Gamma-interferon dimer fusion protein as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and relates to a gamma-interferon dimer fusion protein as well as a preparation method and application thereof. The fusion protein has an amino acid sequence as shown in SEQ ID NO. 1. According to the gamma-interferon dimer fusion protein and the preparation method and application thereof, when the prepared fusion protein is used for detecting an IFN-gamma antibody in a sample, especially a blood sample, the antigenicity is high, and the specificity and the sensitivity are high.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and relates to a γ-interferon dimer fusion protein, a preparation method thereof, and uses thereof. Background Art

[0002] Interferon (IFN) is a class of proteins naturally formed by the body's immune system in response to various stimuli when vertebrates are invaded by foreign substances. It is a class of proteins that have broad-spectrum antiviral, anti-cell division, and immunomodulatory effects at least on the same type of cells, and affect cell metabolism, growth, and differentiation in a variety of different ways. Interferon is an important class of cytokines. Through a large number of basic clinical studies, interferon has been found to be an important broad-spectrum antiviral and anti-tumor therapeutic drug.

[0003] There are multiple classifications of human interferons: including -α, β, δ, γ, ε, κ, λ, τ, ω, etc. From different interferon receptors, human interferons are of types I, II, and III. Among them, IFN-α, IFN-β, IFN-τ, and IFN-ω belong to type I interferons, IFN-γ belongs to type II interferon, and IFN-λ belongs to type III interferon.

[0004] γ-Interferon is produced by T cells and NK cells upon stimulation. Natural γ-interferon exists in the form of a dimer aggregated by 2 monomers each containing 143 amino acids, has 2 glycosylation sites, does not contain disulfide bonds, and is unstable to acids.

[0005] Previous studies have shown that IFN-γ has antiviral activity and can be used as a candidate for antiviral therapy development. In addition, IFN-γ has also been found to have antitumor effects. In addition, IFN-γ can also be used as an immunogen to stimulate animals to produce corresponding monoclonal antibodies, and this type of antibody can be used in Elisa or IFN-γ release assay (IGRA) for the diagnosis of tuberculosis infection.

[0006] There have been patent reports on IFN-γ detection methods for auxiliary medical diagnosis and screening, such as the development of a double-antibody sandwich Elisa method using monoclonal antibodies against IFN-γ. Although the selected antibodies specifically bind to IFN-γ, the sensitivity of the methodology is relatively low. Therefore, it is necessary to develop IFN-γ or its derivatives with strong antigenicity and high specificity for IFN-γ antibody detection. Summary of the Invention

[0007] The primary object of the present invention is to provide a γ-interferon dimer fusion protein, which has strong antigenicity, high specificity, and high sensitivity when used for the detection of IFN-γ antibodies in samples, especially blood samples.

[0008] To achieve this purpose, in a basic embodiment, the present invention provides a gamma-interferon dimer fusion protein, and the fusion protein has the amino acid sequence shown in SEQ ID NO.1.

[0009] In a preferred embodiment, the present invention provides a gamma-interferon dimer fusion protein, wherein the fusion protein further adds an Avi-tag sequence and a His-tag sequence at its C-terminus on the basis of the amino acid sequence shown in SEQ ID NO.1,

[0010] The Avi-tag sequence is used for site-directed biotinylation modification thereon, and its sequence is as shown in SEQ ID NO.2,

[0011] The His-tag sequence is as shown in SEQ ID NO.3,

[0012] The amino acid sequence of the fusion protein is as shown in SEQ ID NO.4.

[0013] In a preferred embodiment, the present invention provides a gamma-interferon dimer fusion protein, wherein the fusion protein is a fusion protein biotinylated in the sequence segment shown in SEQ ID NO.2.

[0014] The second object of the present invention is to provide a preparation method of the fusion protein as described above, so as to better prepare the fusion protein as described above. When the prepared fusion protein is used for the detection of IFN-γ antibody in a sample, especially in a blood sample, it has strong antigenicity, high specificity and high sensitivity.

