Escherichia coli engineering strain with high yield of trans-aconitic acid as well as construction method and application of escherichia coli engineering strain

Abstract

The invention belongs to the technical field of microbial genetic engineering and fermentation engineering, and particularly relates to an escherichia coli engineering strain with high yield of trans-aconitic acid as well as a construction method and application of the escherichia coli engineering strain. According to the invention, a common mode microorganism E.coli is used as an original strain, and the high yield of trans-aconitic acid by the escherichia coli engineering strain is realized by modifying the metabolic pathway of the strain. A series of metabolic engineering reconstructions are carried out on the original strain, including inhibiting a generation pathway of by-products in a glucose metabolic pathway to redirect carbon flux to pyruvic acid, strengthening metabolic flux at a TCA circulation inlet, and blocking downstream metabolism of isocitric acid to improve supply of a precursor cis-aconitic acid; finally, an escherichia coli engineering strain for producing trans-aconitic acid is obtained by introducing a trans-aconitic acid biosynthesis route, and the escherichia coli engineering strain can be used for efficiently fermenting and producing trans-aconitic acid, so that the engineering strain has considerable application value and prospect.

Description

Technical Field

[0001] The present invention belongs to the technical fields of microbial genetic engineering and fermentation engineering, and particularly relates to an Escherichia coli engineering strain with high trans-aconitic acid production, a construction method thereof, and an application thereof. Background Art

[0002] The information disclosed in the background art of the present invention is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] As a C6 organic acid containing three carboxyl groups and unsaturated double bonds, trans-aconitic acid has been listed as one of the 30 bio-based chemicals with application potential. This compound shows important value in multiple industrial fields: its nematode inhibitory activity provides a new direction for the research and development of biological pesticides (Du et al., J. Biol. Chem, 2023, 292: 3517-3530); as a precursor of environmentally friendly plasticizers, it can improve the performance of chloroprene rubber and polyvinyl chloride composites (Hou et al., Green Carbon, 2023, 1: 20-32); its esterification derivatives, especially diester compounds, show clinical potential in the treatment of inflammatory diseases such as rheumatoid arthritis (Oliveira et al., Biomed. Pharmacother, 2018, 99: 87-95).

[0004] However, the industrial production of trans-aconitic acid currently faces multiple challenges: the traditional sugar extraction method is limited by the too low raw material content (0.02-0.1%) and the complex purification process (Nimmakayala et al., J. Chem. Eng. Data, 2019, 64: 2985-2996); the chemical synthesis route has problems of using toxic and harmful reagents and by-product pollution (Cao et al., Polym. Int, 2011, 60: 630-634); although the whole-cell catalytic system uses citric acid as a substrate, the yield is only 0.21 g / g citric acid (Kobayashi et al., Chem. Select, 2016, 1: 1467-1471), so large-scale low-cost production cannot be achieved.

[0005] Although the reported Aspergillus terreus genetically engineered strains have achieved a yield of 60 g / L, a glucose conversion rate of 0.41 g / g, and a productivity of 0.62 g / L / h (Geng et al., Metab. Eng, 2023, 78: 183-191), the characteristics of this strain as a pathogenic pathogen pose potential biosafety hazards to its application. Therefore, the existing production systems have significant defects in terms of large-scale economy and biosafety, and there is an urgent need to develop a new type of safe and efficient production platform. Summary of the Invention

[0006] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide an Escherichia coli engineered strain with high-yield trans-aconitic acid, its construction method and application. The present invention uses the wild-type model microorganism - Escherichia coli as the starting strain, and through a series of metabolic engineering transformations on the starting strain and introducing the synthesis pathway of trans-aconitic acid, finally obtains an Escherichia coli engineered strain with high-yield trans-aconitic acid, which is expected to be used as an engineering bacterium for the industrial production of trans-aconitic acid. Based on the above research results, the present invention is completed.

[0007] In the first aspect of the present invention, there is provided an Escherichia coli engineered strain with high-yield trans-aconitic acid, wherein the Escherichia coli engineered strain is obtained by using wild-type Escherichia coli as the starting strain and performing a series of metabolic engineering transformations on the starting strain and introducing the synthesis pathway of trans-aconitic acid;

[0008] Among them, the series of metabolic engineering transformations on the starting strain include any one or more of the following methods:

[0009] (1) Inhibiting the generation pathway of by-products in the glucose metabolism pathway to redirect the carbon flux to pyruvate;

[0010] (2) Strengthening the metabolic flux at the entrance of the TCA cycle;

[0011] (3) Blocking the downstream metabolism of isocitrate.

[0012] In the second aspect of the present invention, there is provided a construction method of the above-mentioned Escherichia coli engineered strain with high-yield trans-aconitic acid, and the construction method includes:

[0013] Using wild-type Escherichia coli as the starting strain, performing a series of metabolic engineering transformations on the starting strain and introducing the synthesis pathway of trans-aconitic acid to obtain the Escherichia coli engineered strain with high-yield trans-aconitic acid.

[0014] Among them, the wild-type Escherichia coli can be selected from any one of Escherichia coli W3110(DE3), Escherichia coli BL21(DE3), Escherichia coli Nissle 1917(DE3), and Escherichia coli BW25113(DE3), and among them, Escherichia coli W3110(DE3) is preferred.

[0015] In the third aspect of the present invention, an industrial production method of trans-aconitic acid is provided. The industrial production method includes: culturing and fermenting the above-mentioned Escherichia coli engineering strain, and separating and obtaining the trans-aconitic acid.

[0016] In the fourth aspect of the present invention, the application of the above-mentioned Escherichia coli engineering strain or the above-mentioned industrial production method in the fields of agriculture, food, chemical industry, and pharmaceutical industry is provided.

[0017] Beneficial technical effects of the above one or more technical solutions:

[0018] The above technical solution uses the common model microorganism E. coli as the starting strain, and by modifying its metabolic pathway, an Escherichia coli engineering strain with high yield of trans-aconitic acid is achieved. In the present invention, the related synthesis genes of succinic acid, lactic acid, acetic acid, formic acid, and ethanol are knocked out; the exogenous pyruvate carboxylase and citrate synthase are overexpressed, and the glyoxylate cycle is blocked to achieve the supply of the precursor cis-aconitic acid; finally, the accumulation of trans-aconitic acid in the fermentation broth is achieved by introducing a plasmid or integrating the genome, which can be used for the efficient fermentation production of trans-aconitic acid. Therefore, the above engineering bacteria have considerable application value and prospects. Brief Description of the Drawings

[0019] The specification drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention.

[0020] Figure 1 It is a schematic diagram of the trans-aconitic acid synthesis pathway and metabolic engineering transformation strategy in the Escherichia coli engineering strain constructed in the present invention. Detailed Embodiments

[0021] It should be noted that the following detailed descriptions are all illustrative and are intended to provide further descriptions of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0022] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they specify the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0023] As mentioned above, Aspergillus terreus is the only strain for producing trans - aconitic acid by microbial fermentation. However, A. terreus is a fungal pathogen with a potential risk of infection. E. coli has a short growth cycle, high space - time yield, clear genetic background, and is relatively easy to genetically modify; E. coli has good organic acid tolerance and the potential to produce high - concentration trans - aconitic acid.

[0024] In view of this, in a typical specific embodiment of the present invention, an engineered E. coli strain with high - yield trans - aconitic acid is provided. The engineered E. coli strain is obtained by using wild - type E. coli as the starting strain and introducing the synthesis pathway of trans - aconitic acid through a series of metabolic engineering modifications of the starting strain;

[0025] Among them, the series of metabolic engineering modifications of the starting strain include any one or more of the following methods:

[0026] (1) Inhibiting the by - product generation pathway in the glucose metabolism pathway to redirect the carbon flux to pyruvate;

[0027] (2) Strengthening the metabolic flux at the entrance of the TCA cycle;

[0028] (3) Blocking the downstream metabolism of isocitrate.

[0029] In the present invention, the starting strain can be any one of Escherichia coli W3110(DE3), Escherichia coli BL21(DE3), Escherichia coli Nissle 1917(DE3), and Escherichia coli BW25113(DE3), among which Escherichia coli W3110(DE3) is preferred.

[0030] Further, in the method (1), the method for inhibiting the generation pathway of by-products in the glucose metabolism pathway to redirect the carbon flux to pyruvate specifically includes inhibiting the synthesis of succinic acid, lactic acid, acetic acid, formic acid, and ethanol; further, it can be knocking out one or more of the following coding genes in the starting strain: fumarate reductase subunit A gene frdA, lactate dehydrogenase gene ldhA, pyruvate oxidase gene poxB, phosphotransacetylase-acetate kinase coding genes pta-ack, pyruvate formate lyase gene pflB, and alcohol dehydrogenase gene adhE.

[0031] In the method (2), the method for enhancing the metabolic flux at the entrance of the TCA cycle includes any one or two of the following: (2-1) overexpressing pyruvate carboxylase; (2-2) overexpressing citrate synthase.

[0032] Among them, the pyruvate carboxylase can specifically be a pyruvate carboxylase mutant Pyc P485S , which is derived from Corynebacterium glutamicum ATCC 13032 (Ohnishi J, Mitsuhashi S, Hayashi M, et al. A novel methodology employing Corynebacterium glutamicum genome information to generate a new L-lysine-producing mutant. Applied microbiology and biotechnology, 2002, 58:217-223). In the present invention, overexpression of pyruvate carboxylase is achieved by introducing the pyruvate carboxylase mutant coding gene pyc P485S . More specifically, the promoter used for the expression element of the pyruvate carboxylase is the PT7 promoter, and the start codon is changed from GTG to ATG; its integration site on the genome is the pseudogene ycgh.

[0033] The citrate synthase is specifically citrate synthase GltA, which is derived from Corynebacterium glutamicum ATCC 13032 (Eikmanns B J, Thum-Schmitz N, Eggeling L, et al. Nucleotide sequence, expression and transcriptional analysis of the Corynebacterium glutamicum gltA gene encoding citrate synthase. Microbiology, 1994, 140(8):1817-1828); in the present invention, overexpression of citrate synthase is achieved by introducing the citrate synthase encoding gene gltA. More specifically, the promoter used for the expression element of the citrate synthase is P T7 promoter, and the integration site on its genome is the by-product gene adhE.

[0034] In the method (3), blocking the downstream metabolism of isocitrate is to block the glyoxylate cycle pathway. The specific method includes knocking out the isocitrate lyase encoding gene aceA in the starting strain.

[0035] The method for introducing the synthetic pathway of trans-aconitic acid includes expressing aconitate isomerase Adi1 and trans-aconitate efflux protein TbrB in the starting strain. In the present invention, it is achieved by introducing the encoding gene adi1 of aconitate isomerase and the encoding gene tbrB of trans-aconitate efflux protein. Among them, the nucleotide sequence of the encoding gene adi1 of aconitate isomerase after codon optimization is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene tbrB of trans-aconitate efflux protein after codon optimization is shown in SEQ ID NO.2.

