A composite microbial agent and its application

By screening the composite microbial agent NBI that is suitable for Hainan soil and soybean varieties, including chronic-type rhizobia HS3, Pseudomonas Y43, Burkholder Y30 and Agrobacterium Y27, the problem of poor adaptability of a single rhizobia agent in a variable soil environment is solved, and the nitrogen fixation capacity and yield of soybean nodules have been improved, reducing the use of chemical fertilizers, and promoting the development of green agriculture.

CN120290422BActive Publication Date: 2025-08-29SANYA INST OF HENAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510748109.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-08-29
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

The existing single-type rhizobacterium bacteria agents have poor adaptability in variable soil environments and insufficient variety matching, resulting in low soybean nodules, making it difficult to achieve efficient nitrogen fixation and yield improvement, and the use of chemical nitrogen fertilizers is large and the pollution is serious.

Method used

The complex microbial agent NBI, which is suitable for Hainan soil and soybean varieties, was screened out, including chronic rhizobia HS3, Pseudomonas Y43, Burkholder Y30 and Agrobacterium Y27. It was used through seed coating to promote nitrogen fixation and growth of soybean nodules, combined with phosphorus removal, potassium removal, and growth promotion functions.

Benefits of technology

Significantly improve the nitrogen fixation capacity of soybean nodules, promote yield improvement, reduce the use of chemical fertilizers, strong adaptability, easy application, and promote the development of green agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290422B_ABST
    Figure CN120290422B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of agricultural technology and relates to microorganisms, particularly a composite microbial agent and its application. The composite microbial agent comprises Bradyrhizobium HS3, Pseudomonas Y43, Burkholderia Y30, and Agrobacterium Y27. The composite microbial agent, NBI, is prepared by optimizing highly efficient rhizobia and beneficial microbial strains adapted to local soils based on the soil types and microbial adaptability of different regions in Hainan. The agent can be used to enhance the nodulation and nitrogen fixation capacity of fresh soybeans, promote soybean yield, reduce the use of chemical fertilizers, and increase soybean yield per unit area.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of agriculture and relates to microorganisms, in particular to microorganisms used for leguminous plants. Background Art

[0002] Symbiotic nitrogen fixation between soybeans and rhizobia converts atmospheric nitrogen into ammonia. Globally, this nitrogen fixation reaches 16.44 million tons annually, accounting for 77% of the total nitrogen fixed by leguminous crops. This not only provides approximately 68% of the nitrogen needed for soybean growth but also improves soil fertility and provides access for other crops. Establishing an efficient symbiotic nitrogen fixation system is essential for improving soybean yield and quality and reducing the use of chemical nitrogen fertilizers. Natural soybeans exhibit low nodulation and inefficiency. Replacing chemical nitrogen fertilizers with rhizobia inoculants is currently a key measure both domestically and internationally to reduce non-point source pollution and achieve healthy soybean production. Data shows that in Brazil, a major soybean producer, rhizobium inoculant utilization is near 100%, reducing nitrogen fertilizer investment by approximately $2.5 billion annually. In the United States, a major soybean producer, rhizobia inoculation covers over 50% of soybean-growing areas, resulting in an average reduction of 6.19 million tons of nitrogen fertilizer annually. However, rhizobia exhibit high genetic diversity, species specificity, and regional adaptability. Therefore, strain selection and application in the development of complex rhizobia inoculants must consider the species, strain type, and local soil conditions.

[0003] Single-type rhizobium agents have poor adaptability to changing soil environments, and have problems such as poor variety matching and low nodule occupancy rate. Single inoculation of rhizobium agents often fails to achieve the expected results. A variety of beneficial microorganisms living in the soybean rhizosphere can have an important positive regulatory effect on the soybean-rhizobium symbiotic nitrogen fixation system. In Brazil, the method of co-inoculation of Azospirillum brasiliensis and rhizobia has begun to be widely used. Compared with single rhizobia, co-inoculation significantly improves soybean nodulation and soybean yield. In my country, multifunctional composite rhizobia agents have entered the stage of research and development and application. For example, the application with publication number CN119776202A discloses a composite agent for promoting the growth of legumes, which promotes growth and prevents diseases by combining multiple composite bacteria with rhizobia and biological reagents. However, there is still a lack of existing technologies that disclose microbial agents for leguminous crops that are widely adaptable to regional soils and highly compatible with local cultivated soybean varieties. Therefore, screening and preparing a combination of high-efficiency nitrogen-fixing rhizobia and growth-promoting bacteria that are adapted to the soils of specific regions and match specific cultivated varieties is very important and necessary for improving soybean nodulation, nitrogen fixation and yield, and reducing the application of chemical fertilizers. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention proposes a composite microbial agent and its application.