[0015] To achieve this purpose, in a basic embodiment, the present invention provides a preparation method of the fusion protein as described above. The preparation method is to co-express the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding a biotinylation ligase in microorganisms, animal cells or plant cells, and obtain the fusion protein after microbial culture or cell culture and separation and purification.

[0016] In a preferred embodiment, the present invention provides a preparation method of the fusion protein as described above, wherein the amino acid sequence of the biotinylation ligase is as shown in SEQ ID NO.5.

[0017] In a preferred embodiment, the present invention provides a preparation method of the fusion protein as described above, wherein the co-expression is to transfer the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding a biotinylation ligase into a baculovirus expression vector respectively, and then transfect into insect cells for co-expression.

[0018] In a preferred embodiment, the present invention provides a method for preparing the fusion protein as described above, wherein the recombinant plasmid expression vectors constructed after transferring the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding biotin ligase into baculovirus expression vectors are IFN2-pFastbac 1 and birA-pFastbac 1 respectively.

[0019] In a preferred embodiment, the present invention provides a method for preparing the fusion protein as described above, wherein the insect cell is sf9 insect cell.

[0020] In a preferred embodiment, the present invention provides a method for preparing the fusion protein as described above, wherein the separation and purification is carried out by Ni affinity chromatography column.

[0021] The third object of the present invention is to provide the use of the fusion protein as described above as an antigen for detecting γ-interferon antibody in ELISA detection, so that when used in the detection of IFN-γ antibody in a sample, especially a blood sample, it has strong antigenicity, high specificity and sensitivity.

[0022] To achieve this object, in a basic embodiment, the present invention provides the use of the fusion protein as described above as an antigen for detecting γ-interferon antibody in ELISA detection.

[0023] The beneficial effect of the present invention is that by using the γ-interferon dimer fusion protein of the present invention and its preparation method and use, the prepared fusion protein can have strong antigenicity, high specificity and sensitivity when used in the detection of IFN-γ antibody in a sample, especially a blood sample.

[0024] The present invention realizes the site-specific biotinylation modification of γ-interferon dimer fusion protein in vivo by co-expressing γ-IFN2 and birA in insect cells, thus providing a bridge for subsequent site-specific connection of SA magnetic beads, which is very beneficial to the sensitivity and stability of γ-IFN antibody detection reagents.

[0025] The recombinant antigen of the present invention is recombinantly expressed by an insect baculovirus expression system, which greatly improves the solubility of the recombinant protein, solves the problem of insoluble inclusion bodies expressed by Escherichia coli, and creates a better basis for specific purification; the recombinant γ-interferon dimer fusion protein forms a dimer by connecting γ-interferon monomers with a flexible linker, and its conformation is closer to that of the natural protein, and has a better affinity with γ-interferon antibody, which can improve the sensitivity of γ-interferon antibody detection. Brief Description of the Drawings

[0026] Figure 1 It is a structural diagram of the recombinant plasmid expression vector IFN2-pFastbac 1.

[0027] Figure 2 The functional segmentation diagram of the interferon-gamma dimer fusion protein with the amino acid sequence shown in SEQ ID NO.4.

[0028] Figure 3 The structural diagram of the recombinant plasmid expression vector birA-pFastbac1.

[0029] Figure 4 The SDS-PAGE electrophoresis detection result diagram in Example 3 (from left to right, each lane is molecular weight Marker, concentrated supernatant, sample loading flow-through, washing impurity peak 1, washing impurity peak 2, and each peak collected by 20 - 500 mM imidazole gradient elution). Specific implementation manners

[0030] To better understand the technical solution and advantages of the present invention, the following further illustrates the present invention through examples in conjunction with the accompanying drawings.

