Method for synthesizing phenyllactic acid through whole-cell catalysis of recombinant escherichia coli

Abstract

The invention discloses a method for synthesizing phenyllactic acid through whole-cell catalysis of recombinant escherichia coli, and belongs to the field of bioengineering. The invention provides an effective recombinant escherichia coli whole-cell biocatalyst. A substrate phenylalanine is converted into a product phenyllactic acid through a two-step reaction. The method comprises the following steps: firstly, screening lactic dehydrogenase from lactobacillus hirsuti, and obtaining a mutant which is improved by 2.76 times; the lactic dehydrogenase or the mutant of the lactic dehydrogenase is introduced into escherichia coli, a novel inducible expression system which can be jointly induced by lactose and arabinose and can reduce accumulation of intermediate products is constructed and can be used for preparing phenyllactic acid by taking phenylalanine as a substrate, finally, the yield of the phenyllactic acid reaches 43.82 g / L, and the molar conversion rate is 87%. The method is used for producing phenyllactic acid from cheap phenylalanine, the operation process is convenient and fast, a certain amount of phenyllactic acid can be synthesized within a short production time, and theoretical and practical foundations are laid for industrial production of phenyllactic acid.

Description

Technical Field

[0001] The present invention relates to a method for synthesizing phenyl lactic acid by using recombinant Escherichia coli whole cells, belonging to the technical fields of enzyme engineering and genetic engineering. Background Art

[0002] The food safety industry has attracted increasing attention, and natural biopreservatives with stable and broad-spectrum antibacterial activities are receiving significant attention. Phenyl lactic acid (PLA) is an antibacterial agent inherently produced by many lactic acid bacteria (LAB) and also including non-LAB during the fermentation process. Due to its low side effects and toxicity, it has significant advantages compared with synthetic preservatives such as potassium sorbate and sodium benzoate. Compared with chemical synthesis, biosynthesis is still the preferred route for producing PLA. Chemical synthesis has common drawbacks such as high energy consumption and environmental pollution. However, the biosynthesis of phenyl lactic acid often faces problems such as low yield and accumulation of intermediate products.

[0003] PLA can not only be produced by LAB strains or non-LAB strains, but also by enzymatic conversion using whole cell biocatalysts. Recombinant Escherichia coli heterologously expressing lactate dehydrogenase (LDH) or phenylpyruvate reductase (PPR) from lactic acid bacteria has been widely studied and used as a whole cell biocatalyst with phenylpyruvic acid (PPA) as the substrate. Compared with the fermentation method, the produced PLA has relatively higher yield and titer. For the industrial production of PLA, L-phenylalanine (L-PHE) is a better choice than PPA and is an ideal starting substrate for synthesizing phenyl lactic acid. To effectively convert L-PHE into PPA, L-amino acid deaminase (LAAD) from Proteus mirabilis is a suitable candidate because of its high catalytic efficiency and no cytotoxic by-products such as hydrogen peroxide are produced.

[0004] A major limiting factor in the phenyl lactic acid biosynthesis pathway is the low efficiency of the hydrogenation reduction reaction of phenylpyruvic acid. This reaction is generally catalyzed by lactate dehydrogenase, which is an NADH-dependent enzyme and requires NADH as a cofactor to participate in the reduction reaction. Phenylpyruvic acid is not a natural substrate of lactate dehydrogenase. Since the former contains a relatively large phenyl ring in terms of steric volume, there is often a large hindrance at the substrate binding site of lactate dehydrogenase, reducing the binding force between the two. Moreover, the intracellular content of NADH is another limiting factor for the reduction reaction of phenylpyruvic acid by lactate dehydrogenase, and the exogenous addition of NADH is not a cost-friendly method. Therefore, it is considered to construct an intracellular recycling and regeneration system of NADH and introduce formate dehydrogenase to regenerate NADH.

[0005] In the two-step reaction of phenyl lactic acid synthesis, due to the mismatch of reaction fluxes, a large amount of intermediate phenylpyruvic acid accumulates, reducing the conversion rate of phenyl lactic acid and causing difficulties in subsequent separation and extraction.

[0006] Therefore, constructing a recombinant Escherichia coli biocatalytic system with the above characteristics, enabling it to use inexpensive phenylalanine as a substrate with high efficiency and conversion rate to convert and prepare phenyl lactic acid, is of great significance. SUMMARY OF THE INVENTION

[0007] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides a recombinant Escherichia coli strain capable of efficiently converting the substrate phenylalanine to prepare phenyl lactic acid, which can provide theoretical and practical guidance for the industrial production of phenyl lactic acid, enabling the catalytic reaction to have characteristics such as high production intensity, high conversion rate, and less accumulation of intermediate products, and also providing reference significance for the biological preparation of other compounds.

[0008] The first technical solution provided by the present invention is a lactate dehydrogenase mutant, wherein the mutant is obtained by mutating the 79th threonine T of the lactate dehydrogenase parent with the amino acid sequence shown in SEQ ID NO.2 to glycine G and mutating the 223rd isoleucine I to alanine A.

