, gonadotropin-releasing hormone (GnRH) can stimulate the pituitary gland to synthesize and secrete follicle-stimulating hormone (Fsh) and luteinizing hormone (Lh), which regulate the early development of follicles and the final ovulation process respectively. However, due to the obvious interspecies differences in the secretion patterns of gonadotropins (GtHs) in teleost fish, the induced spawning effects of traditional exogenous hormone induced spawning programs are different in different fish species, resulting in unstable induced spawning effects and prominent species-specific obstacles, further affecting their popularization and application.

[0004] In this context, exploring new reproductive regulatory factors has become an important research direction for improving fish reproductive efficiency. Nicol1 is a new polypeptide gene that is significantly expressed in tissues such as the brain, pituitary gland and gonads of vertebrates, and plays an important role in the process of mammalian sperm maturation by regulating the lumicrine signaling pathway. However, the role of Nicol1 in fish reproductive regulation is not yet clear, and whether it can be used as an induced spawning agent in artificial reproduction remains to be studied.

[0005] Compared with traditional hormonal induced spawning methods, polypeptide active substances have the advantages of high efficiency, low immunogenicity and no toxic and side effects. The present invention intends to study the new uses of the Scatophagus argus Nicol1 gene and its expressed mature peptide Nicol1-17 (Nicol1-17 polypeptide) in the induced spawning of Scatophagus argus, and deeply explore its specific action mechanism and actual application effect on the HPG axis. Through the precise regulation of Nicol1, it is expected to break through the bottleneck of existing induced spawning techniques, significantly improve the reproductive efficiency and fry quality, and provide an innovative technical solution for the artificial reproduction of Scatophagus argus. Summary of the Invention

[0006] The purpose of the present invention is to provide a composition for improving the induced spawning efficiency of Scatophagus argus.

[0007] The object of the present invention also lies in providing a method for improving the induced spawning efficiency of Scatophagus argus.

[0008] The last object of the present invention lies in providing the application of the above composition in the preparation of a drug for improving the induced spawning efficiency of Scatophagus argus.

[0009] The above first object of the present invention can be achieved by the following technical solution: A composition for improving the induced spawning efficiency of Scatophagus argus, the composition comprising Nicol1-17 polypeptide, gonadotropin-releasing hormone A4 (GnRH-A4), domperidone maleate (DOM) and human chorionic gonadotropin (HCG), and the amino acid sequence of the Nicol1-17 polypeptide is as shown in SEQ ID NO: 6.

[0010] The Nicol1-17 polypeptide of the present invention is a mature polypeptide derived from the Nicol1 gene of Scatophagus argus, and when used in combination with gonadotropin-releasing hormone A4 (GnRH-A4), domperidone maleate (DOM) and human chorionic gonadotropin (HCG), can significantly improve the induced spawning success rate, fertilization rate and the post-spawning survival rate of broodstock of Scatophagus argus.

[0011] The present invention uses molecular cloning technology to isolate and identify the Nicol1 gene from Scatophagus argus tissues. Its cDNA has a full length of 405 bp, an open reading frame (ORF) of 273 bp, encoding 90 amino acid residues, and has a high homology in Perciformes fish. Based on NeuroPred cleavage site analysis, the mature peptide fragment Nicol1-17 of Nicol1 in Scatophagus argus was predicted.

[0012] The RT-PCR experimental results of the present invention show that the Nicol1 gene is highly expressed in the key tissues (brain, pituitary gland, gonad) of the reproductive axis of Scatophagus argus, indicating that it may participate in reproductive regulation by regulating the HPG axis.

[0013] The present invention further adopts in vitro incubation experiments to analyze the regulatory effect of Nicol1-17 polypeptide on the expression of genes related to the reproductive axis of Scatophagus argus. The experimental results show that after treatment with different doses of Nicol1-17 (incubated for 3 hours and 6 hours), the expressions of cGnRH, sbGnRH and sGnRH in the hypothalamus and Lh and Fsh mRNA in the pituitary gland are significantly up-regulated to varying degrees, and show a certain dose-dependence. These results indicate that Nicol1-17 can effectively promote the expression of key reproductive hormone genes upstream of the reproductive axis of Scatophagus argus, and has potential application value as a new type of fish spawn inducer.