[0031] Example 1: Construction of the recombinant plasmid expression vector IFN2-pFastbac 1

[0032] Using conventional molecular biology methods, construct the recombinant plasmid expression vector IFN2-pFastbac 1, whose structure is as Figure 1 shown, and insert the gene encoding the interferon-gamma dimer fusion protein with the amino acid sequence shown in SEQ ID NO.4. The functional segmentation of the interferon-gamma dimer fusion protein with the amino acid sequence shown in SEQ ID NO.4 is as Figure 2 shown, wherein: positions 1 - 23 of the amino acid sequence of SEQ ID NO.4 are the signal peptide segment; the sequences of both IFN segments are the amino acid sequences at positions 24 - 166 of the interferon-gamma sequence reported in GenBank:AAB59534.1; the sequence of the linker peptide flexible linker is GGGGSGGGGSGGGGSGGGGS; the sequence of the Avi-tag segment (for site-directed biotinylation modification thereon) is GLNDIFEAQKIEWHE (see SEQ ID NO.2); the sequence of the His10x-tag segment (for affinity chromatography separation and purification) is HHHHHHHHHH (see SEQ ID NO.3).

[0033] The specific construction process of the recombinant plasmid IFN2-pFastbac 1 is as follows:

[0034] 1. Optimize the codons to synthesize the coding gene sequence of IFN2 using the baculovirus expression system;

[0035] 2. Amplify the target gene (i.e., the coding gene of IFN2) with primers,

[0036] The primer pair is: I-F: CCG ATGAAATATACCTCCTACATCCTTG;

[0037] I-R: CCC GTGATGATGGTGGTGGTGGTGATGG;

[0038] PCR reaction system and program design:

[0039]

[0040]

[0041] Reaction program for amplifying IFN2:

[0042]

[0043] 3. Digest the target gene and vector (pFastbac 1) with restriction enzymes EcoRI--HindIII;

[0044] Double digestion system for gene IFN2:

[0045]

[0046] Double digestion system for vector pFastbac 1:

[0047]

[0048] 4. Ligate the target gene and vector pFastbac 1, and transform the ligation product into Escherichia coli TOP10;

[0049] After double digestion, the target gene and vector are purified respectively. The DNA concentration is detected by agarose gel electrophoresis. Select an appropriate ratio and react overnight at 16°C with T4 DNA ligase.

[0050] Ligation system:

[0051]

[0052] After ligation is completed, transform Escherichia coli TOP10 and spread on an Amp-resistant screening plate.

[0053] 5. Pick monoclonal colonies for culture, extract plasmids and sequence to confirm successful construction.

[0054] Example 2: Construction of recombinant plasmid expression vector birA-pFastbac1

[0055] Using conventional molecular biology methods, construct a recombinant plasmid expression vector birA-pFastbac1, whose structure is as shown in Figure 3 and insert the gene encoding the biotin ligase with the amino acid sequence shown in SEQ ID NO.5.

[0056] The specific construction process of the recombinant plasmid birA-pFastbac 1 is as follows: (For specific condition details, refer to the construction process of IFN2-pFastbac 1)

[0057] 1. Optimize the codons of the coding gene sequence of birA using the baculovirus expression system;

[0058] 2. Amplify the target gene (i.e., the coding gene of birA) with primers. The primer pair is: b-F:

[0059] CCG ATGAAAGATAACACCGTTCCACTGA; b-R:

[0060] CCC TTTTTCTGCAGAACGCAGGCTAATC;

[0061] 3. Digest the target gene and the vector (pFastbac 1) with the restriction endonucleases EcoRI--HindIII;

[0062] 4. Ligate the target gene and the vector pFastbac 1, and transform the ligation product into Escherichia coli TOP10;

[0063] 5. Select monoclonal colonies for culture, extract plasmids and sequence to confirm successful construction.

[0064] Example 3: Amplification, transfection, expression and purification of the recombinant plasmid

[0065] The recombinant plasmid expression vectors IFN2-pFastbac 1 and birA-pFastbac1 are respectively transformed into Escherichia coli DH10B competent cells, spread on LB plates containing gentamicin, tetracycline, kanamycin, X-gal and IPTG for blue-white screening culture. After culturing at 37 °C for 2 d, select white colonies and culture them in 100 mL of LB medium containing gentamicin, tetracycline and kanamycin. After culturing at 37 °C and 200 rpm for 16 - 20 h, centrifuge to collect the bacterial cells, and use a bacmid extraction kit (purchased from Invitrogen (Thermo), catalog number: K2100-14) to prepare a large amount of bacmid. The requirement for the bacmid is A 260 / A 280 = 1.8 - 2.0.