[0009] The second technical solution provided by the present invention is a gene encoding the mutant of the first technical solution.

[0010] The third technical solution provided by the present invention is a recombinant vector carrying the gene of the second technical solution.

[0011] In some embodiments, the recombinant vector uses a pET series plasmid as the expression vector.

[0012] In some embodiments, pET-28a is used as the expression vector.

[0013] The fourth technical solution provided by the present invention is a recombinant cell expressing the mutant of the first technical solution, or containing the gene of the second technical solution, or transformed with the recombinant vector of the third technical solution.

[0014] In some embodiments, bacteria or fungi are used as the expression host.

[0015] In some embodiments, the recombinant cell uses Escherichia coli as the host.

[0016] The fifth technical solution provided by the present invention is a recombinant Escherichia coli, using Escherichia coli as the host, overexpressing L-amino acid deaminase derived from Proteus mirabilis, lactate dehydrogenase derived from Lactobacillus hilgardii or the mutant of the first technical solution, and overexpressing formate dehydrogenase derived from Candida boidinii.

[0017] In some embodiments, the Escherichia coli is E. coli BL21(DE3).

[0018] In some embodiments, the amino acid sequence of the L - amino acid deaminase is as shown in SEQ ID NO.1.

[0019] In some embodiments, the amino acid sequences of the lactate dehydrogenase and the mutant are as shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0020] In some embodiments, the amino acid sequence of the formate dehydrogenase is as shown in SEQ ID NO.4.

[0021] In some embodiments, the gene encoding the L - amino acid deaminase is as shown in SEQ ID NO.7.

[0022] In some embodiments, the genes encoding the lactate dehydrogenase and the mutant are as shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0023] In some embodiments, the gene encoding the formate dehydrogenase is as shown in SEQ ID NO.10.

[0024] In some embodiments, the Escherichia coli uses pET series plasmids as expression vectors to co - express L - amino acid deaminase, lactate dehydrogenase or the mutant described in the first technical solution, and formate dehydrogenase.

[0025] In some embodiments, the L - amino acid deaminase is driven by a combined gene fragment with a nucleotide sequence as shown in SEQ ID NO.5. The combined gene fragment includes the promoter of the arabinose operon and the coding gene of its regulatory protein; the genes of lactate dehydrogenase or the mutant and formate dehydrogenase are driven by the original T7 promoter of pET.

[0026] In some embodiments, the whole plasmid sequence of the recombinant vector containing the L - amino acid deaminase, lactate dehydrogenase mutant, formate dehydrogenase and the combined gene fragment is as shown in SEQ ID NO.6.

[0027] The sixth technical solution provided by the present invention is a method for biosynthesizing phenyl lactic acid. The method is to use the recombinant Escherichia coli described in the fifth technical solution as a catalyst and add it to a reaction system with phenylalanine as a substrate, and react to prepare phenyl lactic acid.

[0028] In some embodiments, the reaction system further contains co - substrates glucose and ammonium formate.

[0029] In some embodiments, the addition amount of the co-substrate ammonium formate is 0.02 - 0.5 M.

[0030] In some embodiments, the addition amount of the substrate phenylalanine is 20 - 60 g / L.

[0031] In some embodiments, the recombinant Escherichia coli is added according to the cell mass (dry weight) of 10 - 30 g / L.

[0032] In some embodiments, the catalyst is the bacterial liquid obtained by growing and culturing the recombinant Escherichia coli strain on a growth medium after induction with lactose and arabinose, and the bacterial cells obtained by centrifugation.

[0033] In some embodiments, the addition amounts of the inducers lactose and arabinose are 0 - 20 mM and 0 - 200 mM respectively.

[0034] In some embodiments, the addition amounts of the inducers lactose and arabinose are 5 mM and 50 mM respectively.

[0035] In some embodiments, the reaction temperature is 25 - 45 °C and the initial pH is 6.0 - 8.0.

[0036] In some embodiments, the cell dry weight of the recombinant Escherichia coli is 30 g / L, the reaction temperature is 35 °C, the pH is 7.0, the addition amount of ammonium formate is 0.02 mM, the addition amount of glucose is 50 g / L, and the addition amount of phenylalanine is 60 g / L.

[0037] The seventh technical solution provided by the present invention is the application of the mutant described in the first technical solution, or the gene described in the second technical solution, or the recombinant vector described in the third technical solution, or the recombinant cell described in the fourth technical solution, or the recombinant Escherichia coli described in the fifth technical solution, or the method described in the sixth technical solution in the preparation of phenyl lactic acid or products containing phenyl lactic acid.

[0038] Beneficial effects

[0039] (1) The present invention first introduced the lactate dehydrogenase or its mutant from Lactobacillus hilgardii into Escherichia coli, and constructed a novel inducible expression system that can be co-induced by lactose and arabinose and can reduce the accumulation of intermediate products, which can be used to prepare phenyl lactic acid with phenylalanine as the substrate. Using the technical solution of the present invention, compared with overexpressing the wild-type lactate dehydrogenase and the original strain without introducing the arabinose promoter and its regulatory protein, the yield increased by 1.97 times, and the final yield of phenyl lactic acid reached 43.82 g / L, and the molar conversion rate was 87%.