[0036] In another specific embodiment of the present invention, the encoding gene adi1 of aconitate isomerase and the encoding gene tbrB of trans-aconitate efflux protein are transferred into the production strain through an expression vector. The expression vector can be a plasmid vector, specifically pETDuet. The obtained recombinant expression vector is specifically pETDuet-adi1-tbrB, which can simultaneously express aconitate isomerase Adi1 and trans-aconitate efflux protein TbrB. The genes adi1 and tbrB are respectively located at multiple cloning site 1 (the restriction enzyme sites are BamHI and HindIII) and multiple cloning site 2 (the restriction enzyme sites are NdeI and KpnI) of the vector pETDuet-1.

[0037] In yet another specific embodiment of the present invention, the coding gene adi1 of aconitate isomerase and the coding gene tbrB of trans-aconitate efflux protein are integrated into different gene loci in the genome of the starting strain, so as to achieve multi-copy expression; further, the different gene loci at least include lacZ, yjhR, ynck and yfdf.

[0038] In yet another specific embodiment of the present invention, there is provided a method for constructing the above-mentioned Escherichia coli engineering strain with high-yield trans-aconitate, and the construction method includes:

[0039] Using wild-type Escherichia coli as the starting strain, performing a series of metabolic engineering transformations on the starting strain and introducing the synthesis pathway of trans-aconitate to obtain the Escherichia coli engineering strain with high-yield trans-aconitate.

[0040] Among them, the wild-type Escherichia coli can be any one of Escherichia coli W3110(DE3), Escherichia coli BL21(DE3), Escherichia coli Nissle 1917(DE3), Escherichia coli BW25113(DE3), and among them, Escherichia coli W3110(DE3) is preferred.

[0041] The series of metabolic engineering transformations performed on the starting strain and the introduction of the synthesis pathway of trans-aconitate have been elaborated in detail in the first aspect and will not be repeated here.

[0042] In yet another specific embodiment of the present invention, there is provided an industrial production method for trans-aconitate, and the industrial production method includes: fermenting and culturing the above-mentioned Escherichia coli engineering strain, and separating and obtaining the trans-aconitate.

[0043] Specifically, the specific conditions for the fermentation culture are: the temperature is controlled at 25-35 °C (preferably 30 °C), the stirring speed is controlled at 100-800 rpm (preferably 400 rpm), the ventilation volume is 0.5-5 vvm (preferably 1.5 vvm), and the pH is weakly acidic (pH 6.0); the medium used for the fermentation culture can be DMY medium.

[0044] It has been experimentally proven that the trans - aconitic acid production of the engineered strain E.coli W3110(DE3) introduced with the trans - aconitic acid production plasmid is 37.32 g / L, the yield is 0.76 g / g, and the production efficiency is 0.93 g / L / h. Additionally, the trans - aconitic acid production of the engineered strain with the genes of the trans - aconitic acid synthesis pathway integrated in multiple copies into the E.coli W3110(DE3) genome is 46.85 g / L, the yield is 0.51 g / g, and the production efficiency is 1.17 g / L / h.

[0045] The trans - aconitic acid production of the engineered strain E.coli BL21(DE3) introduced with the trans - aconitic acid production plasmid is 31.83 g / L, the yield is 0.56 g / g, and the production efficiency is 0.79 g / L / h.

[0046] The trans - aconitic acid production of the engineered strain E.coli Nissle 1917(DE3) introduced with the trans - aconitic acid production plasmid is 33.62 g / L, the yield is 0.62 g / g, and the production efficiency is 0.84 g / L / h.

[0047] The trans - aconitic acid production of the engineered strain E.coli BW25113(DE3) introduced with the trans - aconitic acid production plasmid is 21.76 g / L, the yield is 0.37 g / g, and the production efficiency is 0.54 g / L / h.

[0048] In another specific embodiment of the present invention, there is provided the application of the above - mentioned engineered E.coli strains or the above - mentioned industrial production method in the fields of agriculture, food, chemical industry, and pharmaceutical industry.

[0049] The following further explains the present invention through examples, but does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0050] The technologies not mentioned in the following examples are all conventional technologies in the art. The materials such as the strains, vector pETDuet - 1, DNA purification kit, plasmid extraction kit, etc. used are all commercial products. The CRISPR - Cas9 gene editing technology adopted in the present invention includes two knockout vectors, pEcCas9 and pEcgRNA.

[0051] The activation medium for E. coli and its derivative strains is Luria-Bertani medium (LB): 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl. 1.8% (wt / vol) agar powder is additionally added to the solid medium. Culture conditions: temperature 37°C, 180 rpm. During the construction of the engineered E. coli strains, according to the resistance requirements of the imported plasmids, the final concentrations of the antibiotics used are: kanamycin, 50 μg / mL; spectinomycin, 50 μg / mL; ampicillin, 100 μg / mL.

[0052] Fermentation medium (DMY): 13.5 g / L KH2PO4, 4 g / L (NH4)2HPO4, 1.7 g / L citric acid, 1.4 g / L MgSO4·7H2O, 4.5 mg / L vitamin B1, 10 mL / L trace element mother liquor, and 5 g / L yeast extract; the formula of the 100× trace element solution is: 10 g / L FeSO4·7H2O, 2.2 g / L ZnSO4·7H2O, 2 g / L CaCl2, 0.38 g / L MnSO4·H2O, 1.0 g / L CuSO4·5H2O, 0.02 g / L Na2B4O7·10H2O, 0.1 g / L (NH4)6Mo7O 24 Glucose is sterilized separately at 115°C and then added.

[0053] TSB buffer: 10% (w / v) PEG8000, 10% (v / v) glycerol, 5% (v / v) DMSO, 20 mM MgSO4, dissolved in LB medium, adjusted to pH 6.1 with hydrochloric acid solution, and autoclaved at 121°C for 20 min.

[0054] Electroporation buffer: 10% (v / v) glycerol, autoclaved at 121°C for 20 min.

[0055] Determination method of glucose

[0056] The fermentation sample is centrifuged at 13000 rpm for 2 min, and the supernatant of the fermentation broth obtained is diluted 100 times and then the glucose concentration is measured by an SBA-40D type biochemical analyzer.

[0057] Determination method of trans-aconitic acid and by-products

[0058] The fermented sample was heated in a metal bath at 105°C for 15 min, then centrifuged at 14,000 rpm for 15 min. The supernatant of the sample was diluted to an appropriate concentration, filtered through a 0.22-μm filter membrane, and used for HPLC detection. The specific detection method is as follows: The HPLC model is LC-20AT (Shimadzu, Japan), equipped with a refractive index detector and a diode array detector; the ion exchange chromatography column model is Aminex HPX-87H (300×7.8 mm, Bio-Rad, USA); the mobile phase is 5 mM dilute sulfuric acid; the flow rate is 0.5 mL / min; the column temperature is 30°C; the injection volume is 5 μL.

[0059] E. coli has a short growth cycle, high space-time yield, clear genetic background, and is relatively easy to genetically modify; E. coli has good organic acid tolerance and the potential to produce high concentrations of organic acids.

[0060] Example 1: Using wild-type E. coli W3110(DE3) as the starting strain, an engineering strain for producing trans-aconitic acid was constructed.

[0061] The strain E. coli W3110(DE3) grows using glucose under aerobic conditions, and by-products such as succinic acid, lactic acid, acetic acid, formic acid, and ethanol will accumulate in its fermentation broth, resulting in carbon loss. In the present invention, carbon loss is reduced by directly knocking out the encoding genes of related by-products, and at the same time, combined with other metabolic engineering modification strategies, the metabolic flux of glucose is directed to the supply of the precursor cis-aconitic acid.

[0062] 1.1 Knock out genes related to by-product synthesis

[0063] In the present invention, the CRISPR-Cas9 gene editing technology is used to edit the by-product genes. Further, taking the construction of the strain E. coli W3110(DE3)-ΔfrdA as an example, the basic operating procedure for knocking out the by-product gene frdA is demonstrated.

[0064] 1.1.1 Knock out of the fumarate reductase subunit A gene frdA

[0065] The basic procedure for constructing the strain E. coli W3110(DE3)-ΔfrdA is as follows:

[0066] Prepare chemically competent cells

[0067] After activating the starting strain E. coli W3110(DE3) in LB for 1 generation, transfer it to a new LB and culture it until the OD 600 is 0.5 - 0.6; subsequently, take 1 mL of the bacterial solution, centrifuge it at 6,000 rpm at 4°C for 10 min; discard the supernatant and resuspend the cells with 50 μL of TSB solution to prepare chemically competent cells.

[0068] Introduce the pEcCas9 knockout vector

[0069] Extract the knockout vector pEcCas9 according to the extraction procedure of the plasmid extraction kit. Then, use the heat shock method to transform pEcCas9 into competent E. coli W3110(DE3) cells to obtain the E. coli W3110(DE3)-pEcCas9 strain.

[0070] Prepare the dsDNA-N20-frdA fragment

[0071] Use the online website https: / / chopchop.cbu.uib.no / to design the N20 sequence of the frdA gene. Design reverse complementary primers gRNA-frdA-F and gRNA-frdA-R according to the screened N20 sequence. The two primers are annealed to form the dsDNA-N20-frdA fragment.

[0072] Annealing system: 25 μL ddH2O, 5 μL T4 ligase buffer, 10 μL gRNA-frdA-F, 10 μL gRNA-frdA-R (primer concentration is 10 μM).

[0073] Annealing procedure: Incubate the annealing system at 95 °C for 5 min, then gradually lower the reaction temperature to 16 °C by programmed cooling and keep it at 16 °C for 10 min.

[0074] Construct the knockout vector pEcgRNA-dsDNA-N20-frdA

[0075] Extract the knockout vector pEcgRNA according to the extraction procedure of the plasmid extraction kit. After single digestion with BsaI, obtain the linear vector pEcgRNA; then ligate it with the dsDNA-N20-frdA fragment under the action of T4 DNA ligase to obtain pEcgRNA-dsDNA-N20-frdA.

[0076] T4 DNA ligation system: 6 μL dsDNA-N20-frdA fragment (diluted 200 times), 1 μL linear pEcgRNA vector, 1 μL T4 ligase buffer, 1 μL T4 DNA ligase, 1 μL ddH2O.

[0077] The T4 DNA ligation system was transformed into competent E. coli DH5α cells by heat shock method, spread on solid plates containing spectinomycin, and cultured in an inverted position. Finally, single colonies were picked from the plates and cultured in LB (containing spectinomycin). After centrifuging to collect the cells, plasmid pEcgRNA-dsDNAN20-frdA was extracted according to the extraction procedure of the plasmid extraction kit, and the obtained plasmid was stored frozen at -20°C.