[0014] Preferably, the dose of the Nicol1-17 polypeptide is 5-15 μg / kg of Scatophagus argus.

[0015] More preferably, the dosage of the Nicol1-17 polypeptide is 10 μg / kg of golden fish.

[0016] Preferably, the dosage of the gonadotropin-releasing hormone A4 GnRH-A4 is 23-45 μg / kg of golden croaker, the dosage of the dioxin maleate DOM is 18-35 mg / kg of golden croaker, and the dosage of the human chorionic gonadotropin HCG is 500-1000 IU / kg of golden croaker.

[0017] As a preferred embodiment of the present invention, the gonadotropin releasing hormone A4 GnRH-A4, dioxigenin maleate DOM and chorionic gonadotropin HCG are administered three times. The first administration of gonadotropin releasing hormone A4 GnRH-A4 and dioxigenin maleate DOM, the dosage of gonadotropin releasing hormone A4 GnRH-A4 is 3-5 μg / kg golden fish, and the dosage of dioxigenin maleate DOM is 3-5 mg / kg golden fish; the second administration of gonadotropin releasing hormone A4 GnRH-A4 and dioxigenin maleate DOM, the dosage of gonadotropin releasing hormone A4 GnRH-A4 is 5-10 μg / kg golden fish, and the dosage of dioxigenin maleate DOM is 5-10 mg / kg golden fish; the third administration of gonadotropin releasing hormone A4 GnRH-A4, dioxigenin maleate DOM and chorionic gonadotropin HCG, the gonadotropin releasing hormone A4 The dosage of GnRH-A4 is 15-30 μg / kg of golden croaker, the dosage of dioxin maleate DOM is 10-20 mg / kg of golden croaker, and the dosage of human chorionic gonadotropin HCG is 500-1000 IU / kg of golden croaker.

[0018] Preferably, the Nicol 1-17 polypeptide is administered for the third time.

[0019] The above-mentioned second object of the present invention can be achieved by the following technical scheme: a method for improving the efficiency of induced spawning of golden croaker, comprising applying the composition to the golden croaker.

[0020] Preferably, the administration is by intraperitoneal injection.

[0021] The last object of the present invention can be achieved by the following technical solution: use of the above-mentioned composition in the preparation of a drug for improving the efficiency of inducing spawning in golden croaker.

[0022] The present invention adopts a method of combining conventional oxytocin and compares and analyzes the maturation and ovulation of golden croaker. The experimental results show that the medium dose (10 μg / kg Nicoll-17) group shows the best effect in the process of golden croaker inducing labor, and the labor induction rate, fertilization rate and postpartum survival rate are respectively improved by 26.7%, 14.3% and 10% compared with the control group. These data show that Nicoll-17 significantly improves the labor induction effect of conventional oxytocin, not only improves the labor induction success rate, but also improves the fertilization rate and postpartum survival rate of the mother, showing its broad application prospects in artificial breeding technology of aquaculture.

[0023] Therefore, from the perspective of molecular mechanism and practical application results, Nicol1-17 mature peptide has significant reproductive function. The mature peptide Nicol1-17 encoded by the fish Nicol1 gene proposed in the present invention can effectively promote fish reproduction and can be used together with conventional oxytocin as a drug to improve the efficiency of oxytocin in goldfish.

[0024] The present invention has the following advantages:

[0025] (1) Security

[0026] The Nicol1 gene and its mature peptide Nicol1-17 in the present invention have the low toxicity and low residue characteristics of polypeptide preparations, which significantly reduce the risk of side effects that may be caused by traditional hormone-induced labor. When used in combination with conventional induced labor drugs, Nicol1-17 not only has no adverse effects on fish health, but also can improve postpartum survival rate (+10%), reduce potential threats to the environment and parent fish health, and embody higher safety.