[0005] The technical solution of the present invention is achieved as follows:

[0006] This application first screened rhizobia strains from the team's rhizobium resource library based on Hainan's soil characteristics. Then, using representative Hainan soils and local fresh soybean cultivars for matching screening, the researchers compared the rhizobia's nodulation and nitrogen fixation abilities and growth-promoting effects using indicators such as nodule number, nitrogenase activity, and above-ground dry weight to identify highly effective rhizobia adapted to Hainan's local soils and cultivars. The screening revealed a combination of bradyrhizobium HS3 and USDA110 that optimally adapted to representative soils from eight regions in Hainan and five fresh soybean cultivars.

[0007] Furthermore, the type of soil used is brick red soil, red soil or yellow soil, which has the characteristics of strong acidity (pH 4.3-5.7), low organic matter content and low phosphorus and potassium content.

[0008] Furthermore, in response to the current situation where acidic soils are generally poor in fertility and have low levels of available phosphorus and potassium, the use of beneficial microorganisms with phosphorus and potassium solubilization and growth-promoting functions can be an effective method to improve crop nutrient availability. The present invention selects highly efficient growth-promoting microbial strains from the team's beneficial microbial resource library and provides a composite microbial inoculum (Nutrient Booster Inoculum) for leguminous crops, comprising the aforementioned Bradyrhizobium HS3 + USDA110 combination, as well as Pseudomonas Y43, Burkholderia Y30, and Agrobacterium Y27. The ratio of the strains in the composite microbial inoculum is 1:1:1:1:1.

[0009] The composite microbial agent NBI, comprising bradyrhizobium HS3, Pseudomonas Y43, Burkholderia Y30 and Agrobacterium Y27, was isolated and screened by the inventors' team from soils in different regions of the main soybean producing areas across the country.

[0010] Bradyrhizobium HS3 can efficiently nodulate and fix nitrogen with local fresh soybean cultivars in the soil of different soybean producing areas in Hainan. The Latin name of Bradyrhizobium HS3 is Bradyrhizobium sp HS3, classified as Bradyrhizobium sp ., the deposit number is GDMCC No: 66000, the deposit date is March 12, 2025, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences;

[0011] Pseudomonas Y43 has the ability to efficiently produce IAA, which significantly promotes soybean growth in acidic soil. The Latin name of Pseudomonas Y43 is Pseudomonas sp .Y43, classified as Pseudomonas sp ., the deposit number is GDMCC No: 66004, the deposit date is March 12, 2025, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences;

[0012] Burkholderia Y30 has high efficiency in phosphate solubilization and can inhibit pathogens such as Phytophthora sojae and Fusarium oxysporum. It can significantly promote soybean growth in acidic soil. The Latin name of Burkholderia Y30 is Burkholderia sp. Y30, classified as Burkholderia sp. , the deposit number is GDMCC No: 66002, the deposit date is March 12, 2025, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences;

[0013] Agrobacterium Y27 has high potassium solubility and significantly promotes soybean growth in acidic soil. Agrobacterium sp. Y27, classified as Agrobacterium sp. , the deposit number is GDMCC No: 66001, the deposit date is March 26, 2025, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences;

[0014] According to the above scheme, the composite microbial agent of the present invention can significantly promote the symbiotic nodulation phenotype of fresh soybean in greenhouses and Hainan fields, and promote the aboveground biomass, pod number and yield of fresh soybean.

[0015] According to the above scheme, the composite microbial agent is a liquid composite microbial agent, comprising fermentation culture solutions of Bradyrhizobium HS3, Bradyrhizobium USDA110, Pseudomonas Y43, Burkholderia Y30, and Agrobacterium Y27, mixed at a ratio of 1:1:1:1:1. A 2% arabinose solution is added as a binder to the mixed solution to prepare a liquid agent.

