Application of gene PyC1qA, expression vector containing PyC1qA or recombinant protein prepared from expression vector in preparation of antibacterial product
By cloning and expressing the C1qA gene of Huanggai Floyceps, the PyC1qA protein was constructed and purified, and the problem of unclear molecular mechanism of Huanggai Floyceps complement system was solved, and the antibacterial activity against a variety of bacteria was achieved, which improved Huanggai Floyceps' disease resistance.
Patent Information
- Application Number
- CN202510441307.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-07-11
AI Technical Summary
The molecular mechanism of the Huanggai flounder complement system is not fully understood, especially the structure and function of the C1qA gene and its encoding protein need to be studied urgently, resulting in insufficient disease resistance.
The C1qA gene of Huanggai Flounder was cloned and identified, and the expression vector containing PyC1qA was constructed and the recombinant protein was induced in E. coli was induced. PyC1qA protein was obtained through purification and used to prepare antibacterial products.
The prepared PyC1qA protein has obvious antibacterial activity against various bacteria such as Staphylococcus aureus, providing scientific support for studying the immune mechanism of fish and improving the disease resistance of yellow gaitus.
Smart Images

Figure CN120285233A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to the use of a gene PyC1qA, an expression vector containing PyC1qA, or a recombinant protein prepared from the expression vector in the preparation of antibacterial products. Background Art
[0002] Pseudopleuronectes yokohamae is an important marine economic fish, and its aquaculture industry has developed rapidly. However, with the increase in aquaculture density and the change of environmental conditions, P. yokohamae faces more and more disease threats. In order to improve the disease resistance of P. yokohamae, it is particularly important to study its immune mechanism.
[0003] The complement system is a key component of the innate immune system and can recognize and eliminate pathogens through a series of enzymatic reactions. The C1qA protein is the starting molecule of the classical pathway of the complement system and plays an important role in pathogen recognition, immune complex clearance, and regulation of inflammatory responses. Although the C1qA protein of humans and some mammals has been studied in depth, the research on the C1qA gene and its protein function of fish, especially P. yokohamae, is relatively less.
[0004] Existing studies have shown that the complement system of fish plays an important role in resisting pathogen invasion and maintaining immune homeostasis. However, the molecular mechanism of the complement system of P. yokohamae is not fully understood, and the structure and function of the C1qA gene and its encoded protein need to be studied urgently. Summary of the Invention
[0005] Based on the above technical problems, the present invention aims to clone and identify the C1qA gene of P. yokohamae, study its structure and function, and provide scientific support for in-depth understanding of the fish complement system and improving the disease resistance of P. yokohamae.
[0006] The object of the present invention is achieved by the following technical solutions:
[0007] One object of the present invention is to provide the use of a gene PyC1qA, an expression vector containing PyC1qA, or a recombinant protein prepared from the expression vector in the preparation of antibacterial products, and the nucleotide sequence of the PyC1qA is shown as SEQ ID NO.1.
[0008] As a preferred embodiment of the present invention, the antibacterial activity is the inhibition of any one of Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, or Pseudoalteromonas.
[0009] As a preferred embodiment of the present invention, the expression vector containing PyC1qA is constructed according to the following steps:
[0010] The DNA fragment of gene PyC1qA was ligated to the pMD19-T vector to obtain the pMD-PyC1qA plasmid;
[0011] The pMD-PyC1qA plasmid and the pET-30a vector were respectively double digested with EcoRI and KpnI, and the double digested products were ligated to obtain an expression vector containing PyC1qA.
[0012] As a preferred embodiment of the present invention, the recombinant protein was obtained by inducing the expression of the expression vector containing PyC1qA and then purifying it.
[0013] More preferably, the method for inducing the expression and purifying the recombinant protein includes the following steps:
[0014] Extract the total RNA of the tissue of Limanda yokohamae;
[0015] Design amplification primers for the PyC1qA gene containing the C1qA domain, and use the extracted total RNA as a template to perform PCR amplification with the amplification primers;
[0016] The amplification product was ligated to the recombinant vector pMD-PyC1qA to obtain a recombinant plasmid including the PyC1qA gene;
[0017] The recombinant plasmid was transformed into the host cell, cultured and induced for protein expression, and separated and purified to obtain the PyC1qA protein.