[0078] Construct the donor fragment for frdA gene knockout

[0079] Using the genome of E. coli W3110(DE3) as a template, the upstream homologous arm fragment of the frdA gene was amplified by PCR with uf-frdA / ur-frdA as primers; the downstream

[0080] homologous arm fragment of the frdA gene was amplified by PCR with df-frdA / dr-frdA as primers; the upstream homologous arm and the downstream homologous arm were subjected to overlap PCR, and after gel recovery, the fusion fragment of the upstream and downstream homologous arms of the frdA gene, that is, the donor fragment for frdA gene knockout, was obtained. Among them, the primer design for amplifying the donor fragment for frdA gene knockout is as follows:

[0081] uf-frdA- W3110 : GCAACCAGCAGGCGTTTCATA

[0082] ur-frdA- W3110 : CGCACCACCTCAATTTTCAGGTTTTTCATCGACATTCCTCCAGATTG

[0083] df-frdA- W3110 : AACCTGAAAATTGAGGTGGTGCGCTATAACC

[0084] dr-frdA- W3110 : CTATCTTCGTTATAACGATGCGCCAG

[0085] Prepare electrocompetent cells of E. coli W3110(DE3)-pEcCas9

[0086] The E. coli W3110(DE3)-pEcCas9 strain was activated in LB for 12 h, and then transferred to a shake flask containing 50 mL of LB at an inoculation amount of 1% (10 mM arabinose was used to induce the expression of λRed recombinant protein); subsequently, the shake flask was placed at 37°C and cultured at 180 rpm. When the OD of the strain 600When nm is 0.5 - 0.6, take out the shake flask and place it in an ice bath for 10 min. Then, centrifuge at 4°C and 6000 rpm for 10 min using a low-temperature high-speed centrifuge, and discard the supernatant. Wash the cells twice with ice-cold ddH2O and then once with ice-cold 10% (v / v) glycerol. Finally, resuspend the cells in 150 μL of ice-cold 10% glycerol to obtain electrocompetent E. coli W3110(DE3)-pEcCas9 cells, which can be stored frozen at -80°C.

[0087] Construct the strain E. coli W3110(DE3)-ΔfrdA

[0088] Mix the knockout vector pEcgRNA-dsDNA-N20-frdA (about 200 ng) and the donor fragment for frdA gene knockout (about 400 ng) with the electrocompetent cells E. coli W3110(DE3)-pEcCas9. Immediately transfer the mixture into a 2 mm electroporation cuvette and place it in an ice bath for 3 min. Then, use an electroporator to transfer both into the electrocompetent cells E. coli W3110(DE3)-pEcCas9. After electroporation, immediately add 1 mL of LB to the cuvette to resuspend the cells and transfer them to a new 1.5 mL centrifuge tube. Incubate at 37°C and 960 rpm for 1 h. Finally, centrifuge the bacterial suspension at 6000 rpm for 2 min, discard the supernatant, and streak the remaining cells on a double-antibiotic LB solid screening medium (kanamycin + spectinomycin) in zones. After single colonies grow on the double-antibiotic plate, pick them into a new LB for culture and verify the bacterial suspension by colony PCR using the primers uf-frdA / dr-frdA.

[0089] Transfer the monoclonal with correct PCR verification to a new LB shake tube (10 mM rhamnose + kanamycin) and culture it at 37°C and 180 rpm for 12 - 16 h. Then, use a sterile spreader to streak it on a new LB solid plate (kanamycin) in zones until new single colonies form. Next, use a sterile toothpick to pick a new single colony and spot it successively on a new LB solid plate containing spectinomycin and a new LB solid plate containing kanamycin, and incubate it in an inverted position. Finally, the monoclonal that grows on the kanamycin plate but not on the spectinomycin plate is the strain that has successfully eliminated pEcgRNA-dsDNA-N20-frdA.

[0090] Transfer the monoclonal that successfully eliminates pEcgRNA-dsDNA-N20-frdA into a new LB shaking tube, culture it at 37 °C and 180 rpm for 12 - 16 h, then use a sterile spreading rod to streak it on an LB solid plate containing 10% sucrose until new monoclonal colonies form; similarly, use a sterile toothpick to pick a new monoclonal colony, spot it successively on a new LB solid plate with kanamycin and an antibiotic-free LB solid plate, and incubate them in an inverted position; finally, the monoclonal colonies that grow on the antibiotic-free LB solid plate but not on the kanamycin plate are the strains that have successfully eliminated pEcCas9.

[0091] Transfer the monoclonal colonies that simultaneously eliminate pEcgRNA-dsDNA-N20-frdA and pEcCas9 into a new LB medium, extract their genomes according to the operating procedures of the genomic DNA extraction kit, and use the primers uf-frdA / dr-frdA for the final temperature gradient verification (the temperature gradient verification range is 50 - 70 °C); transfer the strain mutant E. coli W3110(DE3)-ΔfrdA with the correct electrophoretic band size and store it in 15% glycerol.

[0092] 1.1.2 Knockout of lactate dehydrogenase gene ldhA

[0093] Similarly, the construction of the ldhA gene knockout vector and the knockout steps can be completed by referring to the above-mentioned knockout procedure of the frdA gene. Among them, the primer design for amplifying the ldhA gene knockout donor fragment is as follows:

[0094] uf-ldhA- W3110 : CAAGCAGAATCAAGTTCTACCGTGCCGA

[0095] ur-ldhA- W3110 : TGGAATGCAGGGGAGCGGCAAGAAAGACTTTCTCCAGTGATGT

[0096] df-ldhA- W3110 : AGAAAGTCTTTCTTGCCGCTCCCCTGCATTCCAG

[0097] dr-ldhA- W3110 : TGTCTGTTTTGCGGTCGCCAG

[0098] 1.1.3 Knockout of pyruvate oxidase gene poxB

[0099] Similarly, the construction and knockout steps of the gene poxB knockout vector can be completed with reference to the above-mentioned gene frdA knockout procedure. Among them, the primer design for amplifying the gene poxB knockout donor fragment is as follows:

[0100] uf-poxB- W3110 : GCTCCGTATATGGATTGGGTAGA

[0101] ur-poxB- W3110 : TGACGGGAAATGCCACCCTTTGGTTCTCCATCTCCTGAATGT

[0102] df-poxB- W3110 : CCAAAGGGTGGCATTTCCCGTCATA

[0103] dr-poxB- W3110 : TCCCATGCTTCTTTCAGGTATTCC

[0104] 1.1.4 Knockout of the phosphotransacetylase-acetate kinase encoding gene pta-ack

[0105] Similarly, the construction and knockout steps of the gene pta-ack knockout vector can be completed with reference to the above-mentioned gene frdA knockout procedure. Among them, the primer design for amplifying the gene pta-ack knockout donor fragment is as follows:

[0106] uf-pta-ack- W3110 : CGATCGGCGGCATAAAACGGAT

[0107] ur-pta-ack- W3110 : GAGCTGGCGGTGTGAAAGGAAGTACCTATAATTGATACGTGG

[0108] df-pta-ack- W3110 : TTCCTTTCACACCGCCAGCTC

[0109] dr-pta-ack- W3110 : AGTGCCCTGAGACATAACGAA

[0110] 1.1.5 Knockout of the pyruvate formate-lyase gene pflB

[0111] Similarly, the construction and knockout steps of the gene pflB knockout vector can be completed with reference to the above-mentioned gene frdA knockout procedure. Among them, the primer design for amplifying the gene pflB knockout donor fragment is as follows:

[0112] uf-pflB- W3110 : ACCTGGGGTCAGTTGGCGAAA

[0113] ur-pflB- W3110 : TCCACTTAAGAAGGTAGGTGTTACTTAGATTTGACTGAAATCGTACAG

[0114] df-pflB- W3110 : GTAACACCTACCTTCTTAAGTGGA

[0115] dr-pflB- W3110 : CGTCGTTCATCTGTTTGAGATCGA

[0116] 1.1.6 Knockout of ethanol dehydrogenase gene adhE

[0117] Similarly, the construction of the adhE gene knockout vector and the knockout procedure can be completed by referring to the above-mentioned knockout procedure of the frdA gene. Among them, the primer design for amplifying the adhE gene knockout donor fragment is as follows:

[0118] uf-adhE- W3110 : TCTGAATCACGGTTAGCTCCGAAGC

[0119] ur-adhE- W3110 : ATGTTGCCAGACAGCGCTACTGAAATGCTCTCCTGATAATGTTAA

[0120] df-adhE- W3110 : TCAGTAGCGCTGTCTGGCAACATAAACG

[0121] dr-adhE- W3110 : CCGTGCCAGTCATCCTTCAGGTAA

[0122] Finally, the genotype of the Escherichia coli mutant strain with the correct knockout of the related by-product genes is E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE.

[0123] 1.2 Enhancing the metabolic flux of the TCA cycle

[0124] Based on the pyruvate-accumulating strain E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE, a metabolic engineering strategy of overexpressing pyruvate carboxylase and citrate synthase was adopted to enhance the metabolic flux at the entry of the TCA cycle.

[0125] 1.2.1 Insert the coding gene pyc of the pyruvate carboxylase mutant at the pseudogene ycgh locus P458S

[0126] Construct the mutant pyc P458S Gene fragment

[0127] Using the genome of C. glutamicum ATCC13032 as a template, use uf-pyc P458S / ur-pyc P458S

[0128] as primers to PCR amplify the upstream fragment of the gene pyc; use df-pyc P458S / dr-pyc P458S as primers to PCR amplify the downstream fragment of the gene pyc; perform overlap PCR on the upstream and downstream fragments, and after gel recovery, obtain the gene fragment pyc after fusion of the upstream and downstream of the pyc gene P458S ; in addition, the start codon of this mutant also changes from GTG to ATG. Among them, the primer design for constructing the mutant pyc P458S gene fragment is as follows:

[0129] uf-pyc P458S : GTATAAGAAGGAGATATACATATGTCGACTCACACATCTTCAACG

[0130] ur-pyc P458S : GTGGAGCCTGAAGGAGGTGCGAGTGATCGGCAATGAATCCGGTG

[0131] df-pyc P458S : CGCACCTCCTTCAGGCTCCAC

[0132] dr-pyc P458S : GTTTCTTTACCAGACTCGAGGGTACCTTAGGAAACGACGACGATC

[0133] Construct the gene element for expressing the mutant pyc T7 under the P P458S promoter

[0134] The commercial vector pETDuet-1 was digested with the enzymes NdeI and KpnI, and the linearized pETDuet-1 vector was obtained after gel recovery; subsequently, the pyc P458S gene fragment was ligated to the linearized vector pETDuet-1 by TEDA ligation to obtain the vector pETDuet-pyc P458S . Finally, using the vector pETDuet-pyc P458S as a template and mf-ycgh::pyc P458S / mr-ycgh::pyc P458S as primers for PCR amplification, the gene element expressed by the promoter P T7 promoter mutant pyc P458S can be obtained. Among them, the primer design for constructing the gene element expressed by the promoter P T7 promoter mutant pyc P458S is as follows:

[0135] mf-ycgh::pyc P458S : TAATACGACTCACTATAGGCCATCT

[0136] mr-ycgh::pyc P458S : CAAAAAACCCCTCAAGACCCGT

[0137] Construct the donor fragment for pyc P458S gene knock-in

[0138] Using the E. coli W3110(DE3) genome as a template, the upstream homologous arm fragment of the gene ycgh was amplified by PCR with uf-ycgh::pyc P458S / ur-ycgh::pyc P458S as primers; the downstream homologous arm fragment of the gene ycgh was amplified by PCR with df-ycgh::pyc P458S / dr-ycgh::pyc P458S as primers; the upstream homologous arm, the mutant pyc P458S gene fragment and the downstream homologous arm were subjected to overlap PCR, and after gel recovery, the fusion fragment of the upstream and downstream homologous arms of the ycgh gene and the mutant pyc P458S gene fragment, that is, the donor fragment for mutant pyc P458S gene knock-in, was obtained. Among them, the primer design for the donor fragment for pyc P458S gene knock-in is as follows:

[0139] uf-ycgh::pyc P458S -W3110: CAGTACCGGGCTGGGAGAAGTGC

[0140] ur-ycgh::pyc P458S -W3110: ACTAAGATGGCCTATAGTGAGTCGTATTAAGATTAACCATCCATTCATT

[0141] mf-ycgh::pyc P458S -W3110: TAATACGACTCACTATAGGCCATCT

[0142] mr-ycgh::pyc P458S -W3110: CAAAAAACCCCTCAAGACCCGT

[0143] df-ycgh::pyc P458S -W3110: GGGTCTTGAGGGGTTTTTTGTCCCGCCGTTAGCTAAAAAACCGCGTCG

[0144] dr-ycgh::pyc P458S -W3110: AGTGGGTGCCGCCGTTGGTGCTG

[0145] Exogenous gene pyc P458S The construction of the knock-in vector and the knock-in steps can be completed by referring to the knockout procedure of the above gene frdA. Finally, the correct knock-in of the exogenous gene pyc P458S The genotype of the E. coli mutant strain is E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE-Δycgh::P T7 pyc P458S .

[0146] 1.2.2 Insert the coding gene gltA of citrate synthase at the adhE locus of the by-product gene

[0147] Similarly, the construction of the knock-in donor fragment of the exogenous gene gltA can be completed by referring to the construction process of the knock-in donor fragment of the above gene pyc P458S ; the construction of its knock-in vector and the knock-in steps can be completed by referring to the knockout procedure of the above gene frdA. Finally, the genotype of the E. coli mutant strain with the correct knock-in of the exogenous gene gltA is E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7gltA. Among them, the primer design for constructing the exogenous gene gltA knock-in donor fragment is as follows:

[0148] uf-adhE::gltA- W3110 : TCTGAATCACGGTTAGCTCCGAAGC

[0149] ur-adhE::gltA- W3110 : GGCCTATAGTGAGTCGTATTAAATGCTCTCCTGATAATGTTAAACTT

[0150] mf-adhE::gltA- W3110 : TAATACGACTCACTATAGGCCATCT

[0151] mr-adhE::gltA- W3110 : CAAAAAACCCCTCAAGACCCGT

[0152] df-adhE::gltA- W3110 : ACGGGTCTTGAGGGGTTTTTTGTCAGTAGCGCTGTCTGGCAATATAAACG

[0153] df-adhE::gltA- W3110 : CCGTGCCAGTCATCCTTCAGGTAA

[0154] 1.3 Blocking the glyoxylate cycle to increase the supply of the precursor cis-aconitic acid

[0155] Based on the strain E.coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA, block the glyoxylate cycle pathway to reduce the utilization of isocitrate.

[0156] Knocking out the coding gene aceA of isocitrate lyase in the glyoxylate cycle pathway can block the cleavage of isocitrate, thereby achieving the purpose of increasing the concentration of cis-aconitic acid in the cell. Similarly, the construction and knockout steps of the gene aceA knockout vector can be completed by referring to the knockout procedure of the above gene frdA. Finally, the genotype of the Escherichia coli mutant strain with the correct knockout of the gene aceA is E.coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S-ΔadhE::P T7 gltA-ΔaceA. Among them, the primer design for amplifying the donor fragment of aceA gene knockout is as follows:

[0157] uf-aceA- W3110 : GTATTCAACGACATTCTCGGCTCCC

[0158] ur-aceA- W3110 : AGTCAGCAACGGTTGTTGTTGCGTGCAGATGCTCCATAGTTA

[0159] df-aceA- W3110 : GCAACAACAACCGTTGCTGACTGTA

[0160] dr-aceA- W3110 : CACGGAGTTAAAAAAGCTCTCCGCA

[0161] Example 2: Introducing the biosynthetic pathway of trans-aconitic acid into an engineered strain

[0162] 2.1 Construction of an engineered strain for producing trans-aconitic acid based on a plasmid

[0163] In this example, the coding genes of aconitate isomerase Adi1 and trans-aconitate efflux protein TbrB were both codon-optimized according to the host E. coli W3110(DE3) and synthesized by a company. The genes adi1 and tbrB are located in multiple cloning site 1 (the restriction enzyme sites are BamHI and HindIII) and multiple cloning site 2 (the restriction enzyme sites are NdeI and KpnI) of the commercial vector pETDuet-1 respectively, and the promoter used for both is P T7 promoter. The nucleic acid sequence of the gene of aconitate isomerase Adi1 is shown as SEQ ID NO.1; the nucleic acid sequence of the gene of trans-aconitate efflux protein TbrB is shown as SEQ ID NO.2. Through the method of TSB chemical transformation, the trans-aconitic acid production plasmid pETDuet-adi1-tbrB was introduced into the chassis strain E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA to obtain an E. coli engineered strain that can produce trans-aconitic acid using the plasmid.

[0164] 2.2 Construction of an engineered strain for the production of trans - aconitic acid based on multi - copy chromosomal integration

[0165] In this example, the genes of the trans - aconitic acid synthesis pathway are introduced into different gene loci in the genome. First, using pETDuet - adi1 - tbrB as a template, a knock - in fragment of genes adi1 and tbrB (P T7 -RBS-adi1-P T7 -RBS-tbrB-T7Terminator) was cloned by PCR using high - fidelity enzyme. Then, the CRISPR - Cas9 gene editing technology was used to insert the knock - in fragment into four gene loci, namely lacZ, yjhR, ynck, and yfdf of the engineered strain successively. The genotype of the finally obtained trans - aconitic acid - producing strain is: E.coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA-ΔlacZ::P T7 adi1-tbrB-ΔyjhR::P T7 adi1-tbrB-Δyfdf::P T7 adi1-tbrB-Δynck::P T7 adi1-tbrB.

[0166] 2.2.1 Insertion of genes of the trans - aconitic acid synthesis pathway at the lacZ gene locus

[0167] Similarly, the construction of the gene knock - in donor fragment of the trans - aconitic acid synthesis pathway can be completed with reference to the above - mentioned construction process of the pyc P458S gene knock - in donor fragment; the construction of its knock - in vector and the knock - in steps can be completed with reference to the above - mentioned gene knockout procedure of frdA. Finally, the genotype of the Escherichia coli mutant strain with correct knock - in at the lacZ gene locus is E.coliW3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔlacZ::P T7 adi1-tbrB. Among them, the primer design for amplifying the gene knock - in donor fragment of the trans - aconitic acid synthesis pathway is as follows:

[0168] uf-lacZ::P T7 adi1-tbrB: CCAGTCTGGCCCTGCACGCG

[0169] ur-lacZ::P T7 adi1-tbrB: AGCTGTTTCCTGTGTGAAATTGTT

[0170] mf-lacZ::P T7 adi1-tbrB: GATAACAATTTCACACAGGAAACAGCTTAATACGACTCACTATAGG

[0171] mr-lacZ::P T7 adi1-tbrB: GCAGACATGGCCTGCCCGGTTATTACAAAAAACCCCTCAAGACCCGT

[0172] df-lacZ::P T7 adi1-tbrB: TAATAACCGGGCAGGCCATGTCT

[0173] df-lacZ::P T7 adi1-tbrB: TAACCACTTCCAGCGCTGAG

[0174] 2.2.2 Insertion of genes of the trans-aconitic acid synthesis pathway at the yjhR gene locus

[0175] Similarly, the genomic integration step of the second copy number of the genes of the trans-aconitic acid synthesis pathway can refer to the integration procedure of the lacZ gene locus above. Finally, the genotype of the Escherichia coli mutant strain with correct knock-in at the yjhR gene locus is E.coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔlacZ::P T7 adi1-tbrB-ΔyjhR::P T7 adi1-tbrB. Among them, the primer design for amplifying the genes of the trans-aconitic acid synthesis pathway as the gene knock-in donor fragment is as follows:

[0176] uf-yjhR::P T7 adi1-tbrB: ATTTACTGGAAAAGGCAGATGACACT

[0177] ur-yjhR::P T7adi1 - tbrB: GGCCTATAGTGAGTCGTATTACGGTGACCGCCTGAGCGGCCACCTTTAAT

[0178] mf - yjhR::P T7 adi1 - tbrB: TAATACGACTCACTATAGG

[0179] mr - yjhR::P T7 adi1 - tbrB: TAATACGACTCACTATAGG

[0180] df - yjhR::P T7 adi1 - tbrB: CGGGTCTTGAGGGGTTTTTTGATGTGATGAGCCGTTCATGATACAGG

[0181] df - yjhR::P T7 adi1 - tbrB: GGCTCGAACAGCAGGCAATTG

[0182] 2.2.3 Insertion of genes of the trans - aconitic acid synthesis pathway at the yfdf gene locus

[0183] Similarly, for the genomic integration step of the third copy number of the genes of the trans - aconitic acid synthesis pathway, the integration procedure at the lacZ gene locus described above can be referred to. Finally, the genotype of the Escherichia coli mutant strain with correct knock - in at the yfdf gene locus is E.coli W3110(DE3)-ΔfrdA - ΔldhA - ΔpoxB - Δpta - ack - ΔpflB - Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA - ΔlacZ::P T7 adi1 - tbrB - Δyfdf::P T7 adi1 - tbrB. Among them, the primer design for amplifying the knock - in donor fragment of the trans - aconitic acid synthesis pathway is as follows:

[0184] uf - yfdf::P T7 adi1 - tbrB: TAATAAAGATGCTTCAGTCGACG

[0185] ur - yfdf::P T7 adi1 - tbrB: GGCCTATAGTGAGTCGTATTAGATTTTATTCCATGTTGATTGATTTGTTA

[0186] mf - yfdf::PT7 adi1 - tbrB: TAATACGACTCACTATAGG

[0187] mr - yfdf::P T7 adi1 - tbrB: CAAAAAACCCCTCAAGACCCGT

[0188] df - yfdf::P T7 adi1 - tbrB: AACGGGTCTTGAGGGGTTTTTTGGGTAATGACTCCAACTTATTGATAGTGT

[0189] df - yfdf::P T7 adi1 - tbrB: GCGTTGGCCTCAACACGATTTTACG

[0190] 2.2.4 Insertion of genes of the trans - aconitic acid synthesis pathway at the ynck gene locus