[0016] Preferably, the liquid composite microbial agent NBI contains 150-300 million cfu / mL of Bradyrhizobium HS3 live bacteria, 150-300 million cfu / mL of Bradyrhizobium USDA110 live bacteria, 100-250 million cfu / mL of Pseudomonas Y43 live bacteria, 100-250 million cfu / mL of Burkholderia Y30 live bacteria, and 100-250 million cfu / mL of Agrobacterium Y27 live bacteria.

[0017] According to the above scheme, the application method is to coat the soybean seeds before sowing. The seed coating should be carried out within 12 hours before sowing. The seed coating should be carried out in a cool place away from direct sunlight. The composite microbial agent NBI is mixed with the soybean seeds and gently stirred until the rhizobium agent is adhered to all the seed surfaces. The seeds are then sown after being dried in the shade.

[0018] According to the above scheme, the application of the microbial agent on leguminous crops includes but is not limited to fresh soybeans, soybeans, etc.

[0019] The present invention has the following beneficial effects:

[0020] 1. The present invention combines the physical and chemical properties of different types of soil in Hainan and the adaptability of microorganisms to select efficient rhizobia and beneficial microbial strains adapted to local soil to prepare a composite microbial agent NBI, which can be used to improve the nodulation and nitrogen fixation ability of fresh soybeans, promote soybean yield, and help reduce the application of chemical fertilizers and increase soybean yield.

[0021] 2. The composite microbial agent NBI of the present application is applied by seed dressing and coating, which is easy to use.

[0022] 3. The soybean cultivation provided by the present invention is suitable for fresh soybean cultivation in Hainan Island and can be used as one of the important measures for fresh soybean cultivation. It is of great significance to promote the sustainable development of green agriculture in the local area and even the whole country. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 This is a heat map of the nodule number of fresh soybeans inoculated with the candidate strain under representative soil conditions in different regions of Hainan in Example 1 of the present invention.

[0025] Figure 2 This is the compatibility of the preferred high-efficiency rhizobium strain in Example 1 of the present invention with the fresh soybean variety under representative soil conditions in different regions of Hainan.

[0026] Figure 3 The preferred beneficial microbial strains in Examples 2, 3, and 4 of the present invention have the ability to solubilize phosphate, solubilize potassium, produce IAA, and be acid-resistant.

[0027] Figure 4 This is a phylogenetic tree of the preferred efficient rhizobium strains and beneficial microbial strains in Examples 1, 2, 3, and 4 of the present invention.

[0028] Figure 5 This is the effect of the preferred beneficial microbial strain in Example 2 of the present invention on promoting soybean growth in a greenhouse.

[0029] Figure 6 This is the effect of the composite microbial agent NBI in Example 3 of the present invention on promoting nodulation and yield of fresh soybean in the field. DETAILED DESCRIPTION

[0030] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0032] The culture medium required in the screening process of beneficial microorganisms is specifically:

[0033] Montgina Inorganic Phosphate Bacteria Screening Medium: Glucose 10.0 g / L, (NH4)2SO4 0.5 g / L, MgSO4·7H2O 0.3 g / L, KCl 0.3 g / L, FeSO4·7H2O 0.03 g / L, NaCl 0.3 g / L. MnSO4·4H2O 0.03 g / L, Ca3(PO4)25.0 g / L, Agar 15.0 g / L. Adjust the pH to 7.0-7.5.

[0034] Montgena Organophosphate Bacteria Screening Medium: Glucose 10.0 g / L, (NH₄)₂SO₄ 0.5 g / L, NaCl 0.3 g / L, KCl 0.3 g / L, FeSO₄·7H₂O 0.03 g / L, MnSO₄·4H₂O 0.03 g / L, lecithin 0.2 g / L, CaCO₃ 5.0 g / L. Yeast extract 0.4 g / L. Adjust pH to 7.0-7.2.

[0035] Silicate bacterial culture medium: Glucose 5.0 g, MgSO4 0.5 g / L, CaCO3 0.1 g / L, Na2HPO4 2.0 g / L, FeCl3 0.005 g / L, glass powder 1.0 g / L. Adjust the pH to 6.9-7.1.