[0066] Resuscitate and culture insect cells sf9, and ensure the cell health before transfection, with a survival rate higher than 90%. Culture shaker settings: temperature 27°C, rotation speed 110 rpm, culture for 1 day. Culture the cell density to 1.5 - 2.5×10 6 cells / ml, and transfer them to a six-well cell culture plate for adherent transfection. Calculate the amount of cells to be transfected, take a certain amount of plasmid DNA (γ-IFN2 and birA) and the corresponding amount of transfection reagent (Component 1: Insect transfection reagent TransIT-Insect Transfection Reagent (Mirus, catalog number: MIR 6100) 10 μL, mixed with 200 μL of PBS; Component 2: Plasmid DNA 10 μL, mixed with 200 μL of PBS), and dilute them to a certain ratio with sterile PBS buffer respectively. Then add the diluted transfection reagent to the diluted plasmid DNA, mix quickly and let it stand for 10 - 20 min, and add it drop by drop to the prepared six-well cell culture plate, and culture adherently in an incubator at 27°C. After culturing for 64 - 72 h, centrifuge the γ-IFN2 and birA cultures at 1800 rpm for 30 min to obtain the first-generation virus, and then infect the adherent sf9 cells respectively. After culturing for 64 - 72 h, centrifuge the γ-IFN2 and birA cultures at 1800 rpm for 30 min to obtain the amplified second-generation virus. Mix the second-generation virus in the ratio of γ-IFN2:birA = 1:1 and directly add it to the cell culture flask at a certain ratio for expression (the cell culture flask contains cells that have been passaged to a density of 1.5 - 2.5×10 6 cells / ml, and the addition ratio of virus:cells = 1:10), temperature 27°C, rotation speed 110 rpm, and collect the expression supernatant after expressing for 64 - 72 h.

[0067] Concentrate the recombinant antigen expression product (supernatant) co-expressed by γ-IFN2 and birA 10-fold through a membrane package (10 kDa), and filter the concentrated supernatant with a 0.45 μm filter membrane. Obtain the filtrate as the sample to be loaded, load it onto a pre-equilibrated Ni affinity chromatography column. After loading, rinse the chromatography column with the equilibration buffer (pH 8.0, 50 mM Tris-Cl, 500 mM NaCl) for 50 column volumes, then wash away impurities with 10 column volumes of equilibration buffer containing 20 mM imidazole, and finally perform a 30-column volume linear gradient elution (equilibration buffer containing 20 - 500 mM imidazole). Collect the eluate in fractions, and after electrophoresis detection (the results are shown in Figure 4 ), mix the eluate collection fractions containing the target protein with higher purity, and dialyze them with a dialysis bag with a pore size of 10 kDa (change the solution after dialysis for 12 h and continue dialysis for 12 h), and finally obtain γ-IFN2-I recombinant antigen.

[0068] Example 4: Preparation of γ-IFN-I Recombinant Antigen

[0069] The γ-IFN-I recombinant antigen was prepared in the same manner as in Examples 1-3, except that the recombinant plasmid expression vector IFN-pFastbac 1 was constructed and this recombinant plasmid expression vector was used to replace IFN2-pFastbac 1 for the subsequent steps. The difference between the recombinant plasmid expression vector IFN-pFastbac 1 and the recombinant plasmid expression vector IFN2-pFastbac 1 is that Figure 2 the second IFN segment from left to right was removed, and the others remained unchanged.