[0018] Even more preferably, the amplification primers are:
[0019] PyC1qA-F: 5'-cggggtacca gctgcgacgg acgt-3';
[0020] PyC1qA-R: 5'-ccggaattct taggagaaca gcaggaagcc g-3'.
[0021] Even more preferably, the host cell is Escherichia coli Transetta(DE3).
[0022] Even more preferably, inducing protein expression is carried out by adding a medium containing kanamycin to the culture solution and then culturing, and the final concentration of kanamycin in the medium is 0.25 mM.
[0023] Even more preferably, the temperature for inducing protein expression is 30 °C and the time is 3 h.
[0024] Even more preferably, separation and purification are carried out by protein affinity chromatography.
[0025] More preferably, SDS-PAGE electrophoresis is used to detect whether the protein is expressed.
[0026] More preferably, the recombinant vector pMD-PyC1qA is obtained by ligating the DNA fragment of the PyC1qA gene to the pMD19-T vector.
[0027] In the second aspect of the present invention, a disease-resistant medicament for aquaculture is provided, which uses the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein as the only active ingredient.
[0028] As a preferred embodiment of the present invention, the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein is used to prepare a disease-resistant medicament for the culture of Limanda yokohamae.
[0029] As a preferred embodiment of the present invention, the disease-resistant medicament is compounded from the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein and a pharmaceutically acceptable excipient or carrier.
[0030] In the third aspect of the present invention, a use of the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein prepared from the expression vector in the preparation of an immune enhancer for aquaculture is provided, and the nucleotide sequence of PyC1qA is as shown in SEQ ID NO.1.
[0031] As a preferred embodiment of the present invention, the immune enhancer uses the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein as the only active ingredient.
[0032] As a preferred embodiment of the present invention, the immune enhancer is compounded from the gene PyC1qA, the expression vector containing PyC1qA, or the recombinant protein and a pharmaceutically acceptable excipient or carrier.
[0033] The excipient or carrier of the present invention is specifically selected according to the preparation dosage form of the disease-resistant medicament or the immune enhancer. Exemplarily, the optional dosage forms of the disease-resistant medicament or the immune enhancer are granule, powder, suspension, etc. Exemplarily, the excipients that can be selected are wetting agents, suspending agents, solubilizers, surfactants, flavoring agents, antioxidants, preservatives, or conventional feeds for aquaculture.
[0034] Compared with the prior art, the beneficial effects of the present invention:
[0035] The present invention utilizes the method of prokaryotic expression, designs specific primers according to the genome sequence of Limanda yokohamae, obtains the PyC1qA gene through PCR, ligates the obtained gene onto pET30a, transfers it into Escherichia coli for induced expression, and can express a high yield of PyC1qA protein in 4-5 hours. After purification, the target protein is successfully obtained. The PyC1qA protein prepared by the present invention can bind to Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, and Pseudoalteromonas, etc., and has obvious antibacterial activity. This method can be used for in-depth study of the immune mechanism of Limanda yokohamae and reveal the important role of the complement system in fish immunity. Description of the Drawings
[0036] Figure 1 The PAGE gel and Coomassie brilliant blue staining detection results of the effects of different induction temperatures and IPTG concentrations on the expression level of PyC1qA protein in Example 2, where M is the protein marker, ① is induced at 37 °C with an IPTG concentration of 1 mmol / L; ② is induced at 30 °C with an IPTG concentration of 1 mmol / L; ③ is induced at 37 °C with an IPTG concentration of 0.25 mmol / L; ④ is induced at 30 °C with an IPTG concentration of 0.25 mmol / L; ⑤ is induced at 37 °C with an IPTG concentration of 0 mmol / L; ⑥ is the empty vector induced at 37 °C with an IPTG concentration of 0.25 mmol / L.