[0036] HM medium formula: Na2HPO4 0.125 g / L, Na2SO4 0.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D-Arbinose 1 g / L, Sodium Gluconate 1g, FeCl3 0.004g, CaCl2 0.013g, HEPES 1.30g, MES 1.30g, adjust the pH to 6.6-7.0 with NaOH.

[0037] LB medium formula: Tryptone 10.0 g, Yeast extract 5.0 g, NaCl 10.0 g.

[0038] Example 1: Screening for efficient rhizobia adapted to Hainan soil and local fresh soybean varieties

[0039] (1) The inventors collected soil from fresh soybean production areas in different regions of Hainan Province and sieved it through a 1mm sieve for later use. The physical and chemical properties of the soil from various regions were measured, as shown in the following table:

[0040]

[0041] It was found that the local soil in Hainan is generally highly acidic (pH 4.3-5.7), and the organic matter content and nitrogen, phosphorus and potassium content are all low. The total nitrogen and organic matter were determined by elemental analyzer. The total potassium content was determined by flame photometry, and the total phosphorus content was determined by sodium hydroxide fusion-molybdenum antimony colorimetry. The methods are all common methods in the industry. According to the soil type and acidic soil characteristics of Hainan, the inventors preliminarily selected 20 strains of rhizobia for testing from the rhizobia library preserved by the team, among which USDA110 is an efficient nitrogen-fixing rhizobium commonly used internationally. Using representative soils from eight local areas in Hainan as the matrix, efficient rhizobia with broad-spectrum adaptability were preliminarily screened. (2) Preparation of rhizobia liquid: The 20 preliminarily selected rhizobia were activated from glycerol bacteria stored at -80℃ and placed on HM solid culture medium plates. After culturing in the dark at 28℃ for 2-4 days, single clones of each strain were selected and inoculated into HM liquid culture medium and placed on a shaker at 28℃ and 200 rpm to culture until OD 600 Use 10mM MgCl2 solution to adjust the OD of each rhizobium solution to 0.5-1. 600 HM medium formula: Na2HPO4 0.125 g / L, Na2SO4 0.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D-Arbinose 1 g / L, Sodium Gluconate 1 g, FeCl3 0.004 g, CaCl2 0.013 g, HEPES 1.30 g, MES 1.30 g. Adjust the pH to 6.6-7.0 with NaOH. Add 1.5% agar powder to the solid medium.

[0042] (3) Sterilize the vermiculite, plug trays, flower pots, beakers and other materials required for the experiment at high temperature and high pressure at 121℃ for 30 min. The soybean seeds used in this experiment were sterilized with chlorine gas. The specific operation is as follows: Spread the soybean seeds flat on a petri dish and place it in a glass desiccator. Quickly add 100 mL of sodium hypochlorite solution and 4.2 mL of concentrated hydrochloric acid to the beaker in sequence, then seal the glass desiccator and sterilize for 12 h. After sterilization, place the petri dish with the soybean seeds flat on a clean bench for air blowing for more than 2 h, then close the petri dish and set aside.

[0043] (4) Representative soils collected from eight regions in Hainan (Sanya, Ledong, Dongfang, Changjiang, Baisha, Danzhou, Qionghai, and Wenchang) were placed in sterilized pots. Sterilized seeds were sown in soils from different regions and cultured in a greenhouse (25°C, 16 h light / 8 h dark). Two seeds were planted per hole, and after the seedlings emerged, the seedlings were thinned to one seedling per hole. Watering was done regularly to keep the soil moist. After two true leaves of soybeans grew out, 1 mL of the prepared rhizobium solution was inoculated into each seedling, and the number of nodules was observed after 21 days of culture. The nodulation of candidate rhizobia strains in different soils is shown in the figure. Figure 1 As shown, the five rhizobia with the highest nodulation efficiency in soils from different regions were screened for further screening of symbiotic matching for fresh soybean varieties.

[0044] (5) A symbiotic compatibility test was conducted using Maodou 64, a local fresh soybean variety grown in Hainan, and four laboratory-grown fresh soybean varieties suitable for promotion and cultivation in Hainan (Zhexian 87, Tianyaxian 1, Tianyaxian 2, and Tianyaxian 3). The method is described in (4). Thirty days after inoculation, the number of nodules, nodule weight, above-ground dry weight, below-ground dry weight, and nitrogenase activity were measured to evaluate the adaptability and compatibility of the rhizobia.