[0040] (2) In the present invention, a better source of lactate dehydrogenase was screened and subjected to protein engineering modification for the reduction of phenylpyruvic acid to prepare phenyllactic acid. The enzyme activity of the modified lactate dehydrogenase was increased by 2.76 times compared with the wild type. The research ideas, methods and related research results of the recombinant Escherichia coli whole-cell catalyst constructed in this study laid a theoretical and practical foundation for the biological preparation, industrial production and application of other chemicals including phenyllactic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the pathway for synthesizing phenyllactic acid from phenylalanine.

[0042] Figure 2 Expression of PmLAAD, LhLDH, and CbFDH in E. coli BL21(DE3).

[0043] Figure 3 Phenyllactic acid production of strains M1, M2, and N1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0044] With reference to the attached Figures 1 to 3 , the preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0045] Test method:

[0046] One unit of enzyme activity of lactate dehydrogenase is defined as the amount of enzyme required to convert 1 μmol of substrate to product per minute. The method for determining the activity of lactate dehydrogenase is as follows: The reaction medium is 20 mM sodium phosphate buffer, pH 7.0, containing 2 mM phenylpyruvic acid, 0.1 mM NADH. After incubation at 30 °C for 2 min, an appropriate amount of crude enzyme solution is added, and the mixture is quickly mixed. The change in absorbance at 340 nm is detected in real time. For the determination of the enzyme activity of LhLDH, the enzymatic reaction is carried out at 30 °C. The reaction system includes 10 μL of NADH (10 mM), 10 μL of phenylpyruvic acid (20 mM), 10 μL of LhLDH, and 170 μL of PB solution (pH 7.0, 100 mM). One unit of enzyme activity of LhLDH is defined as the amount of enzyme required to catalyze the oxidation of 1 μmol of NADH per minute under the above reaction conditions. The concentration range of phenylpyruvic acid (PPA) is set to be 1.0 to 10 mM, and the concentration of NADH is fixed at 2 mM for the determination of kinetic parameters, and nonlinear regression analysis is performed using Origin 9.0 software for calculation.

[0047] Detection method for the contents of phenyl lactic acid, phenyl pyruvic acid and phenylalanine: HPLC analysis: Determined by reversed-phase high performance liquid chromatography using a C18 column; Needle washing: 10% methanol; After needle washing, automatic injection is carried out. Column temperature: 30 °C, injection volume: 10.0 μL, flow rate: 1.0 mL / min, mobile phase: Phase A is a 0.1% (v / v) trifluoroacetic acid - methanol solution, Phase B is a 0.1% (v / v) trifluoroacetic acid aqueous solution, and elution is carried out at a constant ratio of Phase A: Phase B = 40:60 for 20 min. Detection wavelength of the ultraviolet detector: 210 nm.

[0048] The PCR amplification program involved in the following examples is: pre-denaturation at 95 °C for 10 min, denaturation at 95 °C for 10 min, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, final extension at 10 min, and storage at 4 °C.

[0049] Raw materials used in the examples:

[0050] Escherichia coli E. coli BL21(DE3) involved in the following examples was purchased from Beina Biotechnology, and the pET-28a(+) plasmid was purchased from Novagen. DNA polymerase was purchased from TaKaRa; The small-scale plasmid extraction kit, homologous recombination kit and gel extraction kit were purchased from Nanjing Novizan Biotech Co., Ltd.; L-phenylalanine was purchased from Sinopharm Group, and phenyl pyruvic acid and phenyl lactic acid were purchased from Yuanye Group; Yeast extract and tryptone were purchased from Oxoid, UK; All experimental reagents are of analytical grade if not otherwise specified.

[0051] The media and required solutions involved in the following examples are as follows:

[0052] LB liquid medium: Peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0053] LB solid medium: Peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 2% (m / v).

[0054] TB medium: Peptone 12 g / L, yeast extract 24 g / L, glycerol 4 g / L, KH2PO4 2.31 g / L, K2HPO4 12.54 g / L.

[0055] Example 1: Construction of the L-amino acid deaminase expression vector

[0056] The specific steps are as follows:

[0057] Using the genome of Proteus mirabillis as a template, the L-amino acid deaminase gene Pmlaad shown in SEQ ID NO.8 was amplified, and it was ligated with the linear vector obtained by inverse PCR of the pET-28a(+) expression plasmid to obtain the recombinant plasmid pET28a-Pmlaad.