[0037] Figure 2 The protein specificity detection results in Example 2;
[0038] Figure 3 The expression results of the large-scale induction of PyC1qA protein in Example 2, where M is the protein marker; ① and ② are samples induced at 30 °C with an IPTG concentration of 0.25 mmol / L in 500 mL of medium; ③ is the empty vector induced at 30 °C with an IPTG concentration of 0.25 mmol / L.
[0039] Figure 4 The PAGE gel and Coomassie brilliant blue staining detection results of the protein samples obtained in each step of the PyC1qA protein purification method in Example 2, M is the protein marker; ① is the loading supernatant; ② is the supernatant after flow-through; ③ is 10 mL before washing with the equilibration buffer; ④ is 10 mL after washing with the equilibration buffer; ⑤ is 10 mL before elution with eluent ①; ⑥ is 10 mL after elution with eluent ①; ⑦ is 10 mL before elution with eluent ②; ⑧ is 10 mL after elution with eluent ②; ⑨ is 10 mL before elution with eluent ③; ⑩ is 10 mL after elution with eluent ③; Is 10 mL before elution with eluent ④; Is 10 mL after elution with eluent ④; It is 10 mL before elution with eluent ⑤; It is 10 mL after elution with eluent ⑤.
[0040] Figure 5 It is the experimental result of the binding of rPyC1qA protein to different bacteria in Example 3;
[0041] Figures 6 - 13 It is the experimental result of the antibacterial activity of rPyC1qA protein against different bacteria in Example 4. Specific implementation manners
[0042] The raw materials and equipment used in the present invention are all known products without special description, and are obtained by purchasing commercially available products.
[0043] The fish complement system plays an important role in resisting pathogen invasion and maintaining immune homeostasis. However, the molecular mechanism of the complement system of the yellowfin sole is not fully understood, and the structure and function of the C1qA gene and its encoded protein need to be studied urgently.
[0044] Based on this, the present invention provides the use of a gene PyC1qA, an expression vector containing PyC1qA, or a recombinant protein prepared from the expression vector in the preparation of antibacterial products, and the nucleotide sequence of PyC1qA is shown in SEQ ID NO.1.
[0045] The present invention designed specific primers according to the yellowfin sole genome sequence, obtained the PyC1qA gene by PCR, ligated the obtained gene to pET30a, and transferred it into Escherichia coli for induction expression to obtain a high-yield PyC1qA protein. The PyC1qA protein prepared by the present invention can bind to Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, and Pseudoalteromonas sp., etc., and has obvious antibacterial activity.
[0046] The Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Vibrio anguillarum, Vibrio vulnificus, Vibrio alginolyticus, Vibrio splendidus, Aeromonas hydrophila, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, Pseudoalteromonas sp., and Shewanella baltica involved in the present invention were all purchased from Ningbo Minghai Biotechnology Co., Ltd.
[0047] Example 1
[0048] Construction of pET-PyC1qA recombinant plasmid
[0049] S1. Total RNA extraction:
[0050] (1) Preparation: Pre-cool the homogenizer. Wipe the pipettes and the experimental bench used during the experiment with alcohol. The centrifuge tubes and pipette tips should be RNase-free.
[0051] (2) Homogenize or lyse the samples (such as cells or tissues) of Limanda yokohamae in an appropriate amount of TRIzol reagent. Approximately 50 - 100 mg of tissue or 5 - 10 million cells can be processed per 1 mL of TRIzol.
[0052] (3) Let the homogenized samples stand at room temperature for 5 minutes to ensure complete lysis.
[0053] (4) Add 200 μL of chloroform (or 100 μL of chloroform substitute) to each 1 mL of TRIzol, shake vigorously for 15 seconds, and then let it stand at room temperature for 2 - 3 minutes.
[0054] (5) Centrifuge at 12000g for 15 minutes at 4°C. The sample will be separated into three layers: the upper aqueous phase (containing RNA), the middle white interface (containing DNA), and the lower organic phase (containing proteins).
[0055] (6) Transfer the upper aqueous phase to a new centrifuge tube. Add an equal volume of isopropanol to each 1 mL of the aqueous phase, mix well, and let it stand at room temperature for 10 minutes. Centrifuge at 12000g for 10 minutes at 4°C. RNA will precipitate to form a white pellet.