[0070] Example 5: Preparation of γ-IFN-E Recombinant Antigen

[0071] Using conventional molecular biology methods, the amino acid sequence at positions 24-166 of the γ-interferon sequence reported in GenBank: AAB59534.1 was constructed in pET28A, and then transformed into competent Escherichia coli DH10B and stored as glycerol bacteria.

[0072] Inoculation: The glycerol bacteria were activated overnight with LB medium (containing Kan, final concentration 50 μg / ml), and then transferred to a 3L culture flask containing 1L of medium for culture. 10 ml of seed liquid (inoculated at 1%) was added to each flask, and the shaker temperature was set at 37°C and the rotation speed was 200 rpm.

[0073] Induction: After 3 h, samples were taken in a laminar flow hood, and the OD600 of the bacterial solution was continuously measured. When OD600 = 0.4 (Blank: ddH2O), the shaking flask was taken out, and 1M IPTG was added in the laminar flow hood to make the final concentration of IPTG 0.5 mM; the shaker temperature was set at 20°C and the rotation speed was 200 rpm, and the culture was continued for 16 h.

[0074] Collection: Clean 500 mL centrifuge tubes were selected for collection, with the liquid loading less than 400 mL / tube. The bacterial solution was poured in and centrifuged (parameter settings: rotation speed 9000 rpm, temperature 4°C, time 5 min). After centrifugation, the supernatant was poured out, and the above operation was repeated until the collection was completed;

[0075] Denaturation and renaturation: Take 1.5 - 2 g of the collected expressed bacterial cells, add 20 - 30 mL of resuspension buffer (pH 8.0, 50 mM Tris-Cl, 500 mM NaCl) to resuspend. The resuspended cells are lysed by an ultrasonic disruptor with the following ultrasonic program: working for 3 s, pausing for 6 s, and the total duration is 3 min. After ultrasonic treatment, centrifuge at 12,000 rpm, 15 min, 4 °C to separate the supernatant and precipitate. Detect by SDS-PAGE, and the target protein is all expressed in the precipitate and exists in the form of inclusion bodies. Resuspend and dissolve the precipitate with 10 - 20 mL of denaturation buffer (20 mM Tris-Cl, 100 mM NaCl, 8 M urea), centrifuge at 12,000 rpm, 10 min, 4 °C, and obtain the dissolved supernatant for dialysis renaturation. Renature by dialysis with gradient renaturation buffer (20 mM Tris-Cl, 100 mM NaCl, 4 - 2 - 0 M urea), and dialyze for more than 8 h for each gradient to obtain the soluble target protein supernatant.

[0076] Purification: Filter the renatured protein with a 0.45 μm filter membrane to obtain the filtrate as the sample for loading. Load it into a pre-equilibrated Ni affinity chromatography column. After loading, rinse the chromatography column with 50 column volumes of equilibration buffer (pH 8.0, 50 mM Tris-Cl, 500 mM NaCl), then wash away impurities with 10 column volumes of equilibration buffer containing 20 mM imidazole, and finally perform a 30-column volume linear gradient elution (equilibration buffer containing 20 - 500 mM imidazole). Collect the eluate in fractions, mix the collected fractions containing the target protein with higher purity after electrophoresis detection, and dialyze with a dialysis bag with a 10 kDa pore size (change the solution after 12 h of dialysis and continue dialysis for 12 h). Finally, obtain the soluble recombinant antigen γ-IFN-E through denaturation, renaturation, and purification.

[0077] Example 6: Specificity test 1 of ELISA detection

[0078] The recombinant antigens γ-IFN2-I, γ-IFN-I, and γ-IFN-E prepared in the above examples were diluted to 5 μg / ml with CB diluent respectively, and then 100 μl was added to each well and the 96-well ELISA plate was coated overnight at 4°C. The ELISA plate was washed, and 150 μl of blocking solution was added to each well and blocked at room temperature for about 5 - 24 h. After washing the ELISA plate, 100 μl of different antibodies (α-IFN antibody, β-IFN antibody, and γ-IFN antibody are all rabbit polyclonal antibodies, all purchased from Sino Biological, and the working concentration is 0.5 mg / mL) was added to each well and incubated at 37°C for 1 h. After washing the ELISA plate, 100 μl of mouse anti-rabbit IgG (labeled HRP) diluted 10,000 times was added to each well and incubated at 37°C for 0.5 h. After washing the ELISA plate, 100 μl of substrate (TMD) was added to each well for color development, and the reaction was carried out for 10 min. After adding the stop solution to each well, the absorbance value at a wavelength of 450 nm of each well was read with an ELISA reader. The detection results are shown in Table 1 below.