[0058] The primer sequences used for constructing the expression vector are as follows:

[0059] The upstream primer for amplifying L-amino acid deaminase:

[0060] ATGAACATCAGCCGCCGTAAAT;

[0061] The downstream primer for amplifying L-amino acid deaminase:

[0062] TTATTTTTTGAAGCGATCCAGGGAGAACG;

[0063] The upstream primer for inverse amplification of pET-28a:

[0064] TCGCTTCAAAAAATAACACTCGAGCACCACCACCA;

[0065] The downstream primer for inverse amplification of pET-28a:

[0066] GGCGGCTGATGTTCATGAATTCGGATCCGCGACCC;

[0067] Example 2: Construction of expression vectors for lactate dehydrogenase and its mutants

[0068] The specific steps are as follows:

[0069] Using the genome of Lactobacillus hilgardii as a template, the lactate dehydrogenase gene Lhldh shown in SEQ ID NO.9 was amplified, and it was ligated with the vector obtained by linearizing the pET-28a expression plasmid through inverse PCR to obtain the recombinant plasmid pET28a-Lhldh. Using pET-28a-Lhldh as a template, its mutant expression vector pET-28a-Lhldh was obtained after two rounds of inverse amplification with primers carrying the mutated sequences. T79G / I223A , and the gene sequence of the mutant is as shown in SEQ ID NO.9.

[0070] The primer sequences used for constructing the pET-28a-Lhldh T79G / I223A expression vector are as follows:

[0071] The upstream primer for amplifying lactate dehydrogenase:

[0072] ATGGCTTTAGAACGTCAAAAAGTTGCG;

[0073] Downstream primer for amplifying lactate dehydrogenase:

[0074] TTAAAGTTGATCCATACCATCTTTAGTTGTCTTTTGG。

[0075] Upstream primer for reverse amplifying pET-28a:

[0076] TATGGATCAACTTTAAAAGCTTGCGGCCGCAC(SEQ ID NO.17);

[0077] Downstream primer for reverse amplifying pET-28a:

[0078] GACGTTCTAAAGCCATGAATTCGGATCCGCGACCC;

[0079] First-round upstream primer for reverse amplifying pET-28-Lhldh:

[0080] CTGTCATGATGCTGACTTGGCTATTATTGGTGCAGGTGCACCTCAAAAGC;

[0081] First-round downstream primer:

[0082] ACCAATAATAGCCAAGTCAGCATCATGACAG;

[0083] Second-round upstream primer for reverse amplifying pET-28a-Lhldh:

[0084] GAAGATCAAGTACGTCATAAAGCATACGAAGCGATTAACAGAAAAGGGGCAACTTT TTATGGA;

[0085] Second-round downstream primer:

[0086] TTAATCGCTTCGTATGCTTTATGACGTACTTGATCTTC。

[0087] According to the enzyme activity assay method of lactate dehydrogenase in the test method, the results are shown in Table 1. Using phenylpyruvic acid as the substrate, the activity of wild-type lactate dehydrogenase was measured to be 83.40 U / mg, and the activity of mutant T79G / I223A was 230.35 U / mg. It was increased by 2.76 times compared with the wild type. And the K of the mutant mIt is 2.8 times higher than the wild type, and the catalytic activity is 3.3 times higher.

[0088] Table 1 LhLDH T79G / I223A Kinetic parameter values for the substrate phenylpyruvic acid

[0089]

[0090] Example 3: pET-28a-P t7 -Pmlaad-P t7 -Lhldh–Cbfdh, pET-28a-Pt7-Pmlaad-P t7 -Lhldh T79G / I223A Construction of -Cbfdh recombinant plasmid

[0091] The specific steps are as follows:

[0092] Using the pET-28a-Lhldh and pET-28a-Lhldh constructed in Example 2 T79G / I223A as templates to amplify the DNA coding sequences of Lhldh and Lhldh T79G / I223A For amplifying the gene of Cbfdh, fusion PCR was used to obtain the fragment Lhldh-CbfdhLhldh T79G / I223A -Cbfdh was ligated with the linearized vector obtained by reverse amplification of pET-28a-Pmlaad with primers to obtain pET-28a-P t7 -Pmlaad-P t7 -Lhldh-Cbfdh and pET-28a-P t7 -Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh.

[0093] The primers required for constructing the recombinant plasmid are as follows:

[0094] Upstream primer for amplifying the DNA sequence shown in SEQ ID NO.5:

[0095] CAGCGCAATAGTTGGCGAAG (SEQ ID NO.23);

[0096] Downstream primer for amplifying the DNA sequence shown in SEQ ID NO.6:

[0097] TATCATCAACGGGGTCTGGTGCC (SEQ ID NO.24);

[0098] Upstream primer used for reverse amplification of pET-28a-Pmlaad:

[0099] CGCCAACTATTGCGCTGGCATAAGGGAGAGCGTCGAGA;

[0100] Reverse amplification of the downstream primer used for pET-28a-Pmlaad:

[0101] AGACCCCGTTGATGATACATCATCATCATCATCACAGCAGCG;

[0102] Amplification of Lhldh T79G / I223A The upstream primer used for the DNA coding sequence (fusing the downstream primer used for Lhldh T79G / I223A -Cbfdh):

[0103] ATCGTAGCTAGCTAGCGTACGAGATCTCGATCCCGCGAAAT;

[0104] Amplification of Lhldh T79G / I223A The downstream primer used for the DNA coding sequence:

[0105] CTAAAACGATCTTCATTTAAAGTTGATCCATACCATCTTTAGTTGTCTTTTGG;