[0056] (7) Carefully discard the supernatant, and wash the RNA pellet with 75% ethanol. Add 1 mL of 75% ethanol to each 1 mL of TRIzol, mix gently. Centrifuge at 7500g for 5 minutes at 4°C. Discard the ethanol, and repeat this step twice.
[0057] (8) After discarding all the supernatant, air-dry the RNA pellet for a few minutes, but do not over-dry it. Dissolve the RNA pellet in 30 - 50 μL of RNase-free water.
[0058] (9) Take 5 μL of the RNA sample for detection by 1% agarose gel electrophoresis, take 2 μL of the RNA sample to measure the concentration and purity of the sample with a NanoDrop spectrophotometer. Store the remaining RNA samples at -80°C for future use, and the storage time should not exceed one week.
[0059] S2. PCR Amplification Reaction and Nucleic Acid Electrophoresis
[0060] (1) Primer Design
[0061] Using the full-length sequence of PyC1qA of Limanda yokohamae (the sequence is as shown in SEQ ID NO:1), primer pairs were designed using SanpGene 6.0.2 (the sequences are as shown in SEQ ID NO:2 and SEQ ID NO:3). The PCR reaction system is shown in Table 1.
[0062] Table 1 PCR reaction system (50 μl)
[0063]
[0064] PCR reaction program: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, a total of 35 cycles, and finally extension at 72°C for 10 min.
[0065] SEQ ID NO:1:
[0066] atgggaggtt attatgggat ggctgttctg gtgggcgtgg ctttgcttct gaaggccggcccatgcgacg cgagctgcga cggacgtcca ggcgtggtag gatcccccgg cagggacggg tgggccggagtgaagggaga gaaaggagaa ccagatgctg cgatggctga caggtcggtt gatgaaggcg tcctacagaggatgaagggg ccgatgggaa gtcaaggtgt gcaaggagcc atgggtcaga aaggtttcag aggagatctgggagcagcag gtcaaccggg acgacctggc ccccccggcc ctgaggggag cagcatcaac cttggtcaagactcctctca acaggccgtt tcagctttct cagtgatcag gacggagagc agttaccctc gatacaaccagcctgtgatc ttccagacga ctgtggtcaa cagaggcaga gacttctctg cagccacagg ttacttcacctgcagagtac cgggcgtgta ttacttcacc tttcactctg gggccaaggt cagcatgtgt ctgcgtctggccagcgaggc tctggccaac aaactgggat tctgtgatca aaacaggaac aatgatcagg tgctgtcaggcggcgcggtg cttgagctga aggtcggaca gaaggtttgg ctcgagtcct tcaaggacca gcagacggattctgaggcaa gagacacgca agaaaaatcc atcatcttca acggcttcct gctgttctcc taa
[0067] PyC1qA-F: 5'-cggggtacca gctgcgacgg acgt-3', SEQ ID NO:2;
[0068] PyC1qA-R: 5'-ccggaattct taggagaaca gcaggaagcc g-3', SEQ ID NO:3.
[0069] (2) Perform agarose gel electrophoresis on the PCR products to check whether the band bp is consistent with the design.
[0070] S3. Construction of the cloning vector pMD-PyC1qA
[0071] (1) Purify the PCR products obtained in S2.
[0072] (2) Ligation and transformation
[0073] Ligation: Mix the purified DNA with the pMD19-T vector and ligate at 16°C for 30 min. The ligation system (10 ul) includes: 4 ul of the recovered product, 5 ul of solution I, and 1 ul of the pMD19-T vector.