[0191] Similarly, for the genomic integration step of the fourth copy number of the genes of the trans - aconitic acid synthesis pathway, the integration procedure at the lacZ gene locus mentioned above can be referred to. Finally, the genotype of the Escherichia coli mutant strain with correct knock - in at the ynck gene locus is E.coli W3110(DE3)-ΔfrdA - ΔldhA - ΔpoxB - Δpta - ack - ΔpflB--Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA - ΔlacZ::P T7 adi1 - tbrB - Δyfdf::P T7 adi1 - tbrB - Δynck::P T7 adi1 - tbrB. Among them, the primer design for amplifying the knock - in donor fragment of the trans - aconitic acid synthesis pathway is as follows:

[0192] uf - ynck::P T7 adi1 - tbrB: TACTTCACTTTCTGTCTGAATACTGATGT

[0193] ur - ynck::P T7 adi1 - tbrB: CCTATAGTGAGTCGTATTATTGACCTGTGAAACGATTACAGGCATT

[0194] mf - ynck::P T7 adi1 - tbrB: TAATACGACTCACTATAGG

[0195] mr-ynck::P T7 adi1-tbrB: CAAAAAACCCCTCAAGACCCGT

[0196] df-ynck::P T7 adi1-tbrB: AACGGGTCTTGAGGGGTTTTTTGCGATGGCGCGTCTGGAACTACTT

[0197] df-ynck::P T7 adi1-tbrB: AACAACCTCGGCTACAGGTAAACC

[0198] Example 3: Fermentation production of trans-aconitic acid using an engineered Escherichia coli strain

[0199] 3.1 Fermentation production of trans-aconitic acid based on plasmid

[0200] 3.1.1 Plate activation: Take an appropriate amount of the bacterial solution of E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA(pEETDuet-adi1-tbrB) from the glycerol tube, and use a sterile spreading rod to streak it in zones on a new ampicillin solid plate; culture it at 37 °C until monoclonal colonies are formed on the plate.

[0201] 3.1.2 Tube activation: Pick a monoclonal colony from the above-mentioned ampicillin solid plate and transfer it to an LB tube, and culture it at 37 °C and 180 rpm for 12 h.

[0202] 3.1.3 Flask activation: Transfer the seed solution after tube activation to a flask containing 400 mL of LB medium according to an inoculation amount of 1%, and continue to activate and culture it at 37 °C and 180 rpm for 12 h.

[0203] 3.1.4 Fermentation tank fermentation culture: According to an inoculation amount of 10% (v / v), inoculate the seed solution after flask activation into the fermentation medium containing glucose. Among them, the fermentation conditions are set as follows: the liquid loading is 4.0 L, the fermentation temperature is 30 °C, the rotation speed is 400 rpm, the aeration is 1.5 vvm, and the pH is adjusted to 6.0 with 5 M sodium hydroxide solution. After fermentation culture for 3 h, add the inducer IPTG (working concentration 0.25 mM) to induce the expression of key proteins; thereafter, sample every 6 h to measure its sugar consumption, OD 600nm , trans-aconitic acid and by-product concentrations. When glucose is no longer consumed, stop fermentation.

[0204] The fermentation results showed that the engineered strain E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA(pEETDuet-adi1-tbrB) produced 37.32 g / L of trans-aconitic acid, with a yield of 0.76 g / g and a productivity of 0.93 g / L / h.

[0205] 3.2 Fermentation production of trans-aconitic acid based on the genome

[0206] Similarly, the engineered strain E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA-ΔlacZ::P T7 adi1-tbrB-ΔyjhR::P T7 adi1-tbrB-Δyfdf::P T7 adi1-tbrB-Δynck::P T7 The process of fermenting and producing trans-aconitic acid by adi1-tbrB can refer to the process of producing trans-aconitic acid based on plasmids in the above 3.1; however, no antibiotics are added during the fermentation process.

[0207] The fermentation results showed that the engineered strain E. coli W3110(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA-ΔlacZ::P T7 adi1-tbrB-ΔyjhR::P T7 adi1-tbrB-Δyfdf::P T7 adi1-tbrB-Δynck::P T7 The yield of trans-aconitic acid produced by adi1-tbrB was 46.85 g / L, the yield was 0.51 g / g, and the productivity was 1.17 g / L / h.

[0208] Example 4: Using the wild-type E. coli BL21(DE3) as the starting strain, an engineered strain for producing trans-aconitic acid was constructed.

[0209] 4.1 Knock out genes related to by-products

[0210] Knock out the related synthesis genes frdA, ldhA, poxB, Δpta-ack, ΔpflB, ΔadhE of by-products in the starting strain E. coli BL21(DE3). The knockout steps of the related genes can refer to Example 1 of the present invention.

[0211] 4.1.1 Knockout of fumarate reductase subunit A gene frdA

[0212] The construction and knockout steps of the fumarate reductase subunit A gene frdA knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) is used as a template to amplify the donor fragment for frdA knockout. Among them, the primer design for amplifying the donor fragment for frdA knockout is as follows:

[0213] uf-frdA- BL21 : CGTGTCTCAAACGGGACCAAATG

[0214] ur-frdA- BL21 : AGCGCACCACCTCAATTTTCAGGTTTTTCATCGACATTCCTCCAGATTGTTTTTAT

[0215] df-frdA- BL21 : ATAAAAACAATCTGGAGGAATGTCGATGAAAAACCTGAAAATTGAGGTGGTGCG

[0216] dr-frdA- BL21 : CGATGAACTCTGGGTTCAGGC

[0217] 4.1.2 Knockout of lactate dehydrogenase gene ldhA

[0218] The construction and knockout steps of the lactate dehydrogenase gene ldhA knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) is used as a template to amplify the donor fragment for ldhA knockout. Among them, the primer design for amplifying the donor fragment for ldhA knockout is as follows:

[0219] uf-ldhA- BL21 : CAAGCAGAATCAAGTTCTACCATGC

[0220] ur-ldhA- BL21: AGCGGCAAGATTAAACCAGTTCGTTCAAGACTTTCTCCAGTGATGT

[0221] df-ldhA- BL21 : TCAACATCACTGGAGAAAGTCTTGAACGAACTGGTTTAATCTTGCCGCT

[0222] dr-ldhA- BL21 : TGTCTGTTTCGCGGTCGCC

[0223] 4.1.3 Knockout of pyruvate oxidase gene poxB

[0224] The construction and knockout steps of the pyruvate oxidase gene poxB knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) was used as a template to amplify the donor fragment for poxB gene knockout. Among them, the primer design for amplifying the donor fragment for poxB gene knockout is as follows:

[0225] uf-poxB- BL21 : GCGGCCCGGCTCCGTATATGG

[0226] ur-poxB- BL21 : CCTTATTATGACGGGAAATGCCACCCTTTGGTTCTCCATCTCCTGAATGTG

[0227] df-poxB- BL21 : ATCACATTCAGGAGATGGAGAACCAAAGGGTGGCATTTCCCGTCATAATAAGG

[0228] dr-poxB- BL21 : AATTCCCATGCTTCTTTCAGGT

[0229] 4.1.4 Knockout of phosphotransacetylase-acetate kinase encoding gene pta-ack

[0230] The construction and knockout steps of the phosphotransacetylase-acetate kinase encoding gene pta-ack knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) was used as a template to amplify the donor fragment for pta-ack gene knockout. Among them, the primer design for amplifying the donor fragment for pta-ack gene knockout is as follows:

[0231] uf-pta-ack-BL21 : ATCCGTAACCACGCTCAATAATTGTTTGCAGG

[0232] ur-pta-ack- BL21 : AGCGCAAAGCTGCGGATGATGACGAGAGGAAGTACCTATAATTGATACGTGGC

[0233] df-pta-ack- BL21 : AGCCACGTATCAATTATAGGTACTTCCTCTCGTCATCATCCGCAGCTTTGCGCT

[0234] dr-pta-ack- BL21 : GAAAGAAGCGGTCGGACTCATGCAC

[0235] 4.1.5 Knockout of pyruvate formate-lyase gene pflB

[0236] The construction and knockout steps of the knockout vector for pyruvate formate-lyase gene pflB can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) was used as the template to amplify the donor fragment for pflB gene knockout. Among them, the primer design for amplifying the donor fragment for pflB gene knockout is as follows:

[0237] uf-pflB- BL21 : ATATGACCGCAAATGGTCAATG

[0238] ur-pflB- BL21 : ACTGTACGATTTCAGTCAAATCTAAGTAACACCTACCTTCTTAAGTG

[0239] df-pflB- BL21 : TCCACTTAAGAAGGTAGGTGTTACTTAGATTTGACTGAAATCGTACAGT

[0240] dr-pflB- BL21 : ACAGGTATGAATGCCTTCTTTTTTGC

[0241] 4.1.6 Knockout of alcohol dehydrogenase gene adhE

[0242] The construction and knockout steps of the ethanol dehydrogenase gene adhE knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) was used as a template to amplify the donor fragment for adhE gene knockout. Among them, the primers for amplifying the donor fragment for adhE gene knockout were designed as follows:

[0243] uf-adhE- BL21 : AAAATCAAAAAAGGTCTGAATCACGGTT

[0244] ur-adhE- BL21 : GCCAGACAGCGCTACTGAAATGCTCTCCTGATAATGTTAAA

[0245] df-adhE- BL21 : CATTATCAGGAGAGCATTTCAGTAGCGCTGTCTGGCAA

[0246] dr-adhE- BL21 : ATTAAAAACCATCTGTTTTTGTGGCCGTAA

[0247] Finally, the genotype of the E. coli mutant strain with the correct knockout of the relevant by-product genes is E. coli BL21(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE.

[0248] 4.2 Enhancing the metabolic flux of the TCA cycle

[0249] Based on the pyruvate-accumulating strain E. coli BL21(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE, a metabolic engineering strategy of overexpressing pyruvate carboxylase and citrate synthase was adopted to enhance the metabolic flux at the entry of the TCA cycle.