[0027] (2) Efficiency

[0028] Nicol1-17 achieves efficient targeted regulation by precisely activating the expression of key reproductive hormones in the HPG axis, breaking through the limitations of traditional broad-spectrum hormone intervention. Experimental results show that the induction rate was increased to 86.7% (60% in the control group) and the fertilization rate was increased by 14.3%, fully demonstrating its excellent performance in improving the efficiency of induction of labor, and providing an innovative induction plan suitable for golden croaker, making the induction effect more stable and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0030] Figure 1 : It is the Nicol1 ORF sequence and the deduced amino acid sequence of the golden croaker in Example 1 of the present invention. The signal peptide is underlined, the Nicol1-17 mature peptide is shaded, and the box indicates the predicted cleavage site.

[0031] Figure 2 This is the multiple amino acid alignment of Nicol1 among species in Example 1 of the present invention. The mature peptide is underlined, and the potential cleavage sites are boxed;

[0032] Figure 3 This is the expression analysis of Nicol1 gene in various tissues of female and male Scatophagus argus in Example 2 of the present invention. The expression of Nicol1 mRNA in different tissues of female and male Scatophagus argus, with β-actin as the internal reference gene, Br, brain; Pi, pituitary; Li, liver; Ki, kidney; He, heart; Mu, muscle; In, intestine; Sp, spleen; Gi, gill; Go, gonad; St, stomach; Hk, head kidney; Nc, negative control;

[0033] Figure 4 This is the effect of in vitro incubation of Nicol1-17 mature peptide on the expression of cGnRH, sbGnRH, sGnRH in the hypothalamus and Lh, Fsh mRNA in the pituitary of Scatophagus argus in Example 3 of the present invention. The hypothalamus and pituitary of Scatophagus argus were incubated in vitro with different doses of Nicol1-17 for 3 hours and 6 hours respectively. The values are expressed as mean ± standard error (n = 3), * indicates significant difference compared with the control group (P < 0.05); ** indicates extremely significant difference compared with the control group (P < 0.01); *** indicates extremely significant difference compared with the control group (P < 0.001). Detailed implementation manners

[0034] The following examples are used to further explain the present invention, but the examples do not limit the present invention in any form.

[0035] The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions.

[0036] The experimental methods used in the following implementation methods are all conventional experimental methods without special instructions.

[0037] The terms used in the following implementation methods and examples generally have the meanings commonly understood by those of ordinary skill in the art unless otherwise specified.

[0038] Example 1 Cloning and sequence analysis of Nicol1 gene of Scatophagus argus

[0039] 1. Extraction and detection of total RNA from various tissues of Scatophagus argus

[0040] The Scatophagus argus used in the experiment was purchased from the Xiashan Aquatic Products Wholesale Market in Zhanjiang City, Guangdong Province. Three healthy male and three healthy female individuals were selected. After anesthesia with 100 mg / L MS-222 (Sigma, USA), they were decapitated and sacrificed, and tissues such as the brain, gonad, pituitary gland, kidney, liver, intestine, heart, muscle, stomach, spleen, head kidney, and gill were quickly separated. Each tissue sample was immediately frozen in liquid nitrogen and stored in a -80 °C refrigerator for later use.

[0041] RNA extraction was carried out according to the operation instructions of the Trizol kit (Invitrogen, USA). Total RNA of each tissue was extracted in an enzyme-free environment for tissue expression analysis and gene cloning and identification. The extracted RNA was detected for integrity by 1.5% agarose gel electrophoresis, and the RNA concentration was measured using a nucleic acid-protein analyzer. Finally, the samples were stored in a -80 °C refrigerator.

[0042] 2. Preparation of cDNA by Reverse Transcription

[0043] Take 1 μg of total RNA samples from each tissue of Scatophagus argus, and use DNase to remove genomic DNA contamination. Reverse transcription was carried out using the PrimeScript TM RT reagent Kit with gDNA Eraser (Takara, Japan) to synthesize cDNA, which was stored in a -20 °C refrigerator for later use.

[0044] 3. Primer Design

[0045] Based on the comparison with the GenBank database and the Scatophagus argus transcriptome database, the highly conserved region of Scatophagus argus Nicol1 was identified, and full-length primers were designed using NCBI Primer-Blast for gene subcloning. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0046] The designed primers are shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0047] Nicol1-F: CAATTCTAGGTCGGCATCTTAC (SEQ ID NO: 1);

[0048] Nicol1-R: GACGGACGCGTCCTCAGGTGTC (SEQ ID NO: 2).