[0106] The upstream primer used for reverse amplification of pET-28a Pmlaad:

[0107] GCACGATAAGAAATAAGGTAAAGAAACCGCTGCTGCG;

[0108] The downstream primer GTACGCTAGCTAGCTACGATCTCAGCTTCCTTTCGGGCTTT used for reverse amplification of pET-28a-Pmlaad

[0109] The upstream primer for amplifying the Cbfdh gene:

[0110] ATGAAGATCGTTTTAGTCTTATACGATTGTGG;

[0111] The downstream primer for amplifying the Cbfdh gene (fusing the downstream primer used for Lhldh T79G / I223A -Cbfdh):

[0112] TTATTTCTTATCGTGCTTACCGTAAGCTTT。

[0113] Example 4: Recombinant plasmid pET-28a-araC-P araC -P BAD -Pmlaad-P t7-Lhldh T79G / I223A -Cbfdh, pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh T79G / I223A -Construction of -Cbfdh

[0114] The specific steps are as follows:

[0115] (1) Amplify the DNA sequence shown in SEQ ID NO.5 (including the promoter of the arabinose operon and the coding gene of its regulatory protein) using the gene editing plasmid pREDCas9 from addgene as a template, and ligate it with the vector obtained by linearizing the pET-28a-Pmlaad expression plasmid through inverse PCR amplification to obtain pET-28a-araC-P araC -P BAD -Pmlaad.

[0116] (2) Amplify the DNA coding sequence of Lhldh using the pET-28a-Lhldh constructed in Example 2 T79G / I223A as a template. For amplifying the gene of Cbfdh, use fusion PCR to obtain the fragment Lhldh T79G / I223A -Cbfdh and ligate it with the linearized vector obtained by inverse amplification with primers of pET-28a-araC-P T79G / I223A -P araC -P BAD -Pmlaad to obtain pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh; if the fragment amplified using pET-28a-Lhldh as a template is ligated with the linearized vector obtained by inverse amplification with primers of the above pET-28a-araC-P araC -P BAD -Pmlaad, pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh-Cbfdh can be obtained.

[0117] The primers required for constructing the recombinant plasmid are as follows:

[0118] The upstream primer for amplifying the DNA sequence shown in SEQ ID NO.5:

[0119] CAGCGCAATAGTTGGCGAAG;

[0120] Downstream primer for amplifying the DNA sequence shown in SEQ ID NO.6:

[0121] TATCATCAACGGGGTCTGGTGCC;

[0122] Upstream primer for reverse amplification of pET-28a-Pmlaad:

[0123] CGCCAACTATTGCGCTGGCATAAGGGAGAGCGTCGAGA;

[0124] Downstream primer for reverse amplification of pET-28a-Pmlaad:

[0125] AGACCCCGTTGATGATACATCATCATCATCATCACAGCAGCG;

[0126] Amplifying Lhldh T79G / I223A Upstream primer for amplifying the DNA coding sequence (downstream primer for fusing Lhldh T79G / I223A -Cbfdh):

[0127] ATCGTAGCTAGCTAGCGTACGAGATCTCGATCCCGCGAAAT;

[0128] Amplifying Lhldh T79G / I223A Downstream primer for amplifying the DNA coding sequence:

[0129] CTAAAACGATCTTCATTTAAAGTTGATCCATACCATCTTTAGTTGTCTTTTGG;

[0130] Upstream primer for reverse amplification of pET-28a-araC-P araC -P BAD -Pmlaad:

[0131] GCACGATAAGAAATAAGGTAAAGAAACCGCTGCTGCG;

[0132] Downstream primer for reverse amplification of pET-28a-araC-P araC -P BAD -Pmlaad: GTACGCTAGCTAGCTACGATCTCAGCTTCCTTTCGGGCTTT;

[0133] Upstream primer for amplifying the Cbfdh gene:

[0134] ATGAAGATCGTTTTAGTCTTATACGATTGTGG;

[0135] Downstream primer for amplifying Cbfdh gene (fused with Lhldh T79G / I223A -Cbfdh used downstream primer):

[0136] TTATTTCTTATCGTGCTTACCGTAAGCTTT。

[0137] Example 5: Construction of recombinant Escherichia coli E.coli BL21(DE3) / pET-28a-P t7 -Pmlaad-P t7 -Lhldh–Cbfdh (strain M1), E.coli BL21(DE3) / pET-28a-Pt7-Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh (hereinafter referred to as strain M2)

[0138] The specific steps are as follows:

[0139] (1) Transform the recombinant plasmid pET-28a-P t7 -Pmlaad-P t7 -Lhldh–Cbfdh, pET-28a-Pt7-Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh constructed in Example 3 into competent cells of Escherichia coli E.coli BL21(DE), and screen through an LB solid plate with 50 mg / L kanamycin. After sequencing confirmation, recombinant Escherichia coli strains M1 and M2 are obtained.