[0045] (6) 30 days after rhizobium inoculation, the soybean plants were cut horizontally along the upper part of the first lateral root to separate the underground root part and the aboveground part. The roots were cleaned. The nitrogenase activity index was determined using the traditional acetylene reduction method. After the nitrogenase activity determination was completed, the nodules were separated from the roots, and the number and weight of the nodules were counted. After that, the soybean underground and aboveground roots were dried in an oven at 65°C to constant weight, and the aboveground dry weight and underground dry weight were determined.

[0046] (7) Statistical analysis was performed on the nodulation and nitrogen fixation phenotypes and growth phenotypes of each strain in different soils and various fresh soybean varieties. The adaptability and compatibility of each strain were assigned based on its nodulation and nitrogen fixation ability and growth promotion ability. The results are as follows: Figure 2The results showed that the compatibility of rhizobium strains with soybean varieties varied significantly across soil types. HS3 and USDA110 showed the best symbiotic compatibility with the tested soybean varieties. HS3 was the best match for Maodou 64, Tianyaxian 1, and Tianyaxian 3, while USDA110 was the best match for Zhexian 87 and Tianyaxian 2. Based on the soybean-rhizobium compatibility results across all soil types, the USDA110+HS3 combination achieved the best regional adaptability and variety compatibility.

[0047] The 16S rDNA sequence of the screened HS3 strain is shown in SEQ ID No. 1. After bioinformatics analysis, the phylogenetic tree was constructed as shown in Figure 4 The strain HS3 shown in A belongs to the genus Bradyrhizobium ( Bradyrhizobium sp.).

[0048] Bradyrhizobium HS3 can efficiently nodulate and fix nitrogen with local fresh soybean cultivars in the soil of Hainan's main soybean producing areas. It has been deposited in the Guangdong Provincial Microbial Culture Collection with the accession number GDMCC No: 66000 and the preservation date is March 12, 2025.

[0049] Example 2: Screening of phosphate-solubilizing bacteria

[0050] The organic acid secreted by inorganic phosphorus-dissolving bacteria during their growth process can dissolve Ca3(PO4)2 in the culture medium around the colony, making it transparent; the enzymes secreted by organophosphate-dissolving bacteria during their growth process decompose the lecithin in the culture medium around the colony through enzymatic hydrolysis, making it transparent. All candidate beneficial microbial strains were cultured in LB medium, and the OD value of each strain was calculated. 600 Adjust the concentration to 0.5. In a clean bench, inoculate 5 µL of bacterial culture into either Montkina Inorganic Phosphorus Screening Medium or Montkina Organophosphate Screening Medium. Culture the culture in a 28°C incubator for 7 days. If a phosphate-solubilizing zone forms during growth, the strain is considered phosphate-solubilizing. Efficient phosphate-solubilizing bacteria can be screened by comparing the ratio (D / d) of the phosphate-solubilizing zone diameter (D) to the colony diameter (d) formed by different organophosphate-solubilizing strains on solid plates containing organophosphate-solubilizing medium.

[0051] The results are as follows Figure 3 As shown, the Y30 strain grows slowly on a medium with pH 4.0, but is almost unaffected on a medium with pH 4.5, and has a high phosphate solubility capacity. The obtained sequences were subjected to BLAST comparison analysis and a phylogenetic tree was constructed ( Figure 4 In B), analysis showed that strain Y30 belongs to Burkholderia ( Burkholderia sp.) and was subsequently deposited.

[0052] Burkholderia Y30 has high phosphate solubilization capabilities and inhibits pathogens such as Phytophthora sojae and Fusarium oxysporum. It significantly promotes soybean growth in acidic soils. It has been deposited with the Guangdong Provincial Microbial Culture Collection under the accession number GDMCC No. 66002, with a preservation date of March 12, 2025.

[0053] Example 3: Screening of potassium-solubilizing bacteria

[0054] All candidate beneficial microbial strains were cultured in LB medium and the OD of each strain was calculated. 600 Adjust to 0.5. In the clean bench, 5 μL of bacterial solution was inoculated onto silicate bacterial culture medium for screening. By comparing the size of the colorless and transparent oily ring produced by different potassium-dissolving bacteria, efficient potassium-dissolving bacteria were obtained. The results are shown in Figure 2. Figure 3 As shown, strain Y27 can grow on both pH 4.0 and pH 4.5 media and has a high potassium solubility. After full-length 16S rDNA sequencing, the obtained sequence was submitted to NCBI for BLAST comparison analysis and phylogenetic tree construction ( Figure 4 In B), analysis showed that strain Y27 belongs to Agrobacterium ( Agrobacterium sp.) and was subsequently deposited.