[0250] 4.2.1 Inserting the coding gene pyc of the pyruvate carboxylase mutant at the pseudogene ycgh locus P458S

[0251] The gene pyc P458S The construction and insertion steps of the knock-in vector can refer to Example 1.2.1 of the present invention. Finally, the genotype of the E. coli mutant strain with the correct knock-in of the foreign gene pyc P458S is E. coli BL21(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE-Δycgh::P T7 pycP458S Among them, the amplified gene pyc P458S The primer design for the knock-in donor fragment is as follows:

[0252] uf-ycgh::pyc P458S - BL21 : CAGTACCGGGCTGGGAGAAGTGC

[0253] ur-ycgh::pyc P458S - BL21 : ACTAAGATGGCCTATAGTGAGTCGTATTAAGATTAACCATCCATTCATT

[0254] mf-ycgh::pyc P458S - BL21 : TAATACGACTCACTATAGGCCATCT

[0255] mr-ycgh::pyc P458S - BL21 : CAAAAAACCCCTCAAGACCCGT

[0256] df-ycgh::pyc P458S - BL21 : GGGTCTTGAGGGGTTTTTTGTCCCGCCGTTAGCTAAAAAACCGCGTCG

[0257] dr-ycgh::pyc P458S - BL21 : AGTGGGTGCCGCCGTTGGTGCTG

[0258] 4.2.2 Insert the citrate synthase-encoding gene gltA at the adhE locus of the by-product gene

[0259] For the gene gltA knock-in vector and knock-in steps, refer to Example 1.2.2 of the present invention. Finally, the genotype of the Escherichia coli mutant strain with the exogenous gene gltA correctly knocked in is E.coli BL21(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA. Among them, the primer design for constructing the exogenous gene gltA knock-in donor fragment is as follows

[0260] uf-adhE::gltA- BL21 : AAAATCAAAAAAGGTCTGAATCACGGTT

[0261] ur-adhE::gltA- BL21 : GGCCTATAGTGAGTCGTATTAAATGCTCTCCTGATAATGTTAAACTT

[0262] mf-adhE::gltA- BL21 : TAATACGACTCACTATAGGCCATCT

[0263] mr-adhE::gltA- BL21 : CAAAAAACCCCTCAAGACCCGT

[0264] df-adhE::gltA- BL21 : AACGGGTCTTGAGGGGTTTTTTGTCAGTAGCGCTGTCTGGCAATATAAACG

[0265] df-adhE::gltA- BL21 : ATTAAAAACCATCTGTTTTTGTGG

[0266] 4.3 Blocking the glyoxylate cycle to increase the supply of the precursor cis-aconitic acid

[0267] Similarly, the construction and knockout steps of the gene aceA knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BL21(DE3) is used as a template to amplify the donor fragment for aceA gene knockout. Finally, the genotype of the E. coli mutant strain with correct knockout of the aceA gene is E. coli BL21-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA. Among them, the primer design for amplifying the donor fragment for aceA gene knockout is as follows:

[0268] uf-aceA- BL21 : GTGAACGCACCGAAGAAGG

[0269] ur-aceA- BL21 : ACAGTCAGCAACGGTTGTTGTTGCGTGCAGATGCTCCATAGTTATG

[0270] df-aceA- BL21: GCAACAACAACCGTTGCTGACTG

[0271] dr-aceA- BL21 : ACTTTGGCCGTTAGTAATGCAG

[0272] Example 5: Fermentation production of trans-aconitic acid based on plasmid

[0273] Using the engineered strain E.coli BL21(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 The process of fermenting and producing trans-aconitic acid by -ΔaceA(pEETDuet-adi1-tbrB) can refer to Example 3.1 of the present invention. Finally, the trans-aconitic acid yield of the engineered strain E.coli BL21(DE3) is 31.83 g / L, the yield is 0.56 g / g, and the production efficiency is 0.79 g / L / h.

[0274] Example 6: Using the wild-type E.coli Nissle 1917(DE3) as the starting strain to construct an engineered strain for producing trans-aconitic acid.

[0275] 6.1 Knock out genes related to by-products

[0276] Knock out the related synthetic genes frdA, ldhA, poxB, Δpta-ack, ΔpflB, ΔadhE of by-products in the starting strain E.coli Nissle 1917(DE3). The knockout steps of the related genes can refer to Example 1 of the present invention.

[0277] 6.1.1 Knockout of the fumarate reductase subunit A gene frdA

[0278] The construction and knockout steps of the fumarate reductase subunit A gene frdA knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; but use the genome of E.coli Nissle 1917(DE3) as the template to amplify the donor fragment for gene frdA knockout. Among them, the primer design for amplifying the donor fragment for gene frdA knockout is as follows:

[0279] uf-frdA- Nissle 1917 : CGATGAACTCTGGGTTCAGGCCAAACT

[0280] ur-frdA- Nissle 1917: ACAATCTGGAGGAATGTCGATGAAAAACCTGAAAATTGAG

[0281] df-frdA- Nissle 1917 : ATTTTCAGGTTTTTCATCGACATTCCTCCAGATTGTTTTTAT

[0282] dr-frdA- Nissle 1917 : CGTGTCTCAAACGGGACCAAATGAATAT

[0283] 6.1.2 Knockout of lactate dehydrogenase gene ldhA

[0284] The construction and knockout steps of the lactate dehydrogenase gene ldhA knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli Nissle 1917(DE3) was used as a template to amplify the donor fragment for the knockout of gene ldhA. Among them, the primer design for amplifying the donor fragment for the knockout of gene ldhA is as follows:

[0285] uf-ldhA- Nissle 1917 : TGTCTGTTTCGCGGTCGCCAGCGTTAA

[0286] ur-ldhA- Nissle 1917 : ATCACTGGAGAAAGTCTTTCTTGCCGCTCCCCTGCATTC

[0287] df-ldhA- Nissle 1917 : TGCAGGGGAGCGGCAAGAAAGACTTTCTCCAGTGATGTTG

[0288] dr-ldhA- Nissle 1917 : CAAGCAGAATCAAGTTCTACCGTGCCG

[0289] 6.1.3 Knockout of pyruvate oxidase gene poxB

[0290] The construction and knockout steps of the pyruvate oxidase gene poxB knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli Nissle 1917(DE3) was used as a template to amplify the donor fragment for the knockout of gene poxB. Among them, the primer design for amplifying the donor fragment for the knockout of gene poxB is as follows:

[0291] uf-poxB- Nissle 1917: AATTCCCATACCTCTTTTAAGTATTCACGC

[0292] ur-poxB- Nissle 1917 : TTCAGGAGATGGAGAACCAAAGGGTGGCATTTCCCGTCA

[0293] df-poxB- Nissle 1917 : CGGGAAATGCCACCCTTTGGTTCTCCATCTCCTGAATGTG

[0294] dr-poxB- Nissle 1917 : GTGGCCCTGCGCCATATATGGATTGGG

[0295] 6.1.4 Knockout of the phosphotransacetylase-acetate kinase encoding gene pta-ack

[0296] The construction and knockout steps of the phosphotransacetylase-acetate kinase encoding gene pta-ack knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli Nissle 1917(DE3) was used as a template to amplify the donor fragment for the knockout of the gene pta-ack. Among them, the primer design for amplifying the donor fragment for the knockout of the gene pta-ack is as follows:

[0297] uf-pta-ack Nissle 1917 : CGATCGGCGGCATAAAACGGATCGC

[0298] ur-pta-ack- Nissle 1917 : CTGCGGATGATGACGAGAGGAAGTACCTATAATTGATAC

[0299] df-pta-ack- Nissle 1917 : TCAATTATAGGTACTTCCTCTCGTCATCATCCGCAGCTTT

[0300] dr-pta-ack- Nissle 1917 : GATCCTGAGGTTAACCCTTCAAAC

[0301] 6.1.5 Knockout of the pyruvate formate-lyase gene pflB

[0302] The construction and knockout steps of the pyruvate formate-lyase gene pflB knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli Nissle 1917 (DE3) was used as a template to amplify the donor fragment for pflB gene knockout. Among them, the primers for amplifying the donor fragment for pflB gene knockout were designed as follows:

[0303] uf-pflB- Nissle 1917 : ACAGGTATGAATGCCTTCTTTTTTGC

[0304] ur-pflB- Nissle 1917 : TAAGAAGGTAGGTGTTACTTAGATTTGACTGAAATCGTACA

[0305] df-pflB- Nissle 1917 : GATTTCAGTCAAATCTAAGTAACACCTACCTTCTTAAGTGG

[0306] dr-pflB- Nissle 1917 : ATATGACCGCAAATGGTCAATGGGGA

[0307] 6.1.6 Knockout of alcohol dehydrogenase gene adhE

[0308] The construction and knockout steps of the alcohol dehydrogenase gene adhE knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli Nissle 1917 (DE3) was used as a template to amplify the donor fragment for adhE gene knockout. Among them, the primers for amplifying the donor fragment for adhE gene knockout were designed as follows:

[0309] uf-adhE- Nissle 1917 : GCACCAGTGCGGATGCGGCGT

[0310] ur-adhE- Nissle 1917 : CATTATCAGGAGAGCATTTCAGTAGCGCTGTCTGGCAAC

[0311] df-adhE- Nissle 1917 : GCCAGACAGCGCTACTGAAATGCTCTCCTGATAATGTTAAA

[0312] dr-adhE- Nissle 1917 : AAAATCAAAAAGGGTCTGAATCACGGTTAG

[0313] Finally, the genotype of the E. coli mutant strain with the relevant by-product genes correctly knocked out is E. coli Nissle 1917(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE.

[0314] 6.2 Enhancing the metabolic flux of the TCA cycle

[0315] Based on the pyruvate-accumulating strain E. coli Nissle 1917(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE, a metabolic engineering strategy of overexpressing pyruvate carboxylase and citrate synthase was adopted to enhance the metabolic flux at the TCA entry.

[0316] 6.2.1 Inserting the coding gene pyc of the pyruvate carboxylase mutant at the pflB locus of the by-product gene P458S

[0317] The gene pyc P458S For the construction of the knock-in vector and the knock-in procedure, refer to Example 1.2.1 of the present invention. Finally, the genotype of the E. coli mutant strain with the exogenous gene pyc correctly knocked in is E. coli Nissle 1917(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔadhE-ΔpflB::P P458S pyc T7 pyc P458S . Among them, the primer design for amplifying the gene pyc P458S knock-in donor fragment is as follows:

[0318] uf-pflB::pyc P458S -1917: GTTTCACACTCTGCTTTTCTGTG

[0319] ur-pflB::pyc P458S -1917: GATGGCCTATAGTGAGTCGTATTACTCGTACCTTCACTCAATCTATGTAATT

[0320] mf-pflB::pyc P458S -1917: TAATACGACTCACTATAGGCCATCT

[0321] mr-pflB::pyc P458S -1917: CAAAAAACCCCTCAAGACCCGT

[0322] df-pflB::pyc P458S-1917: AACGGGTCTTGAGGGGTTTTTTGGGCTAACTTTTCATTAAGCTCGGACATGdr-pflB::pyc P458S -1917: CCTGCTGCAATGGCCAAAGTGGCCG

[0323] 6.2.2 Insert the citrate synthase-encoding gene gltA at the by-product gene adhE locus

[0324] The construction of the gltA knock-in vector and the knock-in steps can refer to Example 1.2.2 of the present invention. Finally, the genotype of the Escherichia coli mutant strain with the exogenous gene gltA correctly knocked in is E.coli Nissle 1917(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB::P T7 pyc P458S -ΔadhE::P T7 gltA. Among them, the primer design for amplifying the gltA knock-in donor fragment is as follows:

[0325] uf-adhE::gltA- Nissle 1917 : GAGTGTTATCGCCGGTTTGTTCT

[0326] ur-adhE::gltA- Nissle 1917 : TGGCCTATAGTGAGTCGTATTATCAGTAGCGCTGTCTGGCAACATAAACG

[0327] mf-adhE::gltA- Nissle 1917 : TAATACGACTCACTATAGGCCATCT

[0328] mr-adhE::gltA- Nissle 1917 : CAAAAAACCCCTCAAGACCCGT

[0329] df-adhE::gltA- Nissle 1917 : AACGGGTCTTGAGGGGTTTTTTGAATGCTCTCCTGATAATGTTAAAC