[0049] 4. Cloning of the Scatophagus argus Nicol1 Gene

[0050] Using the first strand of the synthesized cDNA as a template, PCR amplification was carried out using the above primers.

[0051] The total volume of the RT-PCR amplification reaction system was 50 μL, including: 25 μL of 2×PCR SuperMix (containing dye), 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of cDNA template, and 22 μL of DEPC-treated water.

[0052] The PCR amplification program was: pre-denaturation at 95°C for 2 min, 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, for 35 cycles, and final extension at 72°C for 10 min.

[0053] The PCR products were detected by 1.5% agarose gel electrophoresis, the target bands were cut out, and purified using a DNA gel extraction kit. The recovered products were ligated to the pEASY-T3 vector and transformed into DH5α competent Escherichia coli. They were cultured on an LB solid medium containing ampicillin at 37°C, positive monoclonal colonies were screened, and sent to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing.

[0054] BLAST alignment analysis confirmed that the cloned gene was Nicol1 of Scatophagus argus.

[0055] 5. Sequence analysis of Nicol1 gene

[0056] The DNAstar software was used to predict the open reading frame (ORF) of the Nicol1 gene and translate its amino acid sequence; the SignalP web tool was used to predict the signal peptide of Nicol1; the NeuroPred tool was used to predict the cleavage sites of neuropeptide precursors; multiple sequence alignment analysis was performed to compare the similarity of Nicol1 of Scatophagus argus with other species.

[0057] The results of sequence analysis were as Figure 1 shown. The full-length cDNA of the Nicol1 gene of Scatophagus argus was 405 bp (as shown in SEQ ID NO: 3), the ORF length was 273 bp (as shown in SEQ ID NO: 4, including the stop codon TGA), encoding 90 amino acids (AA) (as shown in SEQ ID NO: 5), the predicted molecular weight of the protein was 9.81 kDa, and the theoretical isoelectric point was 5.21. This protein contained a signal peptide composed of 26 AAs. NeuroPred analysis predicted that the mature peptide Nicol1-17 of Nicol1 was composed of 17 amino acid residues (TAFNLDARTETLVLRAE) (as shown in SEQ ID NO: 6).

[0058] The results of sequence alignment were as Figure 2 shown. There were significant differences between the Nicol1 precursor polypeptides of fish and mammalian sequences, but they had high conservation among fish, indicating that it might play a conserved physiological function in teleosts.

[0059] Example 2 Tissue expression analysis of Nicol1 gene of Scatophagus argus

[0060] 1. RNA Extraction and cDNA Synthesis

[0061] Total RNA was extracted from different tissues of Scatophagus argus, such as brain, gonad, pituitary, kidney, liver, intestine, heart, muscle, stomach, spleen, head kidney and gill. RNA extraction was performed using a Trizol kit (Invitrogen, USA) under RNase-free conditions according to the operating instructions.

[0062] Reverse transcription was carried out using PrimeScript TM RT reagent Kit with gDNA Eraser (Takara, Japan) for cDNA synthesis to remove genomic DNA contamination, obtaining cDNA of each tissue, and storing it at -20 °C in the refrigerator for later use.

[0063] 2. RT-PCR Amplification and Electrophoresis Detection

[0064] Using the cDNA of each tissue as a template, RT-PCR amplification was performed with β-actin as an internal reference gene.

[0065] The total volume of the RT-PCR amplification reaction system was 20 μL, including: 10 μL of 2×PCR SuperMix (containing dye), 0.5 μL each of the upstream and downstream primers (the same as above), 1 μL of cDNA template, and 8 μL of DEPC-treated water.

[0066] The PCR amplification program was: pre-denaturation at 95 °C for 2 min, 30 s at 94 °C, 30 s at 60 °C, 30 s at 72 °C, 35 cycles, and final extension at 72 °C for 10 min.

