Mutant of nicotinamide ribose phosphate transferase and application thereof

Abstract

The invention provides a nicotinamide phosphoribosyltransferase mutant and an application of the nicotinamide phosphoribosyltransferase mutant in preparation of beta-nicotinamide mononucleotide. According to the nicotinamide phosphoribosyltransferase mutant, 259th lysine (K) of an amino acid sequence shown in SEQ ID NO: 2 is mutated into 259th valine (V). The invention overcomes the technical problems of slow reaction, low yield, high energy consumption and NMN feedback inhibition of the product in the process of producing NMN by escherichia coli, and the constructed nicotinamide phosphoribosyltransferase mutant expression system is used for fermentation production of nicotinamide mononucleotide, and slows down the feedback inhibition effect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a nicotinamide phosphoribosyltransferase mutant and its application in improving the production of β-nicotinamide mononucleotide by key enzymes involved in the fermentation method. Background Art

[0002] β-Nicotinamide mononucleotide (β-NMN) has been reported to be a compound that can effectively relieve aging and promote physical health. It can generate nicotinamide adenine dinucleotide (NAD+) in vivo metabolism and plays an important role in inhibiting DNA damage, apoptosis, autophagy, epigenetics and modification. Due to its role in anti-aging and metabolism, NMN has become popular in the fields of cosmetics and beauty as well as healthcare products.

[0003] Traditional NMN synthesis methods mainly rely on chemical methods, with the raw material being nicotinamide ribose, which is expensive. The production process is difficult to control, resulting in many impurities and difficult purification and separation, and relatively serious environmental pollution. Enzymatic methods have problems such as high requirements for the purity of enzymes and extremely harsh reaction conditions for enzymes. In recent years, it has been found that during the production of NMN, the sites on nicotinamide phosphoribosyltransferase will react with the product NMN, thereby reducing production efficiency. Summary of the Invention

[0004] The purpose of the present invention is to provide a new plasmid containing an exogenous nicotinamide phosphoribosyltransferase gene with better expression effect, and further to provide a plasmid containing an exogenous nicotinamide phosphoribosyltransferase gene with better expression effect in Escherichia coli.

[0005] The second purpose of the present invention is to apply the plasmid containing the exogenous nicotinamide phosphoribosyltransferase gene to the fermentation method for synthesizing NMN.

[0006] The third purpose of the present invention is to solve the problem in the prior art that the product NMN may bind to the key enzyme NAMPT, resulting in a reduction in yield.

[0007] The key gene for producing NMN is nicotinamide phosphoribosyltransferase. Therefore, the present invention mutates the reaction sites on nicotinamide phosphoribosyltransferase. By reducing the binding sites of NMN and NAMPT, the problem of NMN feedback inhibition is alleviated. The present invention mutates the rate-limiting enzyme of key catalysis by site-directed mutagenesis to increase the reaction rate of key steps. The raw material uses relatively inexpensive nicotinamide to reduce production costs. At the same time, the product NMN may occupy the site of the key enzyme nicotinamide phosphoribosyltransferase, resulting in a decrease in yield. The reaction process is also relatively simple. The present invention uses a nicotinamide phosphoribosyltransferase gene from a different source from the prior art and applies it to the fermentation method. Different from the enzyme preparation process in the prior art, the substrates used in the present invention are only nicotinamide (NAM) and glucose, which are cheaper and more easily available, and have better economic benefits.

[0008] To achieve the above object, the present invention provides a nicotinamide phosphoribosyltransferase mutant, in which the 259th lysine of the amino acid sequence of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 2 is mutated to valine.

[0009] The 259th lysine (K) of the wild-type nicotinamide phosphoribosyltransferase amino acid sequence shown in SEQ ID NO: 2 is mutated to 259 valine (V) to obtain the amino acid sequence of the nicotinamide phosphoribosyltransferase mutant shown in SEQ ID NO: 3.

[0010] The present invention also provides the gene of the nicotinamide phosphoribosyltransferase mutant, and the nucleotide sequence of the gene of the nicotinamide phosphoribosyltransferase mutant is the nucleotide sequence described in a) or b) below,

[0011] a) The nucleotide sequence is the gene sequence shown in SEQ ID NO: 5;

[0012] b) The nucleotide sequence is the gene sequence shown in SEQ ID NO: 6.