[0055] Agrobacterium tumefaciens Y27 has high potassium solubilization capacity and significantly promotes soybean growth in acidic soils. It has been deposited with the Guangdong Provincial Microbiological Culture Collection under the accession number GDMCC No: 66001, with a deposit date of March 26, 2025.

[0056] Example 4: Screening of strains with high indoleacetic acid (IAA) production

[0057] All candidate beneficial microbial strains were cultured in LB medium and the OD of each strain was calculated. 600Adjust the concentration to 0.5. Inoculate 300 µL of TSB liquid medium containing 0.1 g / L L-tryptophan at a 2% inoculum. Grow in a shaker at 200 rpm and 28°C for 48 hours. Centrifuge at 4000 rpm for 10 minutes. Aspirate 100 µL of the supernatant and add an equal volume of Salkowski colorimetric solution. Incubate at room temperature in the dark for 30 minutes and observe the color change. A pink color indicates that the strain is capable of secreting IAA. Perform a secondary screening to obtain a bacterial suspension using the same method as the initial screening. After centrifugation of the bacterial solution, 1 mL of supernatant was aspirated and mixed with an equal volume of Salkowski colorimetric solution. After being placed in the dark at room temperature for 30 minutes, the absorbance at OD530 was measured. Using liquid TSB medium as a control, different concentrations of IAA standard solutions (10 mg / L, 20 mg / L, 40 mg / L, 80 mg / L, 100 mg / L) were set up, with IAA concentration as the horizontal axis and OD530 as the vertical axis to create an IAA standard curve. The IAA yield was calculated using the standard curve. The strains with high IAA yield were screened by comparing the IAA yield values. The results are shown in the figure below. Figure 3 As shown, strain Y43 can grow normally on both pH 4.0 and pH 4.5 media, is almost unaffected by pH changes, and has the ability to efficiently produce long-chain IAA. Quantitative determination of its IAA production reached 61.5 mg / L. After full-length 16S rDNA sequencing, the obtained sequence was submitted to NCBI for BLAST comparison analysis and phylogenetic tree construction ( Figure 4 In B), analysis showed that strain Y43 belongs to Pseudomonas ( Pseudomonas sp. The primers for full-length 16S rDNA identification were 27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT.

[0058] Pseudomonas sp. Y43 has the ability to efficiently produce the hormone IAA, significantly promoting soybean growth in acidic soils. It has been deposited with the Guangdong Provincial Microbial Culture Collection under the accession number GDMCC No: 66004, with a deposit date of March 12, 2025.

[0059] Example 5: Preparation of composite microbial agent

[0060] Preferred beneficial microbial combinations: Given that Hainan's soils are generally acidic and high in total phosphorus and total potassium, but low in available phosphorus and potassium, efficient phosphate-solubilizing and potassium-solubilizing bacteria can improve the utilization of phosphorus and potassium in the soil. Furthermore, high indoleacetic acid (IAA) production can promote the growth and development of crop roots, increase the number of root hairs and lateral roots, and enhance plant growth. The inventors' team screened for strains of highly efficient phosphate-solubilizing and potassium-solubilizing bacteria and high IAA-producing beneficial microorganisms (the strains described in Examples 1-4) from a library of beneficial microbial resources.

[0061] Greenhouse experiments tested the growth-promoting effects of beneficial bacteria and rhizobia:

[0062] A total of five treatments were designed in the experiment: only inoculation with the HS3+USDA110 combination rhizobium agent in implementation case 1 (T1), co-inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y30 (Y30), co-inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y27 (Y27), co-inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y43 (Y43), and co-inoculation with HS3+USDA110 rhizobium agent and the combination of beneficial bacteria Y30+Y27+Y43 (NBI).