[0079] Table 1 Specificity test results (I)

[0080]

[0081] The results showed that the recombinant antigens γ-IFN2-I, γ-IFN-I, and γ-IFN-E all had strong reactivity to the γ-IFN antibody, and the Eilsa test signal values all exceeded the range. At the same time, the recombinant antigens γ-IFN2-I, γ-IFN-I, and γ-IFN-E had no obvious reactivity to the α-IFN antibody and β-IFN antibody, and the test signal values were close to the blank control. It shows that the recombinant γ-IFN antigen prepared by the present invention has good specificity and will not cross-react with the α-IFN antibody and β-IFN antibody.

[0082] Example 7: Specificity test 2 of ELISA detection

[0083] The recombinant antigens γ-IFN2-I, γ-IFN-I, and γ-IFN-E prepared in the above examples were diluted to 5 μg / ml with CB diluent respectively, and then 100 μl was added to each well and the 96-well ELISA plate was coated overnight at 4°C. The ELISA plate was washed, and 150 μl of blocking solution was added to each well and blocked at room temperature for about 5 - 24 h. After washing the ELISA plate, 100 μl of different serum samples (the serum samples were all diluted 100 times with sample diluent, and the samples included γ-IFN antibody-negative and -positive samples. The negative and positive judgments were synchronously verified using the human γ-IFN antibody detection kit from the comparison manufacturer abcam) were added to each well and incubated at 37°C for 1 h. After washing the ELISA plate, 100 μl of mouse anti-human IgG (labeled HRP) diluted 10,000 times was added to each well and incubated at 37°C for 0.5 h. After washing the ELISA plate, 100 μl of substrate (TMD) was added to each well for color development, and the reaction was carried out for 10 min. After adding the stop solution to each well, the absorbance value at a wavelength of 450 nm of each well was read with an ELISA reader. The detection results are shown in Table 2 below.

[0084] Table 2 Specificity Test Results (II)

[0085]

[0086] The results showed that: when testing 15 negative and positive samples, it was found that the coincidence rate of the positive and negative test results of γ-IFN2-I and γ-IFN-I for the 15 samples with the test results of the γ-IFN antibody detection kit of the comparison manufacturer (abcam) reached 100%; when comparing the reactivity of each test antigen to the 15 negative and positive samples, it was not difficult to find that the reactivity of γ-IFN2-I was the best, with a better signal-to-noise ratio than abcam ab300323 and γ-IFN-I; at the same time, it was found that γ-IFN-E showed multiple false positive signals and the overall test value background was relatively high. Obviously, for different serum samples, considering the specificity and signal-to-noise ratio comprehensively, the performance of γ-IFN2-I was better than that of γ-IFN-I, γ-IFN-E antigens and the human γ-IFN antibody detection kit of the comparison manufacturer abcam.