[0074] Transformation:
[0075] ① Take out the E. coli (DH5α) competent cells from the -80°C refrigerator and place them on ice for slow thawing;
[0076] ② Add 1 ul of the ligation product to the thawed competent cells, shake well, and place on ice for 50 min. During this period, gently shake the mixture every 10 min to ensure that the competent cells are fully mixed with the ligation product;
[0077] ③ Place the mixture in a 42°C water bath for heat shock for 45 sec, then quickly transfer it to ice and cool for 2 min;
[0078] ④ Perform aseptic operation on the ultra-clean workbench, add 1 ml of liquid medium (without antibiotics) to the centrifuge tube, mix well, and culture at 37°C with shaking for 1 h (120 revolutions per minute);
[0079] ⑤ Centrifuge at 5000 rpm / min for 5 min, discard about 900 ul of the supernatant, add 4 μl of IPTG and 40 ul of X-gal to the centrifuge tube, and use a pipette to blow and open the precipitate to mix it evenly with the reagent;
[0080] ⑥ Use a pipette to aspirate the mixed bacterial solution onto the plate, and use a spreader to spread the bacterial solution evenly (the force should be moderate during the spreading process to prevent breaking the culture medium). Invert the plate and culture it overnight at 37°C (not exceeding 16 h).
[0081] Bacterial strain screening and preservation:
[0082] ① When obvious and non-overlapping single colonies appear on the plate, take out the plate and place it at 4°C for a period of time to make the blue-white colonies clearly distinguishable;
[0083] ②Pick white colonies from the plate, evenly dissolve the colonies in 10 μl of liquid medium, and use this bacterial solution as a template for bacterial solution PCR reaction to detect whether it is a positive clone;
[0084] PCR reaction to detect whether it is a positive clone;
[0085] ①The bacterial solution PCR reaction system (20 μl) is as follows:
[0086] ddH2O: 8 μl, 10×Taq Buffer: 2 μl, dNTP: 3.2 μl, upstream and downstream primers: 0.8 μl each, template: 5 μl, Taq enzyme: 0.2 μl.
[0087] ②The bacterial solution PCR reaction is as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, a total of 35 cycles, and finally extension at 72°C for 5 min. Store at 4°C.
[0088] Perform nucleic acid electrophoresis to detect whether the amplified fragment meets the designed length.
[0089] Select a tube of bacterial solution with better effect, take out 200 μl, add 200 μl of glycerol, store the preserved bacterial strain at -80°C, and send a part of it to the company for sequencing.
[0090] S4. Construction of expression vector pET-PyC1qA
[0091] (1) Plasmid extraction
[0092] Extract the pMD-PyC1qA plasmid from the bacterial solution obtained in S3.
[0093] (2) Restriction enzyme digestion reaction
[0094] Perform double digestion of the pMD-PyC1qA plasmid and the pET-30a vector with EcoRI and KpnI respectively.
[0095] The restriction enzyme digestion reaction system is as follows:
[0096] Target fragment (plasmid): 2 μl, 10×CutOne TM Buffer, restriction enzyme (LightNing TM EcoRI, KpnI): 1 μl each, ddH2O: make up to 20 μl.
[0097] Restriction enzyme digestion reaction conditions: Incubate at 37°C for 15 min
[0098] Note: Both the pMD-PyC1qA plasmid and the pET-30a vector need to be digested with enzymes. Since gel extraction is required after digestion, two parallel samples need to be prepared for each, that is, 40 μl of the pMD-PyC1qA plasmid and the pET-30a vector are each prepared in two tubes. After the digestion reaction and before electrophoresis detection, it is optional to incubate at 80 °C for 20 min to inactivate the enzyme and stop the reaction.
[0099] (3) Construction of expression vector
[0100] ① Electrophoretically detect the digested pMD-PyC1qA plasmid and pET-30a vector, and perform gel extraction on them respectively.
[0101] ② Ligation reaction
[0102] Ligate the recovered pMD-PyC1qA plasmid fragment with the pET-30a vector fragment to obtain the expression vector pET-PyC1qA.
[0103] The ligation system is as follows:
[0104] Digested expression vector PET-30a: 1 μl, digested pMD-PyC1qA plasmid: 7 μl, T4 ligase: 1 μl, T4 ligase buffer: 1 μl.
[0105] Reaction conditions: 25 °C, 2 h.
[0106] ③ Transform the constructed expression vector pET-PyC1qA into competent cells E.coli (DH5α) (the steps are the same as those in the transformation step of S3). From this point on, the antibiotic added to the medium is kanamycin.