[0067] The PCR products were separated by 1.5% agarose gel electrophoresis, and the gel images were taken using a fully automatic digital gel imaging analysis system (Tanon-1600, Tianneng, Shanghai), and semi-quantitative analysis was performed.

[0068] 3. Result Analysis

[0069] Figure 3 The expression patterns of the Nicol1 gene in different tissues of female and male Scatophagus argus were shown, with β-actin as an internal reference gene. The abbreviations of each tissue are as follows: Br, brain; Pi, pituitary; Li, liver; Ki, kidney; He, heart; Mu, muscle; In, intestine; Sp, spleen; Gi, gill; Go, gonad; St, stomach; Hk, head kidney; Nc, negative control.

[0070] Figure 3The results in [it] showed that the expression level of Nicol1 gene was relatively high in the brain, pituitary gland and gonads of male Scatophagus argus, medium in the heart, and low in other tissues. In female Scatophagus argus, it was also highly expressed in the brain, pituitary gland and gonads, medium in the liver and spleen, and low in the remaining tissues.

[0071] It is worth noting that the high expression of Nicol1 in tissues related to the HPG axis (hypothalamus-pituitary-gonad axis) (brain, pituitary gland, gonads) suggests that this gene may be involved in the reproductive regulation of Scatophagus argus by regulating the HPG axis.

[0072] Example 3 Effects of Nicol1-17 in vitro incubation on the expression of genes related to reproduction in Scatophagus argus

[0073] 1. Tissue isolation and culture

[0074] After anesthetizing Scatophagus argus with 100 mg / L MS-222 (Sigma, USA), the hypothalamus and pituitary gland were quickly isolated and washed 3 times with M-199 medium (Gibco, USA) to remove blood and impurities.

[0075] The hypothalamus and pituitary gland tissues were cut into small pieces and evenly distributed into 12-well culture plates. 2 mL of M-199 medium was added to each well, and penicillin (100 IU / mL) and streptomycin (100 μg / mL) were added to the medium to prevent microbial contamination. The tissues were cultured in a 5% CO2 humidified incubator. After pre-incubating at 25 °C for 2 hours, the M-199 medium containing different doses of Nicol1-17 polypeptide was replaced. The doses in the experimental groups were set as 0.1, 1, and 10 μM, and the control group did not contain Nicol1-17 polypeptide (n = 3).

[0076] The Nicol1-17 polypeptide was synthesized by GL Biochem (Shanghai) Ltd., China. The N-terminus was acetylated and the C-terminus was amidated. This modification can improve the stability and biological activity of the polypeptide, reduce its immunogenicity, and improve its drug properties. The purity of the synthesized Nicol1-17 polypeptide was 98.20% detected by analytical high performance liquid chromatography.

[0077] 2. Sample collection and qPCR detection

[0078] Tissue samples were collected at 3 hours and 6 hours after incubation respectively, quickly frozen and stored at -80 °C for subsequent gene expression analysis. qPCR was used to detect the regulatory effects of Nicol1-17 on key reproductive regulatory genes sGnRH, sbGnRH, cGnRH, Lh, and Fsh.

[0079] The total volume of the qPCR amplification reaction system was 10 μL, including: 5 μL of 2×Green qPCR SuperMix, 0.4 μL each of the upstream and downstream primers (Table 1), 1 μL of cDNA template, and 3.2 μL of DEPC-treated water.

[0080] Table 1 Primers used in the qPCR amplification reaction system for 5 reproduction-related genes

[0081]

[0082] The qPCR conditions were as follows: denaturation at 95°C for 1 min, followed by 35 cycles (fluorescence data collection) of 95°C for 15 s, 60°C for 30 s, and 72°C for 20 s. The reference gene β-actin was used to normalize the expression values. The values were expressed as mean ± standard error (n = 3).