[0140] Example 6: Construction and expression of recombinant Escherichia coli E.coli BL21(DE3) / pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh (hereinafter referred to as strain N1) and E.coli BL21(DE3) / pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh (hereinafter referred to as strain N2)

[0141] The specific steps are as follows:

[0142] (1) Transform the recombinant plasmid pET-28a-araC-P araC -PBAD -Pmlaad-P t7 -Lhldh-Cbfdh or pET-28a-araC-P araC -P BAD -Pmlaad-P t7 -Lhldh T79G / I223A -Cbfdh were separately transformed into competent cells of Escherichia coli E. coli BL21(DE3). After screening on LB solid plates containing 50 mg / L kanamycin and sequencing for confirmation, recombinant E. coli strains N1 and N2 were obtained.

[0143] (2) Streak the above strains on LB solid plates containing 50 mg / L kanamycin. After static culture overnight at 37 °C, pick well-grown single colonies and inoculate them into 50 mL / 250 mL shake flask LB liquid medium containing 50 mg / L kanamycin. Culture at 37 °C and 220 rpm for 8 - 10 h, then transfer with a 4% transfer amount to 50 mL / 250 mL shake flask TB liquid medium containing 50 mg / L kanamycin, 5 mM lactose, 50 mM arabinose, and 0.5 g / L glucose, and induce culture at 30 °C for 10 - 12 h.

[0144] (3) Centrifuge the induced cells at 6000 rpm and 4 °C to collect the cells. Wash them three times with 200 mM phosphate buffer and then resuspend them to make the final OD 600 reach 30. Subsequently, ultrasonically disrupt the cells; centrifuge at 4 °C, 12000 rpm for 10 min to obtain the crude enzyme supernatant, and resuspend the precipitate with an equal volume of phosphate buffer.

[0145] (4) Mix a part of the above-obtained supernatant and precipitate components with the loading buffer in a ratio of 4:1, boil for 20 min to completely denature them, and prepare samples for SDS-PAGE analysis. The results are as Figure 1 shown, and all were expressed.

[0146] Example 7: Preparation of phenyl lactic acid by whole-cell catalyst of strain M1

[0147] The specific steps are as follows (the synthesis process is as Figure 1 shown):

[0148] (1) Preparation of whole-cell catalyst: Streak the recombinant strain M1 prepared in Example 5 on an LB solid plate containing 50 mg / L kanamycin. After static incubation overnight at 37 °C, pick a well-grown single colony and inoculate it into a 50 mL / 250 mL shake flask LB liquid medium containing 50 mg / L kanamycin. Culture at 37 °C and 220 rpm for 8 - 10 h, then transfer it with a transfer amount of 4% to a 50 mL / 250 mL shake flask TB liquid medium containing 50 mg / L kanamycin, 5 mM lactose, and 0.5 g / L glucose. After induction at 30 °C for 10 - 12 h, centrifuge at 6000 rpm at low temperature for 10 min to collect the cells. Wash the cells twice with 200 mM PB (pH 7.0) buffer to obtain the whole-cell catalyst.

[0149] (2) Preparation of phenyl lactic acid:

[0150] In a solution of 20 mM PB buffer (pH 7.0), add phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate to obtain a reaction system; incubate the reaction system at 37 °C and 220 rpm for 12 h under conversion conditions.

[0151] The results are shown in Table 2, Figure 3 As shown, the conversion rate of phenylalanine to phenyl lactic acid by the whole-cell transformation of the recombinant strain M1 is 37%, the yield of phenyl lactic acid at this time is 22.30 g / L, and the space-time yield is 1.86 g / L / h.

[0152] Example 8: Preparation of phenyl lactic acid by the whole-cell catalyst of strain M2

[0153] The specific steps are as follows (the synthesis process is as Figure 1 shown):

[0154] (1) Preparation of whole-cell catalyst: Streak the recombinant strain M2 prepared in Example 5 on an LB solid plate containing 50 mg / L kanamycin. After static incubation overnight at 37 °C, pick a well-grown single colony and inoculate it into a 50 mL / 250 mL shake flask LB liquid medium containing 50 mg / L kanamycin. Culture at 37 °C and 220 rpm for 8 - 10 h, then transfer it with a transfer amount of 4% to a 50 mL / 250 mL shake flask TB liquid medium containing 50 mg / L kanamycin, 5 mM lactose, and 0.5 g / L glucose. After induction at 30 °C for 10 - 12 h, centrifuge at 6000 rpm at low temperature for 10 min to collect the cells. Wash the cells twice with 200 mM PB (pH 7.0) buffer to obtain the whole-cell catalyst.

[0155] (2) Preparation of phenyl lactic acid:

[0156] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h.

[0157] The results are shown in Table 2, Figure 3 As shown, the conversion rate of the whole-cell transformation of phenylalanine to phenyl lactic acid by the recombinant strain M2 was 47%, the yield of phenyl lactic acid at this time was 28.45 g / L, and the space-time yield was 2.37 g / L / h. It can be seen that the introduction of the mutant T79G / I223A increased the yield of phenyl lactic acid.