[0087] Example 8: Sensitivity Test of ELISA Detection

[0088] The recombinant antigens γ-IFN2-I, γ-IFN-I, and γ-IFN-E prepared in the above examples were respectively diluted to 5 μg / ml with CB diluent, and then 100 μl was added to each well and incubated overnight at 4°C to coat a 96-well enzyme-linked immunosorbent assay (ELISA) plate. The ELISA plate was washed, and 150 μl of blocking solution was added to each well and blocked at room temperature for about 5 - 24 h. After washing the ELISA plate, 100 μl of γ-IFN antibody with different concentrations (the γ-IFN rabbit polyclonal antibody was purchased from Sino Biological and was serially diluted at a 1 - 10 4 gradient) was added to each well, and incubated at 37°C for 1 h (simultaneously verifying the reactivity of the human γ-IFN antibody detection kit (abcam ab300323) to the γ-IFN rabbit polyclonal antibody of Sino Biological). After washing the ELISA plate, 100 μl of mouse anti-rabbit IgG (labeled HRP) diluted 10,000-fold was added to each well and incubated at 37°C for 0.5 h. After washing the ELISA plate, 100 μl of substrate (TMD) was added to each well for color development, and the reaction was carried out for 10 min. After adding the stop solution to each well, the absorbance value at a wavelength of 450 nm of each well was read using an enzyme-linked immunosorbent assay reader. The detection results are shown in Table 3 below.

[0089] Table 3 Sensitivity Test Results

[0090]

[0091]

[0092] The results showed that: the lowest concentration of the antibody tested by the recombinant antigen γ-IFN2-I reached 0.05 μg / mL, and the original concentration of the antibody was diluted 10 4times can still be detected; γ-IFN-I can still detect the signal value after the antibody is diluted 10 3 times; γ-IFN-E can still detect the signal value after the antibody is diluted 10 2 times. At the same time, by comparing the recombinant antigen γ-IFN2-I and abcam ab300323, it was found that γ-IFN2-I has better signal values for rabbit polyclonal antibodies against γ-IFN at low concentrations. Therefore, it was confirmed that the detection sensitivity of γ-IFN2-I is significantly higher than that of γ-IFN-I and γ-IFN-E and the comparison manufacturer abcam ab300323.

[0093] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations. The above embodiments or implementation manners are only illustrative examples of the present invention, and the present invention can also be implemented in other specific manners or other specific forms without departing from the gist or essential features of the present invention. Therefore, the described implementation manners should be regarded as illustrative rather than restrictive in any aspect. The scope of the present invention should be defined by the appended claims, and any changes equivalent to the intention and scope of the claims should also be included within the scope of the present invention.

Claims

1. A gamma interferon dimer fusion protein, characterized in that: The fusion protein has the amino acid sequence shown in SEQ ID NO.

1.

2. The fusion protein according to claim 1, wherein: On the basis of the amino acid sequence shown in SEQ ID NO.1, the fusion protein further adds an Avi-tag sequence and a His-tag sequence at its C-terminus. The Avi-tag sequence is used for directed biotinylation modification thereon, and its sequence is as shown in SEQ ID NO.

2. The His-tag sequence is as shown in SEQ ID NO.

3. The amino acid sequence of the fusion protein is as shown in SEQ ID NO.

4.

3. The fusion protein according to claim 2, wherein: The fusion protein is a fusion protein biotinylated in the sequence segment shown in SEQ ID NO.

2.

4. A method for preparing the fusion protein according to claim 3, characterized in that: The preparation method is to co-express the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding a biotin ligase in a microorganism, an animal cell or a plant cell, and obtain the fusion protein after microbial culture or cell culture and separation and purification.

5. The preparation method according to claim 4, characterized in that: The amino acid sequence of the biotin ligase is as shown in SEQ ID NO.

5.

6. The preparation method according to claim 4, characterized in that: The co-expression is to transfer the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding a biotin ligase into a baculovirus expression vector respectively, and then transfect into insect cells for co-expression.

7. The preparation method according to claim 6, characterized in that: The recombinant plasmid expression vectors constructed after the nucleic acid encoding SEQ ID NO.4 and the nucleic acid encoding a biotin ligase are respectively transferred into a baculovirus expression vector are IFN2-pFastbac 1 and birA-pFastbac 1 respectively.

8. The preparation method according to claim 6, characterized in that: The insect cell is an sf9 insect cell.

9. The preparation method according to claim 4, wherein: The separation and purification is carried out by using a Ni affinity chromatography column.

10. Use of the fusion protein according to any one of claims 1-3 as an antigen for detecting an interferon-γ antibody in an ELISA assay.

Images