[0330] df-adhE::gltA- Nissle 1917 : ACCAGGATGCCACCGGCGATACGG

[0331] 6.3 Block the glyoxylate cycle to increase the supply of the precursor cis-aconitic acid

[0332] The coding gene aceA of isocitrate lyase in the genome of E. coli Nissle 1917 (NZ_CP007799.1) has four copies, and sequence alignment shows that the sequences of these four copies of the aceA gene are exactly the same. In this example, the construction and knockout steps of the gene aceA knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic template of E. coli Nissle 1917 is used to amplify the donor fragment for aceA gene knockout. Finally, the genotype of the E. coli mutant strain with the gene aceA correctly knocked out is E. coli Nissle 1917-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA. Among them, the primer design for amplifying the donor fragment for aceA gene knockout is as follows:

[0333] uf-aceA1- Nissle 1917 : GATCGCTCACCCGGGCCTTGCTG

[0334] ur-aceA1- Nissle 1917 : TAGAACTGCGATTCTTCGGTGGAGCCTCAATTTGTTGTGTACGGGTTTTCAT

[0335] df-aceA1- Nissle 1917 : AAAACCCGTACACAACAAATTGAGGCTCCACCGAAGAATCGCAGTTCTA

[0336] dr-aceA1- Nissle 1917 : GCTGGGAGCTAAAGATAAAAAGCCGC

[0337] uf-aceA2- Nissle 1917 : GCGGCGTTTATTCCGAGCAAAG

[0338] ur-aceA2- Nissle 1917 : TAGAACTGCGATTCTTCGGTGGAGCCTCAATTTGTTGTGTACGGGTTTTCAT

[0339] df-aceA2- Nissle 1917 : TGAGGCTCCACCGAAGAATCGCAGTTCTAA

[0340] dr-aceA2- Nissle 1917: ATACGCAAAGGCCAGAAAAAAGC

[0341] uf-aceA3- Nissle 1917 : TGCTTTGGCCATTAGTAATGCAGCGCA

[0342] ur-aceA3- Nissle 1917 : TGAAAACCCGTACACAACAAATTGAAGCTCCACCGAAGAATCGCAGTTC

[0343] df-aceA3- Nissle 1917 : AGCTTCAATTTGTTGTGTACGGGTTTTCA

[0344] dr-aceA3- Nissle 1917 : CGATTACTGCCGATCAGCTGCTGG

[0345] uf-aceA4- Nissle 1917 : AAATCAACCGAGATTCCCCCAGTA

[0346] ur-aceA4- Nissle 1917 : TGAAAACCCGTACACAACAAATTGAAGCTCCACCGAAGAATCGCAGTTC

[0347] df-aceA4- Nissle 1917 : CTTCAATTTGTTGTGTACGGGTTTTCA

[0348] dr-aceA4- Nissle 1917 : ATAACGGTCACGATGGCACATGG

[0349] Example 7: Fermentation Production of Trans-Aconitic Acid Based on Plasmid

[0350] The process of fermenting and producing trans-aconitic acid using the engineered strain E. coli Nissle 1917(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB::P T7 pyc P458S -ΔadhE::P T7 gltA-ΔaceA(pEETDuet-adi1-tbrB) can refer to Example 3.1 of the present invention. Finally, the yield of trans-aconitic acid of the engineered strain E. coli Nissle 1917(DE3) is 33.62 g / L, the yield rate is 0.62 g / g, and the production efficiency is 0.84 g / L / h.

[0351] Example 8: Using wild-type E. coli BW25113(DE3) as the starting strain, an engineered strain for producing trans-aconitic acid was constructed.

[0352] 8.1 Knock out genes related to by-products

[0353] In the starting strain E. coli BW25113(DE3), knock out the related synthetic genes frdA, ldhA, poxB, Δpta-ack, ΔpflB, and ΔadhE of by-products. The knockout steps of the related genes can refer to Example 1 of the present invention.

[0354] 8.1.1 Knockout of fumarate reductase subunit A gene frdA

[0355] The construction and knockout steps of the fumarate reductase subunit A gene frdA knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, use the genome of E. coli BW25113(DE3) as the template to amplify the donor fragment for gene frdA knockout. Among them, the primer design for amplifying the donor fragment for gene frdA knockout is as follows:

[0356] uf-frdA- BW25113 : CGTGTCTCAAACGGGACCAAATG

[0357] ur-frdA- BW25113 : AGCGCACCACCTCAATTTTCAGGTTTTTCATCGACATTCCTCCAGATTGTTTTTAT

[0358] df-frdA- BW25113 : TAAAAACAATCTGGAGGAATGTCGATGAAAAACCTGAAAATTGAGGTGGTGCG

[0359] dr-frdA- BW25113 : CGATGAACTCTGGGTTCAGGC

[0360] 8.1.2 Knockout of lactate dehydrogenase gene ldhA

[0361] The construction and knockout steps of the lactate dehydrogenase gene ldhA knockout vector can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, use the genome of E. coli BW25113(DE3) as the template to amplify the donor fragment for gene ldhA knockout. Among them, the primer design for amplifying the donor fragment for gene ldhA knockout is as follows:

[0362] uf-ldhA- BW25113:TAGCGCCAGGTTTAAAAGCGTCGATGT

[0363] ur-ldhA- BW25113 :ATCACTGGAGAAAGTCTTTCTTGCCGCTCCCCTGCATTCCAG

[0364] df-ldhA- BW25113 :AATGCAGGGGAGCGGCAAGAAAGACTTTCTCCAGTGATGTTG

[0365] dr-ldhA- BW25113 :TCCACCAGTGACGGTTCCTGCGGC

[0366] 8.1.3 Knockout of pyruvate oxidase gene poxB

[0367] The construction of the knockout vector for pyruvate oxidase gene poxB and the knockout procedure can refer to the knockout procedure of gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BW 25113(DE3) was used as the template to amplify the donor fragment for poxB gene knockout. Among them, the primer design for amplifying the donor fragment for poxB gene knockout is as follows:

[0368] uf-poxB- BW25113 :GCGGCCCGGCTCCGTATATGG

[0369] ur-poxB- BW25113 :CCTTATTATGACGGGAAATGCCACCCTTTGGTTCTCCATCTCCTGAATGTG

[0370] df-poxB- BW25113 :ATCACATTCAGGAGATGGAGAACCAAAGGGTGGCATTTCCCGTCATAATAAGG

[0371] dr-poxB- BW25113 :AATTCCCATGCTTCTTTCAGGT

[0372] 8.1.4 Knockout of phosphotransacetylase-acetate kinase encoding genes pta-ack

[0373] The construction and knockout steps of the phosphotransacetylase - acetate kinase - encoding gene pta-ack knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BW25113(DE3) is used as a template to amplify the donor fragment for pta-ack gene knockout. Among them, the primer design for amplifying the donor fragment for pta-ack gene knockout is as follows:

[0374] uf-pta-ack- BW25113 : ATCCGTAACCACGCTCAATAATTGTTTGCAGG

[0375] ur-pta-ack- BW25113 : AGCGCAAAGCTGCGGATGATGACGAGAGGAAGTACCTATAATTGATACGTGG

[0376] df-pta-ack- BW25113 : GCCACGTATCAATTATAGGTACTTCCTCTCGTCATCATCCGCAGCTTTGCGCT

[0377] dr-pta-ack- BW25113 : GAAAGAAGCGGTCGGACTCATGCAC

[0378] 8.1.5 Knockout of the pyruvate formate lyase gene pflB

[0379] The construction and knockout steps of the pyruvate formate lyase gene pflB knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli BW25113(DE3) is used as a template to amplify the donor fragment for pflB gene knockout. Among them, the primer design for amplifying the donor fragment for pflB gene knockout is as follows:

[0380] uf-pflB- BW25113 : ATATGACCGCAAATGGTCAATG

[0381] ur-pflB- BW25113 : ACTGTACGATTTCAGTCAAATCTAAGTAACACCTACCTTCTTAAGTG

[0382] df-pflB- BW25113 : TCCACTTAAGAAGGTAGGTGTTACTTAGATTTGACTGAAATCGTACAGT

[0383] dr-pflB-BW25113 : ACAGGTATGAATGCCTTCTTTTTTGC

[0384] 8.1.6 Knockout of alcohol dehydrogenase gene adhE

[0385] The construction and knockout steps of the alcohol dehydrogenase gene adhE knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the genomic DNA of E. coli 25113(DE3) was used as a template to amplify the donor fragment for the knockout of the gene adhE. Among them, the primer design for amplifying the donor fragment for the knockout of the gene adhE is as follows:

[0386] uf-adhE- BW25113 : GCTGTCGGTTTATGGAAAAGTTGCT

[0387] ur-adhE- BW25113 : TTTAACATTATCAGGAGAGCATTTCAGTAGCGCTGTCTGGCAAC

[0388] df-adhE- BW25113 : GTTGCCAGACAGCGCTACTGAAATGCTCTCCTGATAATGTTAAAC

[0389] dr-adhE- BW25113 : AACAATCCCCAACAACATAAAGCGAAC

[0390] Finally, the genotype of the E. coli mutant strain with the correct knockout of the related by-product genes is E. coli BW25113(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE.

[0391] 8.2 Enhancement of the metabolic flux of the TCA cycle

[0392] Based on the pyruvate-accumulating strain E. coli BW25113(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE, a metabolic engineering strategy of overexpressing pyruvate carboxylase and citrate synthase was adopted to enhance the metabolic flux at the entry of the TCA cycle.