[0013] According to the method described in the prior art, the present invention identifies substances with a structure similar to NMN. Since the site on nicotinamide phosphoribosyltransferase can bind to NMN, the energy value of the binding site is first examined using molecular docking. Subsequently, a preliminary experiment is further set up, that is, a precursor substance is added to wild-type nicotinamide phosphoribosyltransferase, and then NMN with different concentrations is added dropwise. The NMN produced by the enzyme is calculated by subtracting the added NMN amount from the total NMN amount. The results show that as the added NMN amount increases, the yield of NMN obtained from the enzymatic reaction becomes lower and lower, demonstrating that NMN occupies the site on nicotinamide phosphoribosyltransferase, leading to a decrease in yield. Therefore, mutations are made based on the results after docking. The same method as described above is used to screen nicotinamide phosphoribosyltransferase mutants and NMN. Finally, it is experimentally verified that the mutant of nicotinamide phosphoribosyltransferase with the amino acid sequence shown in SEQ ID NO: 3 reduces the binding of NMN to nicotinamide phosphoribosyltransferase and improves the reaction efficiency. The mutation method of the mutant of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 3 in the present invention is abbreviated as 259K / 259V.

[0014] Preferably, the coding gene of the mutant of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 3 is the nucleotide sequence shown in SEQ ID NO: 5.

[0015] In a preferred embodiment of the present invention, when the lysine (K) at site 259 is mutated to valine (V) with the nucleotide sequence of GTC, the fermentation NMN yield is increased by 36.3%.

[0016] Furthermore, during the codon optimization process of the present invention, it is found that the 771st nucleotide of the nucleotide sequence of wild-type nicotinamide phosphoribosyltransferase (Nicotinamide pHospHoribosyltransferase) NAMPT shown in SEQ ID No: 1 is mutated from C to T, resulting in the nucleotide sequence shown in SEQ ID NO: 4. The mutation method of this nucleotide at site 771 in the present invention is abbreviated as 257F / 257F. During the production of NMN, nicotinamide phosphoribosyltransferase is a key enzyme in the reaction process and can directly affect the yield of NMN. Therefore, the optimization of the expression level of nicotinamide phosphoribosyltransferase is particularly important. After codon optimization, the present invention obtains the nicotinamide phosphoribosyltransferase gene shown in SEQ ID NO: 4. Due to the change in the GC content of the expression sequence, the expression level of the nicotinamide phosphoribosyltransferase is just suitable for the production of NMN. It is experimentally verified that when the nucleotide sequence of phenylalanine (F) at site 257 is mutated from TTC to TTT, that is, when using the nicotinamide phosphoribosyltransferase gene shown in SEQ ID NO: 4, the fermentation NMN yield is increased by 5.3%.

[0017] Therefore, a further preferred embodiment of the present invention is that on the basis of the mutant coding gene of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 5, the 771st nucleotide is mutated from C to T to obtain the nucleotide sequence shown in SEQ ID NO: 6.

[0018] In a preferred embodiment of the present invention, when the 2257F / 257F and 259K / 259V sites are jointly mutated, that is, using the mutant gene of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 6, the fermentation NMN yield is increased by 46.1%.

[0019] The present invention also provides a recombinant expression vector of nicotinamide phosphoribosyltransferase mutant, which contains the gene of the nicotinamide phosphoribosyltransferase mutant.

[0020] Preferably, the recombinant expression vector is selected from at least one of pET series vectors, pUC series vectors, pCold series vectors, pSUMO series vectors, pDsRed series vectors, pBAD series vectors, pMAL series vectors, pACYC series vectors, pQE series vectors, pGEX series vectors, pPIC9K vector, pPICZ series vectors, pGAPZ series vectors, pFLD vector, pUB110 vector, pHT series vectors, pWB980 vector, pBE-S vector, pHY-Pgrac vector, pAX01 vector, pDG1730 vector.

[0021] The present invention also provides an engineered bacterium containing any one of the above-mentioned recombinant expression vectors.

[0022] Preferably, any one of the above-mentioned engineered bacteria includes at least one of Pichia pastoris, Bacillus subtilis, Bacillus licheniformis, Escherichia coli.

[0023] The present invention also provides a preparation method of β-nicotinamide mononucleotide. Using an Escherichia coli expression system, the preparation method includes the following steps:

[0024] Step 1: Transform the obtained recombinant expression vector of nicotinamide phosphoribosyltransferase mutant into Escherichia coli to obtain Escherichia coli containing the gene of the nicotinamide phosphoribosyltransferase mutant described in claim 2;

[0025] Step 2: Shake and culture the Escherichia coli containing the gene of the nicotinamide phosphoribosyltransferase mutant in LB medium to obtain a seed solution;

[0026] Step 3: Inoculate the seed solution into the fermentation medium and shake culture at 30 °C until OD 600When the value is 0.8, after adding 0.75 mM IPTG for induction for 12 h, add NAM and glucose, and continue to culture with shaking;

[0027] Step 4: Collect the supernatant for subsequent purification of β-nicotinamide mononucleotide.