[0107] ④ Extract the pET-PyC1qA plasmid, transform 1 μl of the plasmid into the expression competent cells Transetta (DE3), and at the same time transform an empty vector pET-30a plasmid without the ligated target fragment as a control.
[0108] ⑤ Pick single colonies from the plates of pET-PyC1qA and pET-30a respectively, and perform colony PCR reactions for preliminary detection.
[0109] ⑥ Select the bacterial liquid with better results for preservation. Incubate at 37 °C with shaking overnight (120 rpm / min), take 200 μl of the bacterial liquid and mix it with an equal volume of glycerol, seal it, and store it at -80 °C.
[0110] Example 2
[0111] PyC1qA expression and purification
[0112] S1. Induced expression
[0113] (1) Mix the bacterial solution containing the pET-PyC1qA plasmid obtained in Example 1 with a liquid medium (containing kanamycin) at a ratio of 50 μl:5 ml. Culture 4 tubes of the bacterial strain containing the expression vector pET-PyC1qA and 1 tube of the bacterial strain with the empty vector pET-30a, 5 ml per tube. The culture conditions are 37 °C and shaking culture at 180 rpm / min for 2 - 3 h until the growth phase of the bacterial strain reaches the logarithmic phase (OD value = 0.4 - 0.6).
[0114] (2) Perform shaking culture at 120 rpm / min for 3 h, and the induction conditions are shown in Table 2.
[0115] Table 2 Induction conditions
[0116]
[0117] (3) Take 1 ml of the induced expression bacterial solution from each tube for inspection, and temporarily store the remaining 4 ml in a 4 °C refrigerator. Centrifuge the taken bacterial solution at 4 °C and 7000 rpm / min for 5 min, discard the supernatant, add 1 ml of 1×PBS, disperse the bacterial cells, then centrifuge again at 4 °C and 7000 rpm / min for 5 min, discard the supernatant, wash the bacteria twice with 1×PBS, and finally resuspend the bacterial cells with 80 μl of 1×PBS.
[0118] (4) Detect by SDS-PAGE electrophoresis
[0119] ① Sample preparation
[0120] The ratio of 5×SDS-PAGE loading buffer to the bacterial solution is 1:4. After mixing, boil the sample in boiling water for 8 min, centrifuge at 4 °C and 12000 rpm / min for 5 min, and aspirate the supernatant for subsequent protein electrophoresis detection;
[0121] ② Gel preparation
[0122] ③ Electrophoresis
[0123] ④ Staining and decolorization
[0124] Detect the histidine tag of the recombinant protein by Western blot
[0125] As Figure 1 shown, when the final concentration of IPTG is 0.25 mmol / L and the induction temperature is 30 °C, the induction effect is the best. As Figure 2 shown, the expressed protein can bind to the His-tag antibody. The above results indicate that the expression vector construction is successful.
[0126] S2. Detection of the solubility of the recombinant protein
[0127] (1) Select a group of expressed proteins for subsequent experiments. The selection criteria are as follows: If there is only one group expressing recombinant proteins, select this group; if there are multiple groups expressing, select the group with the lowest IPTG concentration and the lowest induction temperature in the induction conditions.
[0128] (2) Take out the remaining 4 ml of bacterial liquid stored at 4°C, wash the bacteria following the previous treatment steps, and finally suspend the bacterial cells with 400 μl of 1×PBS.
[0129] (3) Perform ultrasonic disruption at a power of 300 w, working for 3 seconds every 3 seconds until the bacterial liquid becomes clear.
[0130] (4) Centrifuge at 12,000 rpm / min at 4°C for 5 min, save the supernatant and precipitate separately. Wash the precipitate twice with 1×PBS, and finally suspend the precipitate with 1×PBS in an amount equal to that of the supernatant.
[0131] (5) Boil the sample, and perform electrophoresis, staining, and decolorization steps as in (4) of S1.
[0132] S3. Large-scale induction and recombinant protein purification
[0133] (1) Prepare two 1-L conical flasks, configure 1 L of liquid medium containing kanamycin, and fill 500 ml of liquid medium into each conical flask.