[0063] The rhizobium strains (HS3, USDA110) stored at -80°C were streaked on HM plates for activation, and the beneficial bacteria strains (Y30, Y27, and Y43) were streaked on LB plates for activation. The plates were cultured at 28°C in the dark until a single colony was grown. The plates were then inoculated into the corresponding 500 mL liquid culture medium and cultured at 28°C with shaking at 200 rpm until the OD 600 = 2. Collect the cells by centrifugation at 4000 rpm for 15 min, resuspend the cells in sterile water and adjust the OD 600 = 1. Prepare the bacterial suspension for each treatment by mixing the bacterial suspension according to the table below.

[0064]

[0065] Uniformly sized seeds of the Maodou 64 soybean cultivar were sterilized and inoculated into pots filled with moist soil. The plants were then cultured in a greenhouse (25°C, 16 h light / 8 h dark). When the soybeans had two true leaves, each seed was inoculated with 10 mL of the corresponding bacterial solution. Twelve replicates were set up for each treatment. Afterwards, the plants were watered regularly, and the number of nodules at the onset of flowering, as well as the aboveground and belowground biomass of the soybeans, were measured.

[0066] The results are as follows Figure 5As shown in the data, compared with single inoculation of rhizobia, the Y43, Y30 and Y27 treatments co-inoculated with beneficial bacteria can significantly promote the number of soybean nodules and growth, while the NBI treatment co-inoculated with rhizobia and Y43+Y30+Y27 showed the best effect of promoting nodulation and growth.

[0067] (2) Preparation of a composite microbial agent: Bradyrhizobium HS3, Bradyrhizobium USDA110, Pseudomonas Y43, Burkholderia Y30 and Agrobacterium Y27 were activated respectively, and Bradyrhizobium HS3 and Bradyrhizobium USDA110 were inoculated into HM medium for liquid expansion culture at a speed of 200 rpm and 28°C for 72 h. Pseudomonas Y43, Burkholderia Y30 and Agrobacterium Y27 were inoculated into LB medium for expansion culture at a speed of 200 rpm and 28°C for 48 h. After obtaining the culture solution of each strain, the OD value was adjusted. 600 After the mixture reaches 1, 500 mL of each solution was taken and mixed. The mixed bacterial solution was centrifuged and resuspended in 25 mL of the supernatant. 2% adhesive arabic gum powder was added and mixed thoroughly to obtain the composite microbial inoculant NBI.

[0068] The liquid composite microbial inoculant NBI contains 150-300 million cfu / mL of live bacteria of Bradyrhizobium HS3, 150-300 million cfu / mL of Bradyrhizobium USDA110, 100-250 million cfu / mL of Pseudomonas Y43, 100-250 million cfu / mL of Burkholderia Y30, and 100-250 million cfu / mL of Agrobacterium Y27.

[0069] Application example: Experiment on promoting soybean nodulation, nitrogen fixation and growth and development with composite microbial agents in the field

[0070] (1) Field experiment: This experiment was conducted at the Nanfan Base in Yazhou District, Sanya City, Hainan Province. The soil type of the experimental base was dry red soil, and the basic soil fertility was 0.23 g / kg total nitrogen, 27.7 g / kg total potassium, 0.8 g / kg total phosphorus, 7.20 mg / kg available phosphorus, 84.3 mg / kg available potassium, and pH 4.39.

[0071] This experiment set up three treatments: 1. 30% weight loss without inoculation of microbial agents; 2. 30% weight loss with inoculation of composite microbial agent NBI; 3. Full fertilizer application without inoculation of microbial agents.

[0072] For the full fertilizer treatment, 25 kg of 15-15-15% (NPK) compound fertilizer was applied per mu, and for the 30% reduction treatment, 17.5 kg of 15-15-15% (NPK) compound fertilizer was applied per mu. Fertilizers were applied as base fertilizer according to a uniform standard.

[0073] The inoculation was performed by seed coating the soybean seeds. This was done within 12 hours before sowing. The seed coating should be done in a cool, shady location away from direct sunlight. The inoculation agent was mixed with the soybean seeds, with 15 mL of agent added to 1 kg of fresh soybean seeds. The seeds were gently stirred until all surfaces were coated with the composite microbial agent NBI. The seeds were then dried in the shade before sowing. Three replicates were used for each treatment.