[0028] Preferably, in any of the above, the mass ratio of glucose:NAM is 2:1.

[0029] In a preferred embodiment of the present invention, the preparation method includes the following steps:

[0030] Preferably, in step 2, the Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant is cultured in LB medium containing 50 mg / L kanamycin at 37 °C, 200 rpm, with shaking for 12 h, and used as the seed solution.

[0031] Preferably, in step 3, the seed solution is transferred into the fermentation medium at 1%. Preferably, the fermentation medium is LB medium.

[0032] Preferably, in step 3, culture with shaking at 30 °C, 200 rpm until OD 600 When the value is 0.8, after adding 0.75 mM IPTG for induction for 12 h, add NAM with a final concentration of 1 g / L and glucose with a final concentration of 2 g / L, and continue to culture with shaking for 12 h.

[0033] Preferably, in step 1, a screening step is further included:

[0034] The Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant gene obtained in step 1 is cultured at 37 °C for 8 h, then IPTG (isopropyl-β-D-thiogalactoside, IPTG) is added for overnight induction, and NAM and glucose are added the next day. Samples are taken at 4, 6, 8, 10, and 12 h after the addition. After ultrasonic disruption of the samples, the supernatant is taken for detection.

[0035] More preferably, strains with high fluorescence values are obtained by fluorescence detection.

[0036] More preferably, after secondary fermentation culture, further detection of NMN production is carried out by HPLC, and suitable strains are selected for subsequent production.

[0037] Preferably, add 27.7 μL of 2 mol / L KOH and 1% BSA into a 1 mL centrifuge tube, then add 27.7 μL of 20% acetophenone. After briefly vortexing and mixing, place it on ice and incubate in an ice bath for 2 min. Add 125 μL of 88% formic acid, vortex thoroughly to mix, react in a constant temperature shaker at 37 °C for 10 min, and then centrifuge. Pipette 80 μL into a black 96-well plate, set the excitation light of the microplate reader to 382 nm and the emission light to 445 nm for fluorescence detection. Select the strain with a high fluorescence value for bacteria preservation. After secondary fermentation culture, further detect the NMN production by HPLC.

[0038] The present invention also provides the use of the nicotinamide phosphoribosyltransferase mutant described in any one of the above in the preparation of β-nicotinamide mononucleotide.

[0039] The present invention also provides the use of the gene of the nicotinamide phosphoribosyltransferase mutant described in any one of the above in the preparation of β-nicotinamide mononucleotide.

[0040] The present invention also provides the use of the recombinant expression vector of the nicotinamide phosphoribosyltransferase mutant described in any one of the above in the preparation of β-nicotinamide mononucleotide.

[0041] The present invention also provides the use of the engineered bacterium described in any one of the above in the preparation of β-nicotinamide mononucleotide.

[0042] The present invention selects the nicotinamide phosphoribosyltransferase from Comamonadaceae bacterium with the highest evaluation in molecular docking and performs mutation, describes the method of heterologous expression in Escherichia coli and the construction of foreign enzyme mutants, and uses this engineered bacterium as a chassis strain for highly efficient production of nicotinamide mononucleotide.

[0043] The method for preparing β-nicotinamide mononucleotide in the present invention is different from the existing methods. Different from the traditional enzymatic method, the present invention does not require the addition of expensive precursor substance ribose 5-phosphate pyrophosphate as a substrate. The method for preparing β-nicotinamide mononucleotide provided by the present invention is a fermentation method, which only uses cheap NAM and glucose as substrates. Moreover, after mutation and transfer into the bacterial cells, the present invention clearly measures by HPLC method that the production has increased under the influence of metabolism. And the subsequent purification of the fermentation method provided by the present invention is simpler than the enzymatic method in the prior art, and the recombinant expression vector of the nicotinamide phosphoribosyltransferase mutant provided by the present invention has a significant improvement when applied to the fermentation method for producing NMN.

[0044] In a preferred embodiment of the present invention, first, the optimized nucleotide sequence is translated into an amino acid sequence, modeled using the switch model and compared with models in the PDB library for multiple numerical values to prove the accuracy and reliability of the model. Then, 3D modeling of NMN is performed using ChemDraw, molecular docking is carried out in AutoDock, and the results are output using PyMOL to find the sites that need to be mutated. Primer design is carried out at the mutated sites for site-directed saturation mutagenesis, overlapping PCR is used to ligate the fragments, and then homologous recombination is used to construct them onto the pET-28a(+) vector. After sequencing, mutant screening is carried out. Through screening and identification, it is confirmed that the nucleotide sequence AAG at the 259K site is mutated to GTC of V, that is, the nicotinamide phosphoribosyltransferase mutant with the amino acid sequence as shown in SEQ ID NO: 3.