[0134] (2) Add 5 ml of the preserved bacterial strain containing the recombinant protein to every 500 ml of liquid medium, and culture it with shaking at 37°C, 120 rpm / min until the logarithmic growth phase of the bacterial cells is reached.
[0135] (3) Add IPTG for induction culture. The culture conditions are selected as an IPTG final concentration of 0.25 mmol / L, a temperature of 30°C, and culture with shaking at 120 rpm / min for 3 h.
[0136] (4) Take out 1 ml of bacterial liquid to detect whether it expresses recombinant proteins, as Figure 3 shown;
[0137] (5) Prepare a sterilized 50-ml centrifuge tube, weigh the centrifuge tube itself, and make a record.
[0138] (6) After centrifugation, collect all the bacterial cells into the above centrifuge tube, weigh the total weight, and subtract the weight of the centrifuge tube to obtain the weight of the bacterial cells.
[0139] (7) Wash the bacterial cells twice with 1×PBS, and resuspend the bacterial cells with the equilibration buffer at a ratio of 1 g of bacterial cells: 35 ml of equilibration buffer.
[0140] (8) Perform ultrasonic disruption on the resuspended bacterial liquid until the bacterial liquid becomes clear, and retain the supernatant.
[0141] Filter the above supernatant with a 0.45-μm filter, and then purify the expressed protein using a protein affinity chromatography column with a histidine tag. The specific steps are as follows:
[0142] The required reagents are shown in Table 3.
[0143] Table 3 Reagents Required for the Purification of the Expressed Protein
[0144]
[0145] Filter the above reagents with a 0.45-μm filter and store them at 4 °C for later use.
[0146] ① Wash the gel: Aspirate the equilibration buffer with a syringe, then connect the syringe to the upper opening of the purification column, unscrew the seal at the lower end of the purification column, and inject the equilibration buffer into the purification column using the syringe. The operation should be slow, and the flow rate should be controlled at 2-3 ml / min to avoid generating bubbles in the gel. The amount of equilibration buffer used for washing the gel is 10 ml;
[0147] ② Load the sample: Aspirate the sample with a syringe and then inject it into the purification column. The operation steps are the same as above. Collect and temporarily retain all the flow-through bacterial liquid to prevent the sample from being reused if the protein does not bind to the column;
[0148] ③ Wash: Wash with the equilibration buffer. The amount of buffer used is 20 ml. The steps are the same as ①. The purpose is to wash off the non-specifically bound bacterial proteins;
[0149] ④ Elute: Perform gradient elution with different imidazole contents. The operation steps are the same as ①. The amount of elution buffer used for each gradient is 20 ml. Collect the first 10 ml of the eluate;
[0150] ⑤ Equilibrate: Wash the purification column with 20 ml of equilibration buffer. The operation steps are the same as ①;
[0151] ⑥ Store: Wash the purification column with 10 ml of 20% ethanol. The operation steps are the same as ①. Finally, leave an appropriate amount of 20% ethanol in the purification column to preserve the gel. Store the purification column at 4 °C.
[0152] ⑦ Use a few drops of the collected liquid from the above sample loading, flow-through, washing, and elution for protein electrophoresis detection.
[0153] The expression result of the PyC1qA protein is as Figure 4 shown. The PyC1qA protein with pET30a as the vector was successfully expressed, and the recombinant protein rPyC1qA was purified.
[0154] Example 3
[0155] The rPyC1qA protein can bind to bacteria
[0156] S1. Incubate the rPyC1qA protein with different bacteria
[0157] The purified recombinant protein (5 μg) was separately mixed with different bacteria (Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Vibrio anguillarum, Vibrio vulnificus, Vibrio alginolyticus, Vibrio splendidus, Aeromonas hydrophila, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, Pseudoalteromonas sp., and Shewanella baltica) at 1 × 10 8 CFU / ml. The mixture was slowly shaken and incubated at 28 °C for 1 hour.
[0158] S2, rPyC1qA could bind to different bacteria
[0159] The mixture was centrifuged at 5000 × g for 5 minutes and washed three times with PBS. After washing, the mixture was centrifuged under the same conditions and the supernatant was removed. At the same time, the precipitate was resuspended in 100 μl of PBS. Finally, the treated sample was added with 5× SDS loading buffer and boiled, and then the binding results were detected by Western blotting. At this time, the primary antibody used was a monoclonal antibody against the His tag. Similarly, the binding of bacteria to PBS was used as a control group.