[0074] Maodou 64, a local Hainan soybean variety for fresh consumption, was selected. Each plot was sown manually using line streaking, with two seeds per hole and a row-plant spacing of 40 cm x 10 cm. Seedlings were thinned out at the seedling stage, with one plant per hole. If a seedling was missing, two plants were added to the adjacent hole. Field management was consistent across all plots, with fertilization, sowing, tillage, and weeding completed within a single day. Drip irrigation was used for irrigation.

[0075] (2) Field phenotypic survey: The number of nodules and aboveground biomass of soybeans were investigated during the flowering period. The number of pods, pod weight, number of grains, and grain weight were investigated during the fresh pod period.

[0076] The results are as follows Figure 6 As shown, when no microbial inoculation was performed in the field, fresh soybeans produced few nodules under both full fertilizer and 30% weight reduction conditions, with an average of 5 nodules per plant. When NBI, a composite microbial inoculant, was inoculated at 30% weight reduction, the number of nodules increased significantly, with an average of 35 nodules per plant. During the peak flowering stage, NBI, a composite microbial inoculant, increased aboveground biomass by 50.2% and 20.5%, respectively, compared to NBI, a composite microbial inoculant, or NBI, a composite microbial inoculant. During the fresh pod stage, NBI, a composite microbial inoculant, increased the number of pods per plant by 33.3% and 14.3%, respectively, compared to NBI, a composite microbial inoculant, or NBI, a composite microbial inoculant. Fresh pod weight also increased by 16.7% and 8.7%, respectively, compared to NBI, a composite microbial inoculant, or NBI, a composite microbial inoculant.

[0077] In summary, the application of the composite microbial agent NBI can significantly promote the nodulation and nitrogen fixation of fresh soybeans, increase the yield of fresh soybeans, and achieve the effect of reducing weight and increasing production.

[0078] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A composite microbial agent, characterized in that: These include Bradyrhizobium HS3, Pseudomonas sp. Y43, Burkholderia sp. Y30, Agrobacterium tumefaciens Y27, and Bradyrhizobium sp. USDA110; Among them, the classification name of Bradyrhizobium HS3 is Bradyrhizobium sp HS3, deposit number is GDMCC No: 66000, deposit date is March 12, 2025, deposit address is 5th floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; Pseudomonas Y43 is classified as Pseudomonas sp .Y43, the deposit number is GDMCCNo:66004, the deposit date is March 12, 2025, and the deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou; the classification name of Burkholderia Y30 is Burkholderia sp. Y30, the deposit number is GDMCC No: 66002, the deposit date is March 12, 2025, and the deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou; the classification name of Agrobacterium Y27 is Agrobacteriumsp. Y27, deposit number is GDMCC No: 66001, deposit date is March 26, 2025, deposit address is 5th floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; The viable bacterial count of Bradyrhizobium HS3 in the composite microbial agent is 150-300 million cfu / mL, Bradyrhizobium USDA110 is 150-300 million cfu / mL, Pseudomonas Y43 is 100-250 million cfu / mL, Burkholderia Y30 is 100-250 million cfu / mL, and Agrobacterium Y27 is 100-250 million cfu / mL.

2. The composite microbial agent according to claim 1, characterized in that: The composite microbial agent also contains a binder.

3. The composite microbial agent according to claim 2, characterized in that: The binder is arabinose.

4. A seed coating agent, characterized in that: The invention comprises the composite microbial agent according to any one of claims 1 to 3.

5. Use of the composite microbial agent according to claim 1 or the seed coating agent according to claim 4 in high-yield IAA and efficient phosphorus and potassium solubilization.

6. Use of the composite microbial agent according to claim 1 or the seed coating agent according to claim 4 in improving the nodulation and nitrogen fixation ability of fresh soybeans and promoting the yield of fresh soybeans.

7. The use according to claim 5 or 6, characterized in that: The application is achieved by attaching the composite microbial agent to the surface of soybean seeds and then planting them on the soil.

8. The use according to claim 7, characterized in that: The type of the soil is brick red soil, red soil or yellow soil.

Citation Information

Patent Citations

  • Complex microbial inoculant for promoting growth of leguminous plants and application of complex microbial inoculant

    CN119776202A

  • Strain of bradyrhizobium anguelani and application thereof

    CN115838655A

  • Stress-resistant fertilizer-saving growth-promoting burkholderia sp. SPWD-6 and application thereof

    CN118516265A