[0083] 3. Result analysis

[0084] Figure 4 The results showed that Nicol1-17 treatment could significantly up-regulate the expression of genes related to reproductive regulation. After incubation for 3 hours, the 0.1 μM and 10 μM doses significantly increased the expression levels of sGnRH and Lh mRNA, respectively. After incubation for 6 hours, each dose group still showed a regulatory effect: the 0.1 μM group significantly up-regulated cGnRH, the 1 μM group significantly up-regulated sbGnRH, sGnRH, and Lh, while the 10 μM group significantly up-regulated the expression of sbGnRH, sGnRH, Lh, and Fsh mRNA. These results indicate that Nicol1-17 can activate key reproductive hormone genes upstream of the HPG axis in a short time, may play an important role in fish reproductive regulation, and has the potential application prospect as a new type of fish oxytocic.

[0085] Example 4 Effect of combined use of Nicol1-17 and conventional oxytocic drugs on the oxytocic effect of Scatophagus argus

[0086] This example explored the effect of the combined use of the mature peptide of Nicol1-17 and conventional oxytocic drugs on the oxytocic effect, and investigated the optimal oxytocic dose of the mature peptide of Nicol1-17.

[0087] 1. Experimental design and grouping

[0088] During the breeding season of Scatophagus argus, 120 female Scatophagus argus over 2 years old (weight range: 450 ± 50 g), with healthy physique and after maturation cultivation, were randomly divided into the following 4 groups, with 30 tails in each group:

[0089] Control group: conventional oxytocic drug regimen;

[0090] Low-dose group: Conventional oxytocic drug regimen + 1 μg / kg Nicol1-17 (the third injection, the same source as in Example 3, the same below);

[0091] Medium-dose group: Conventional oxytocic drug regimen + 10 μg / kg Nicol1-17 (the third injection);

[0092] High-dose group: Conventional oxytocic drug regimen + 100 μg / kg Nicol1-17 (the third injection).

[0093] Feeding conditions:

[0094] All experimental fish were raised in a circular water bucket with a diameter of 1 m and a depth of 1 m. The water temperature was maintained at 28.0 ± 0.5 °C through a constant temperature system, the dissolved oxygen > 6 mg / L, pH 7.8 - 8.2. The daily light cycle was 14 hours of light + 10 hours of darkness. High-protein bait (crude protein ≥ 40%) was fed twice a day for 7 days to adapt to the environment.

[0095] 2. Oxytocic regimen and operation

[0096] Injection method:

[0097] The three-injection method was adopted, with an interval of 24 hours between each injection (the optimal time window determined based on preliminary experiments). The gonadotropin-releasing hormone A4 (GnRH-A4), domperidone maleate (DOM), human chorionic gonadotropin (HCG), and Nicol1-17 polypeptide used were all dissolved in 0.9% physiological saline and injected intraperitoneally, with an injection volume of 1 mL / kg. The specific regimen is shown in Table 2:

[0098] Table 2 Three-injection oxytocic regimen for Scatophagus argus and Nicol1-17 dose gradient table

[0099]

[0100] 3. Data collection and statistics

[0101] Evaluation indicators:

[0102] Oxytocic rate (%) = Number of spawning individuals / Total number of experimental fish × 100%;

[0103] Fertilization rate (%) = Number of fertilized eggs / Total number of spawned eggs × 100%;

[0104] Postpartum survival rate (%) = Number of surviving broodstock 7 days after spawning / Total number of spawning broodstock × 100%.

[0105] 4. Result analysis

[0106] As shown in Table 3, the application of Nicol1-17 during the induced spawning of Scatophagus argus showed a dose-dependent promoting effect, especially the medium dose group of 10 μg / kg had the most significant effect. The specific results are as follows:

[0107] In terms of the induced spawning success rate, the medium dose group reached 86.7%, significantly higher than the 60.0% of the control group (p < 0.05), with an increase of 26.7 percentage points. The low dose group and the high dose group were 73.3% and 76.7% respectively, both higher than the control group, but the differences did not reach the statistically significant level.

[0108] In terms of the fertilization rate, the medium dose group was the highest, at 78.1%; the low dose group and the high dose group were 69.2% and 71.4% respectively. All three were significantly higher than the 63.8% of the control group (p < 0.01). Among them, the fertilization rate of the medium dose group was the highest, increasing by 14.3% compared to the control group.

[0109] In terms of the survival rate of parent fish after induced spawning, the medium dose group was the highest, at 90.0%; the low dose group and the high dose group were 83.3% and 86.7% respectively, both higher than the 80.0% of the control group, but the differences were not statistically significant.