[0158] Example 9: Preparation of phenyl lactic acid by whole-cell catalysis of strain N1

[0159] The specific steps are as follows (the synthesis process is as Figure 1 shown):

[0160] (1) Preparation of the whole-cell catalyst: The recombinant strains N1 and N2 prepared in Example 6 were respectively streaked on an LB solid plate with 50 mg / L kanamycin. After static culture overnight at 37 °C, well-grown single colonies were picked and inoculated into a 50 mL / 250 mL shake flask LB liquid medium with 50 mg / L kanamycin. After culturing at 37 °C and 220 rpm for 8 - 10 h, they were transferred with a transfer amount of 4% to a 50 mL / 250 mL shake flask TB liquid medium with 50 mg / L kanamycin, 5 mM lactose, 50 mM arabinose, and 0.5 g / L glucose. After induction at 30 °C for 10 - 12 h, the cells were centrifuged at 6000 rpm for 10 min at low temperature, and the cells were collected and washed twice with 200 mM PB (pH 7.0) buffer to obtain the whole-cell catalyst.

[0161] (2) Preparation of phenyl lactic acid:

[0162] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h.

[0163] The results are shown in Table 3. The conversion rate of the whole-cell transformation of phenylalanine to phenyl lactic acid by the recombinant strain N1 was 63%, the yield of phenyl lactic acid at this time was 37.89 g / L, and the space-time yield was 3.16 g / L / h.

[0164] Example 10: Preparation of phenyl lactic acid by whole-cell catalysis of strain N2

[0165] The specific steps are as follows (the synthesis process is as shown in Figure 1 )

[0166] (1) Preparation of whole-cell catalyst: Streak the recombinant strain N2 prepared in Example 6 on an LB solid plate with 50 mg / L kanamycin. After static incubation at 37 °C overnight, pick well-grown single colonies and inoculate them into a 50 mL / 250 mL shake flask LB liquid medium with 50 mg / L kanamycin. After culturing at 37 °C and 220 rpm for 8 - 10 h, transfer them with a transfer amount of 4% to a 50 mL / 250 mL shake flask TB liquid medium with 50 mg / L kanamycin, 5 mM lactose, 50 mM arabinose, and 0.5 g / L glucose. After inducing at 30 °C for 10 - 12 h, centrifuge at 6000 rpm at low temperature for 10 min, collect the thalli, and wash the thalli twice with 200 mM PB (pH 7.0) buffer to obtain the whole-cell catalyst.

[0167] (2) Preparation of phenyl lactic acid:

[0168] In a solution of 20 mM PB buffer (pH 7.0), add phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate to obtain a reaction system; transform the reaction system at 37 °C and 220 rpm for 12 h.

[0169] The results are shown in Table 3. The conversion rate of the whole-cell transformation of phenylalanine by the recombinant strain N2 to produce phenyl lactic acid is 71%. At this time, the yield of phenyl lactic acid is 42.60 g / L, and the space-time yield is 3.55 g / L / h.

[0170] Example 11: Preparation of phenyl lactic acid by the whole-cell catalyst of recombinant bacterium N2

[0171] In a solution of 20 mM PB buffer (pH 7.0), add phenylalanine with a final concentration of 40 g / L, the whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate to obtain a reaction system; transform the reaction system at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0172] Example 12: Preparation of phenyl lactic acid by the whole-cell catalyst of recombinant bacterium N2

[0173] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, a whole-cell catalyst prepared from step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0174] Example 13: Preparation of phenyl lactic acid using the whole-cell catalyst of recombinant bacterium N2

[0175] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, a whole-cell catalyst prepared from step (1) of Example 9 with a dry cell weight of 20 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0176] Example 14: Preparation of phenyl lactic acid using the whole-cell catalyst of recombinant bacterium N2

[0177] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, a whole-cell catalyst prepared from step (1) of Example 9 with a dry cell weight of 10 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0178] Example 15: Preparation of phenyl lactic acid using the whole-cell catalyst of recombinant bacterium N2

[0179] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, a whole-cell catalyst prepared from step (1) of Example 9 with a dry cell weight of 40 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0180] Example 16: Preparation of phenyl lactic acid using the whole-cell catalyst of recombinant bacterium N2

[0181] In a solution of 20 mM PB buffer (pH 6.0), phenylalanine with a final concentration of 60 g / L, a whole-cell catalyst prepared from step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0182] Example 17: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst

[0183] In a solution of 20 mM PB buffer (pH 8.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0184] Example 18: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst

[0185] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 30 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0186] Example 19: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst

[0187] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.1 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 45 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0188] Example 20: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst.

[0189] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, the whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.02 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0190] Example 21: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst

[0191] In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 60 g / L, a whole-cell catalyst prepared in step (1) of Example 9 with a dry cell weight of 30 g / L, 50 g / L glucose, and 0.3 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 2.