[0160] The results of the binding of rPyC1qA protein to different bacteria are as Figure 5 shown. The rPyC1qA protein could bind to most bacteria, and the binding ability to different bacteria was different.
[0161] Example 4
[0162] Antibacterial function of rPyC1qA protein
[0163] Various bacteria (Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Vibrio anguillarum, Vibrio vulnificus, Vibrio alginolyticus, Vibrio splendidus, Aeromonas hydrophila, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, Pseudoalteromonas sp., and Shewanella baltica) were cultured in MH liquid medium and resuspended in MH medium at 1 × 10 7 CFU / mL. 100 μL of bacteria containing or not containing PyC1qA protein (100 μg / mL) and PBS (control) were added to a 96-well microtiter plate and incubated for 8 or 10 h, and the OD 600 .
[0164] The results are as Figures 6 - 13 shown. The rPyC1qA protein could significantly inhibit the growth of Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium, and Pseudoalteromonas sp.
[0165] In summary, by cloning and expressing the C1qA gene of the yellow flounder, the present invention not only provides an important tool for studying the complement system of fish, but also provides a new disease-resistant strategy for the aquaculture industry, and has important scientific and application values.
[0166] Obviously, based on the above content of the present invention, according to the common general technical knowledge and conventional means in the art, without departing from the above basic technical idea of the present invention, various other forms of modifications, substitutions or changes can be made.
[0167] The above content of the present invention will be further described in detail below through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention.
Claims
1. Use of a gene PyC1qA, an expression vector containing PyC1qA, or a recombinant protein prepared from the expression vector in the preparation of an antibacterial product, characterized in that, The nucleotide sequence of the said PyC1qA is as shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that, The said antibacterial activity is the inhibition of any one of Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahaemolyticus, Edwardsiella tarda, Escherichia coli, Lactococcus garvieae, Pseudomonas aeruginosa, Salmonella typhimurium or Pseudomonas pseudoalteromonas.
3. The use according to claim 1, characterized in that, The expression vector containing PyC1qA is constructed according to the following steps: The DNA fragment of the gene PyC1qA is ligated to the pMD19-T vector to obtain the pMD-PyC1qA plasmid; The pMD-PyC1qA plasmid and the pET-30a vector are respectively double digested with EcoRI and KpnI, and the double digested products are ligated to obtain the expression vector containing PyC1qA.
4. The use according to claim 3, characterized in that, The said recombinant protein is obtained by inducing the expression of the expression vector containing PyC1qA and then purifying it.
5. A disease-resistant medicament for aquaculture, characterized in that, It uses the gene PyC1qA or the expression vector containing PyC1qA or the said recombinant protein as the only active ingredient as claimed in claim 1.
6. The anti-disease agent for aquaculture according to claim 5, characterized in that, The said gene PyC1qA or the expression vector containing PyC1qA or the said recombinant protein is used for preparing a disease-resistant medicament for the cultivation of Limanda yokohamae.
7. The anti-disease agent for aquaculture according to claim 5, characterized in that, The said disease-resistant medicament is compounded by the said gene PyC1qA or the expression vector containing PyC1qA or the said recombinant protein and a pharmaceutically acceptable excipient or carrier.
8. Use of a gene PyC1qA, an expression vector containing PyC1qA, or a recombinant protein prepared from the expression vector in the preparation of an immune enhancer for aquaculture, characterized in that, The nucleotide sequence of the said PyC1qA is as shown in SEQ ID NO.1 in claim 1.
9. The use according to claim 8, characterized in that, The said immunopotentiator uses the gene PyC1qA or the expression vector containing PyC1qA or the said recombinant protein as the only active ingredient.
10. The use according to claim 8, characterized in that, The said immunopotentiator is compounded by the said gene PyC1qA or the expression vector containing PyC1qA or the said recombinant protein and a pharmaceutically acceptable excipient or carrier.