[0110] In summary, the above results indicate that the addition of Nicol1-17 polypeptide can make the conventional induced spawning hormone have a better promoting effect on reproduction. Among them, the medium dose of 10 μg / kg is the optimal dose, which can significantly improve the induced spawning success rate and fertilization rate, and the survival rate of parent fish also increases, providing an effective strategy for improving the artificial breeding efficiency of Scatophagus argus.

[0111] Table 3 Comparison of the induced spawning effects of Scatophagus argus between the experimental group and the control group

[0112] Induction rate (%) Fertilization rate (%) Postpartum survival rate (%) Control group 60.0％ 63.8％ 80.0％ Low-dose group 73.3％ 70.7％ 86.7％ Medium-dose group 86.7％ 78.1％ 90.0％ High-dose group 76.7％ 73.3％ 83.3％

[0113] The present invention identified the function of the mature peptide Nicol1-17 encoded by the fish Nicol1 gene in regulating the reproductive process of fish. Experimental data showed that the Nicol1-17 mature peptide could significantly up-regulate the expression levels of genes related to reproduction in Scatophagus argus, thus providing a theoretical basis at the molecular level for artificial induced spawning.

[0114] On this basis, the present invention designed the induced spawning effect of combining the Nicol1-17 mature peptide with conventional induced spawning drugs for Scatophagus argus. The test results showed that by combining the use of 10 μg / kg of Nicol1-17 mature peptide with conventional induced spawning drugs, the induced spawning efficiency of Scatophagus argus could be significantly improved. This induced spawning efficiency includes but is not limited to increasing the induced spawning success rate, improving the fertilization rate, and improving the survival rate of broodstock after induced spawning. Specifically, the Nicol1-17 mature peptide, as an active substance with the function of promoting the reproductive physiology of Scatophagus argus, can significantly enhance the effect of artificial induced spawning.

[0115] From the perspective of practical application, Nicol1-17 consists of only 17 amino acids to exert its biological function, which significantly reduces the synthesis cost and process complexity, thereby improving its feasibility in actual production.

[0116] Finally, the polypeptide has strong adaptability in artificial induction of labor, good compatibility with existing induction of labor programs, and is suitable for promotion and use in breeding.

[0117] In summary, the present invention provides a solid theoretical basis and technical support for the development of low-cost and efficient goldfish oxytocin through a complete chain from molecular mechanism to practical application, and has significant economic value and broad application prospects.

[0118] The above embodiments are merely examples for demonstrating the technical solutions of the present invention and are not intended to be limitative descriptions of the invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A composition for improving the efficiency of induced spawning of golden croaker, characterized in that: The composition comprises Nicol1-17 polypeptide, gonadotropin-releasing hormone A4 (GnRH-A4), domperidone maleate (DOM) and human chorionic gonadotropin (HCG), and the amino acid sequence of the Nicol1-17 polypeptide is as shown in SEQ ID NO:

4.

2. The composition for improving the induced spawning efficiency of Scatophagus argus according to claim 1, characterized in that, The dosage of the Nicol1-17 polypeptide is 5-15 μg / kg of Scatophagus argus.

3. The composition for improving the induced spawning efficiency of Scatophagus argus according to claim 2, characterized in that, The dosage of the gonadotropin-releasing hormone A4 (GnRH-A4) is 23-45 μg / kg of Scatophagus argus, the dosage of the domperidone maleate (DOM) is 18-35 mg / kg of Scatophagus argus, and the dosage of the human chorionic gonadotropin (HCG) is 500-1000 IU / kg of Scatophagus argus.

4. A method for improving the efficiency of induced spawning of golden croaker, characterized in that: It includes administering the composition according to any one of claims 1-3 to Scatophagus argus.

5. The method for improving the induced spawning efficiency of Scatophagus argus according to claim 4, characterized in that, The mode of administration is intraperitoneal injection.

6. Use of the composition according to any one of claims 1-3 in the preparation of a drug for improving the oxytocic efficiency of Scatophagus argus.

Images