[0192] Table 2 Preparation of phenyl lactic acid by recombinant strain

[0193]

[0194]

[0195] Example 22: Preparation of phenyl lactic acid by whole-cell catalyst of recombinant bacterium N2

[0196] In Example 5, when preparing the whole-cell catalyst of recombinant Escherichia coli, the addition amounts of lactose and arabinose were changed to 0 mM and 0 mM respectively, and the obtained whole-cell catalyst had a dry weight of 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, 50 g / L glucose, and 0.3 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0197] Example 23: Preparation of phenyl lactic acid by whole-cell catalyst of recombinant bacterium N2

[0198] In Example 5, when preparing the whole-cell catalyst of recombinant Escherichia coli, the addition amounts of lactose and arabinose were changed to 5 mM and 0 mM respectively, and the obtained whole-cell catalyst had a dry weight of 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, 50 g / L glucose, and 0.3 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0199] Example 24: Preparation of phenyl lactic acid by whole-cell catalyst of recombinant bacterium N2

[0200] In Example 5, when preparing the whole-cell catalyst of recombinant Escherichia coli, the addition amounts of lactose and arabinose were changed to 5 mM and 50 mM respectively, and the obtained whole-cell catalyst had a dry weight of 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, 50 g / L glucose, and 0.3 mM ammonium formate were added to obtain a reaction system; the reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0201] Example 25: Preparation of phenyl lactic acid using recombinant bacterium N2 whole-cell catalyst

[0202] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 5 mM and 75 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0203] Example 26: Preparation of phenyl lactic acid using recombinant bacterium N2 whole-cell catalyst

[0204] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 5 mM and 100 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0205] Example 27: Preparation of phenyl lactic acid using recombinant bacterium N2 whole-cell catalyst

[0206] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 5 mM and 150 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0207] Example 28: Preparation of phenyl lactic acid using recombinant bacterium N2 whole-cell catalyst

[0208] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 5 mM and 200 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0209] Example 29: Preparation of phenyl lactic acid using recombinant bacterium N2 whole-cell catalyst

[0210] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 10 mM and 75 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L, and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0211] Example 30: Preparation of phenyl lactic acid by recombinant bacterium N2 whole-cell catalyst

[0212] In Example 5, when preparing the recombinant Escherichia coli whole-cell catalyst, the addition amounts of lactose and arabinose were changed to 20 mM and 150 mM respectively. The dry weight of the obtained whole-cell catalyst was 30 g / L. In a solution of 20 mM PB buffer (pH 7.0), phenylalanine with a final concentration of 50 g / L, glucose of 50 g / L, and 0.3 mM ammonium formate were added to obtain a reaction system. The reaction system was transformed at 37 °C and 220 rpm for 12 h. The reaction results are shown in Table 3.

[0213] Table 3 Preparation of phenyl lactic acid by recombinant Escherichia coli

[0214]

[0215] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A lactate dehydrogenase mutant, characterized in that, The mutant is obtained by mutating the 79th threonine (T) of the lactate dehydrogenase parent with an amino acid sequence as shown in SEQ ID NO.2 to glycine (G) and mutating the 223rd isoleucine (I) to alanine (A).

2. A gene encoding the mutant according to claim 1.

3. A recombinant vector carrying the gene according to claim 2.

4. A recombinant cell expressing the mutant according to claim 1, or containing the gene according to claim 2, or transformed with the recombinant vector according to claim 3.

5. A recombinant Escherichia coli, characterized in that, Using Escherichia coli as a host, overexpressing L-amino acid deaminase derived from Proteus mirabilis, lactate dehydrogenase derived from Lactobacillus hilgardii or the mutant according to claim 1, and overexpressing formate dehydrogenase derived from Candida boidinii.

6. The recombinant Escherichia coli according to claim 5, wherein The amino acid sequence of the L-amino acid deaminase is as shown in SEQ ID NO.1; the amino acid sequence of the lactate dehydrogenase is as shown in SEQ ID NO.2; the amino acid sequence of the formate dehydrogenase is as shown in SEQ ID NO.

4.

7. The recombinant Escherichia coli according to claim 5, characterized in that, The L-amino acid deaminase is driven to express by a combined gene fragment with a nucleotide sequence as shown in SEQ ID NO.5, and the combined gene fragment includes the promoter of the arabinose operon and the coding gene of its regulatory protein.

8. A method for biosynthesizing phenyl lactic acid, characterized in that, The method is to use the recombinant Escherichia coli according to any one of claims 5 to 7 as a catalyst, add it to a reaction system with phenylalanine as a substrate and glucose and ammonium formate as co-substrates, and react to prepare phenyl lactic acid.

9. The method according to claim 8, characterized in that, In the reaction system, the addition amount of ammonium formate is 0.02 - 0.5 M; the addition amount of phenylalanine is 20 - 60 g / L; the recombinant Escherichia coli is added according to the cell mass (dry weight) of 10 - 30 g / L; The reaction temperature is 25 - 45 °C, and the initial pH is 6.0 - 8.

0.

10. Use of the mutant according to claim 1, or the gene according to claim 2, or the recombinant vector according to claim 3, or the recombinant cell according to claim 4, or the recombinant Escherichia coli according to any one of claims 5 to 7, or the method according to claim 8 or 9 in the preparation of phenyl lactic acid or a product containing phenyl lactic acid.

Images