[0393] 8.2.1 Insertion of the coding gene pyc of the pyruvate carboxylase mutant at the pseudogene ycgh locus P458S

[0394] Gene pyc P458SThe construction of the knock-in vector and the knock-in steps can refer to Example 1.2.1 of the present invention. Finally, the genotype of the Escherichia coli mutant strain with the exogenous gene pyc correctly knocked in is E.coli BW25113(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-ΔadhE-Δycgh::P P458S pyc T7 P458S Among them, the primers for amplifying the gene pyc and designing the knock-in donor fragment are as follows: P458S

[0395] uf-ycgh::pyc P458S - BW25113 : CAGTACCGGGCTGGGAGAAGTGC

[0396] ur-ycgh::pyc P458S - BW25113 : ACTAAGATGGCCTATAGTGAGTCGTATTAAGATTAACCATCCATTCATT

[0397] mf-ycgh::pyc P458S - BW25113 : ACTAAGATGGCCTATAGTGAGTCGTATTAAGATTAACCATCCATTCAT

[0398] mr-ycgh::pyc P458S - BW25113 : CAAAAAACCCCTCAAGACCCGT

[0399] df-ycgh::pyc P458S - BW25113 : GGGTCTTGAGGGGTTTTTTGTCCCGCCGTTAGCTAAAAAACCGCGTC

[0400] dr-ycgh::pyc P458S - BW25113 : AGTGGGTGCCGCCGTTGGTGC

[0401] 8.2.2 Insert the citrate synthase encoding gene gltA at the by-product gene adhE locus

[0402] The construction and insertion steps of the gene gltA knock-in vector can refer to Example 1.2.2 of the present invention. Finally, the genotype of the Escherichia coli mutant strain with the exogenous gene gltA correctly knocked in is E.coli BW25113(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 gltA. Among them, the primer design for amplifying the gene gltA knock-in donor fragment is as follows

[0403] uf-adhE::gltA- BW25113 : GGTGTCCTGAACTGTGCGCCATC

[0404] ur-adhE::gltA- BW25113 : TTGCCAGACAGCGCTACTGATAATACGACTCACTATAGGCCATCT

[0405] mf-adhE::gltA- BW25113 : TAATACGACTCACTATAGGCCATCT

[0406] mr-adhE::gltA- BW25113 : CAAAAAACCCCTCAAGACCCGT

[0407] df-adhE::gltA- BW25113 : CTCTAAACGGGTCTTGAGGGGTTTTTTGAATGCTCTCCTGATAATGTTAAA

[0408] df-adhE::gltA- BW25113 : GTTTCGCGCTGCCGCTGTCTGATAACT

[0409] 8.3 Blocking the glyoxylate cycle to increase the supply of the precursor cis-aconitic acid

[0410] The construction and knockout steps of the gene aceA knockout vector can refer to the knockout procedure of the gene frdA in Example 1.1.1 of the present invention; however, the donor fragment for amplifying the gene aceA knockout is amplified using the genome of E.coli BW25113(DE3) as the template. Finally, the genotype of the Escherichia coli mutant strain with the gene aceA correctly knocked out is E.coli BL21-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S-ΔadhE::P T7 gltA-ΔaceA. Among them, the primer design for amplifying the gene aceA knockout donor fragment is as follows:

[0411] uf-aceA- BW25113 : GGTATTCAACGACATTCTCGGCTCCCGTAAA

[0412] ur-aceA- BW25113 : ACATAACTATGGAGCATCTGCCAACAACAACCGTTGCTGACTGTAGGC

[0413] df-aceA- BW25113 : ACATAACTATGGAGCATCTGCCAACAACAACCGTTGCTGACTGTAGGC

[0414] dr-aceA- BW25113 : GAGTTAAAAAAGCTCTCCGCAATCTC

[0415] Example 9: Fermentation production of trans-aconitic acid based on plasmid

[0416] Using the engineered strain E. coli BW25113(DE3)-ΔfrdA-ΔldhA-ΔpoxB-Δpta-ack-ΔpflB-Δycgh::P T7 pyc P458S -ΔadhE::P T7 The process of fermenting and producing trans-aconitic acid by gltA-ΔaceA(pEETDuet-adi1-tbrB) can refer to Example 3.1 of the present invention. Finally, the yield of trans-aconitic acid of the engineered strain E. coli BW25113(DE3) is 21.76 g / L, the yield rate is 0.37 g / g, and the production efficiency is 0.54 g / L / h.

[0417] The gene sequences involved in the present invention:

[0418] SEQ ID NO.1

[0419] Sequence characteristics

[0420] Length: 1332 bp

[0421] Source: Ustilago maydis

[0422] The nucleic acid sequence information of the aconitate isomerase-encoding gene adi1 after codon optimization

[0423]

[0424] SEQ ID NO.2

[0425] Sequence feature

[0426] Length: 912bp

[0427] Source: Bacillus thuringiensis

[0428] Nucleotide sequence information of the codon-optimized trans-aconitate efflux protein-encoding gene tbrB

[0429] ATGGATAACCTGAAAAAGGCCACCTTTTTCATGGTTCTGAGTGGTATTAGCTTTAGTCTGAGCGGTTTCTTTGCAGAACATGCCATTATTAGCGGTGACTTTTTCGTGACCCTGACCGCACGTTTCTTTATTCCGTTTCTGTTTCTGGTTCCGTTTATTATTAAGCGTATGGGCAAAATTAGCTTTTGGAGCAATAGCTATAAGCAGCTGCCGCGCGCCTTTAGTATTACCTTTAGCCAGGCACTGTTTTTCCTGTGTGCCGCCAAAACCAGCCTGTTTATTGCAATGGTGCTGTATAATACCGGCCCGATTTTTATTTGTCTGATTACCCTGTTTAGCAAAACCCGCCGTGCCACCCGTGCCGAAATTCTGGCCGCCTTTGTTGGTTTCTTTGGCGTGTTTCTGGTTCTGAAAACCGGCGGTATTGATTATGAAAGTTTTCTGTATCTGGGTGTGGGTCTGCTGAGCGGCCTGAGTCTGGCCTTTAGTCAGTTTTTCCTGCATCGCAGTGCCCAGACCGATGATAATCTGAGCATTATGGCCTATACCTATCTGTATGGTACAATTATTAGCGGCGTGCTGAGTGCCTGTTTTAGCAAAGGTAATTATATTGGCGTTTTCACCAATAGTACCATGGTTCTGGTTTTTCTGTTTTTAATGGCAATGGGCAGCCTGGGTAATCAGTGGTTTCGCGGCCGCGCATATAAACTGACCACCCGTATTAGCAATCTGAGTGCACTGCTGTATCTGAATATTCTGTTTAGTCTGCTGCTGGATATTCTGTTTAATAATAGCATTCCGAGTGTTATTCAGATTACCGGTGCCATTTTTGTGATGGGTAGCGCCGCAATTCCGATTATTGTGCGCGTTAATAAGCAGCAGACCGAACAGCGCCGCGCCGCAAGCAGCTAA

[0430] Matters not covered by the present invention are well-known technologies.

[0431] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An Escherichia coli engineered strain with high production of trans-aconitic acid, characterized in that, The engineered Escherichia coli strain is obtained by using wild-type Escherichia coli as the starting strain and performing a series of metabolic engineering modifications on the starting strain and introducing the synthesis pathway of trans-aconitic acid; Among them, the series of metabolic engineering modifications on the starting strain include any one or more of the following methods: (1) Inhibiting the generation pathway of by-products in the glucose metabolism pathway to redirect the carbon flux to pyruvate; (2) Strengthening the metabolic flux at the entrance of the TCA cycle; (3) Blocking the downstream metabolism of isocitrate.

2. The engineered Escherichia coli strain with high production of trans-aconitic acid as claimed in claim 1, characterized in that, The starting strain is any one selected from Escherichia coli W3110(DE3), Escherichia coli BL21(DE3), Escherichia coli Nissle 1917(DE3), and Escherichia coli BW25113(DE3).

3. The engineered Escherichia coli strain with high production of trans-aconitic acid as claimed in claim 1, characterized in that, In the method (1), the inhibition of the generation pathway of by-products in the glucose metabolism pathway to redirect the carbon flux to pyruvate specifically includes inhibiting the synthesis of succinic acid, lactic acid, acetic acid, formic acid, and ethanol; further, knocking out one or more of the following coding genes in the starting strain: fumarate reductase subunit A gene frdA, lactate dehydrogenase gene ldhA, pyruvate oxidase gene poxB, phosphotransacetylase-acetate kinase coding gene pta-ack, pyruvate formate lyase gene pflB, and alcohol dehydrogenase gene adhE.

4. The engineered Escherichia coli strain with high production of trans-aconitic acid as described in claim 1, characterized in that, In the method (2), the method for strengthening the metabolic flux at the entrance of the TCA cycle includes any one or two of the following: (2-1) Overexpressing pyruvate carboxylase; (2-2) Overexpressing citrate synthase; Among them, the pyruvate carboxylase is specifically a pyruvate carboxylase mutant Pyc P485S , which is derived from Corynebacterium glutamicum ATCC 13032. By introducing the pyruvate carboxylase mutant encoding gene pyc P485S , overexpression of pyruvate carboxylase is achieved. The citrate synthase is specifically citrate synthase GltA, which is derived from Corynebacterium glutamicum ATCC 13032; overexpression of citrate synthase is achieved by introducing the citrate synthase coding gene gltA.

5. The Escherichia coli engineering strain with high yield of trans-aconitic acid according to claim 1, characterized in that, In the method (3), blocking the downstream metabolism of isocitrate is blocking the glyoxylate cycle pathway, and the specific method includes knocking out the isocitrate lyase coding gene aceA in the starting strain.

6. The engineered Escherichia coli strain with high production of trans-aconitic acid as described in claim 1, characterized in that, The method for introducing the synthesis pathway of trans-aconitic acid includes expressing aconitate isomerase Adi1 and trans-aconitic acid efflux protein TbrB in the starting strain; it is achieved by introducing the coding gene adi1 of aconitate isomerase and the coding gene tbrB of trans-aconitic acid efflux protein, wherein the nucleotide sequence of the coding gene adi1 of aconitate isomerase after codon optimization is as shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene tbrB of trans-aconitic acid efflux protein after codon optimization is as shown in SEQ ID NO.

2. Furthermore, the coding gene adi1 of aconitate isomerase and the coding gene tbrB of trans-aconitic acid efflux protein are transferred into the production strain through an expression vector, and the expression vector is a plasmid vector, specifically pETDuet, and the obtained recombinant expression vector is specifically pETDuet-adi1-tbrB; Furthermore, the encoding gene adi1 of aconitate isomerase and the encoding gene tbrB of trans-aconitate efflux protein are integrated into different gene loci in the genome of the starting strain, so as to achieve multi-copy expression; furthermore, the different gene loci at least include lacZ, yjhR, ynck and yfdf.

7. Method for constructing an Escherichia coli engineering strain with high production of trans-aconitic acid according to any one of claims 1-6, characterized in that, The construction method includes: Using wild-type Escherichia coli as the starting strain, performing a series of metabolic engineering transformations on the starting strain and introducing the synthesis pathway of trans-aconitate to obtain the engineered Escherichia coli strain with high-yield trans-aconitate; Among them, the wild-type Escherichia coli can be any one of Escherichia coli W3110(DE3), Escherichia coli BL21(DE3), Escherichia coli Nissle 1917(DE3), Escherichia coli BW25113(DE3), and among them, Escherichia coli W3110(DE3) is preferred.

8. An industrial production method of trans-aconitic acid, characterized in that, The industrial production method includes: fermenting and culturing the engineered Escherichia coli strain according to any one of claims 1-6, and separating and obtaining the trans-aconitate.

9. The industrial production method according to claim 8, wherein The specific conditions of the fermentation culture are: the temperature is controlled at 25-35 °C (preferably 30 °C), the stirring speed is controlled at 100-800 rpm (preferably 400 rpm), the ventilation volume is 0.5-5 vvm (preferably 1.5 vvm), and the pH is weakly acidic (pH 6.0).

10. Use of the engineered Escherichia coli strain according to any one of claims 1-6 or the industrial production method according to any one of claims 8-9 in the fields of agriculture, food, chemical industry and pharmaceutical industry.

Images