[0045] Subsequently, during the process of codon optimization, it was found that the expression level of nicotinamide phosphoribosyltransferase with the nucleotide sequence TTC at the 257F site mutated to TTT was more conducive to the production of NMN. Therefore, the amino acid sequence of the preferred nicotinamide phosphoribosyltransferase mutant of the present invention is as shown in SEQ ID NO: 3, and the gene sequence of the preferred nicotinamide phosphoribosyltransferase mutant is as shown in SEQ ID NO: 5 or SEQ ID NO: 6.

[0046] An expression vector is constructed using the obtained mutant gene, and the primer sequences involved are as follows:

[0047] The forward synthetic mutant primer for 257F is as shown in SEQ ID NO: 7:

[0048] CGCGCCGGGCTTGCCNNNCTGCTCGACCATGTT;

[0049] The reverse synthetic mutant primer for 257F is as shown in SEQ ID NO: 8:

[0050] CGCGCCGGGCTTGCCNNNCTGCTCGACCATGTT;

[0051] The forward synthetic primer for 259K is as shown in SEQ ID NO: 9:

[0052] GTCGAGCAGTTCGGCNNNCCCGGCGCGATCTTC;

[0053] The reverse synthetic mutant primer for 259K is as shown in SEQ ID NO: 10:

[0054] GAAGATCGCGCCGGGNNNGCCGAACTGCTCGAC;

[0055] The forward synthesis primer for the combined mutation of 257F and 259K is shown in SEQ ID NO: 11:

[0056] CAGTTTGGCGTCCCCG;

[0057] The reverse synthesis mutation primer for the combined mutation of 257F and 259K is shown in SEQ ID NO: 12:

[0058] CCGGGGACGCCAAACTGCTCG;

[0059] The forward synthesis primer for the NAMPT gene is shown in SEQ ID NO: 13:

[0060] CAAATGGGTCGCGGATCCATGACTCGCAAT;

[0061] The reverse synthesis primer for the NAMPT gene is shown in SEQ ID NO: 14:

[0062] TCGACGGAGCTCGAATTCTCACAGCGGCGC.

[0063] An expression vector was constructed using the obtained mutant gene and transfected into engineering bacteria to obtain engineering bacteria containing a recombinant expression vector of nicotinamide phosphoribosyltransferase mutant. SDS-PAGE, fluorescence detection method and high performance liquid chromatography (HPLC) were used for screening respectively. After picking monoclonal colonies in the plate and fermenting in a shake flask until the OD 600 values were all 0.8, SDS-PAGE was performed, and the strains with high enzyme expression were selected according to the band size. The screened strains were induced and fermented until the OD 600 values were all 0.8, and the fluorescence intensity value was detected after purification. The strains with higher fluorescence values were detected by HPLC, and the active mutant with the highest yield was selected, that is, the engineering bacteria containing a recombinant expression vector of nicotinamide phosphoribosyltransferase mutant. The results showed that the yield of the nicotinamide phosphoribosyltransferase was increased to varying degrees compared with the original sequence.

[0064] In a preferred embodiment of the present invention, according to the gene expression method, the amount of the expressed protein is regulated by adjusting different vectors and hosts. The present invention preferably uses pET-28 as the vector, which can not only avoid the waste of resources caused by the incorrect folding of the protein into inclusion bodies due to too fast translation speed, but also effectively improve the protein expression level. Preferably, Escherichia coli BL21(DE3) is used as the host, and the precursor substance ribose-5-phosphate pyrophosphate generated by the pentose phosphate pathway (PPP) is used for the synthesis of NMN. Therefore, only relatively cheap NAM and glucose are used as production raw materials, and no additional ribose-5-phosphate pyrophosphate needs to be added.

[0065] In a preferred embodiment of the present invention, it is verified that the optimum temperature of the nicotinamide phosphoribosyltransferase mutant is 25-60 °C, preferably 30-55 °C, preferably 30, 35, 40, 45, 50, 55 °C and the ranges therebetween.

[0066] In a preferred embodiment of the present invention, it is verified that the optimum pH of the nicotinamide phosphoribosyltransferase mutant is 5-8, preferably 5, 6, 7, 8 and the ranges therebetween.

[0067] The present invention overcomes the technical problems of slow reaction, low yield, high energy consumption and product NMN feedback inhibition in the production of NMN by Escherichia coli BL21(DE3), overcomes the problems in the production efficiency and reaction rate of the rate-limiting enzyme. After verification by HPLC comparison, the yield increased by 5.3% after the single gene mutation of 257F / 257F, the yield increased by 36.3% after the single gene mutation of 259K / 259V, and the yield increased by 46.1% after the combined mutation of the two loci of 257F / 257F and 259K / 259V.

[0068] The present invention constructs a chassis strain with high yield of nicotinamide mononucleotide and provides its application. The mutant provided by the present invention is used for the preparation of β-nicotinamide mononucleotide by fermentation method, which improves the yield of β-nicotinamide mononucleotide of the initial strain and provides a chassis strain with better yield for subsequent strain construction and industrial production. Description of the Drawings

[0069] Figure 1 It is the SDS-PAGE diagram of the successful expression of NAMPT enzyme in Preferred Embodiment 2 of the present invention.

[0070] Figure 2 It is the result of sequencing alignment of the successfully constructed expression strain in Preferred Embodiment 2 of the present invention.

[0071] Figure 3 It is the protein concentration standard curve in Preferred Embodiment 2 of the present invention.

[0072] Figure 4 It is the NMN concentration standard curve in Preferred Embodiment 2 of the present invention.

[0073] Figure 5 It is the enzyme activity of the enzyme before and after mutation at different temperatures in Preferred Embodiment 4 of the present invention.

[0074] Figure 6 It is the enzyme activity of the enzyme before and after mutation at different pH values in Preferred Embodiment 4 of the present invention.

[0075] Figure 7 It is the growth curve of Escherichia coli in Preferred Embodiment 5 of the present invention.

[0076] Figure 8 It is the relationship between the absorbance value and the cell mass in Preferred Embodiment 5 of the present invention.

[0077] Figure 9 It is the optimization result of the fermentation induction timing in Preferred Embodiment 5 of the present invention.

[0078] Figure 10 It is the optimization result of the concentration of fermented IPTG in Preferred Embodiment 5 of the present invention.

[0079] Figure 11 It is the optimization result of the IPTG induction duration in Preferred Embodiment 5 of the present invention.

[0080] Figure 12 It is the optimization result of the feeding ratio of glucose to NAM in fermentation in Preferred Embodiment 5 of the present invention.

[0081] Figure 13 It is the optimization of the fermentation temperature in Preferred Embodiment 5 of the present invention.

[0082] Figure 14 It is the optimization of the fermentation pH in Preferred Embodiment 5 of the present invention. Detailed implementation manners

[0083] Example 1

[0084] Example 1 provides a method for constructing the nicotinamide phosphoribosyltransferase expression system of the present invention.

[0085] The gene fragment of NAMPT was synthesized by Tianjin Jiutian Gene and ligated to the vector pET-28a(+). The plasmid was transformed into DH5α, and colony PCR was performed after plating. Primers were designed, F: atgggtcgcggatccatgtcggactcagaa (shown in SEQ ID NO: 15); D: atccggatatagttcctcctttca (shown in SEQ ID NO: 16).

[0086] PCR was performed using a high-fidelity PCR enzyme, and the product was separated by 1% agarose gel electrophoresis and then recovered by gel extraction. The recovered liquid was sequenced, and the result was compared with the gene fragment. If it was correct, the construction was successful. The plasmid with the correct result was extracted and transformed into Escherichia coli BL21(DE3).

[0087] In this example, the gene of NAMPT includes the nicotinamide phosphoribosyltransferase gene and the nicotinamide phosphoribosyltransferase mutant gene.

[0088] Preferably, the nicotinamide phosphoribosyltransferase gene is as shown in SEQ ID NO: 1, denoted as Wild type.

[0089] Preferably, the nicotinamide phosphoribosyltransferase gene mutation sequence is as shown in SEQ ID NO: 4, denoted as 257F / 257F.

[0090] Preferably, the nicotinamide phosphoribosyltransferase mutant gene is as shown in SEQ ID NO: 5, denoted as 259K / 259V.

[0091] Preferably, the nicotinamide phosphoribosyltransferase mutant gene is as shown in SEQ ID NO: 6, denoted as 257F / 257F, 259K / 259V.

[0092] Example 2

[0093] The method for enzyme activity identification of the nicotinamide phosphoribosyltransferase expression system obtained in Example 1 in Example 2.

[0094] Purified enzyme: Activate the Escherichia coli BL21(DE3) seed solution carrying the plasmid obtained in Example 1, transfer it to a 250 mL shake flask, add IPTG for induction, centrifuge at 10000 r / min and 4 °C for 15 min, wash three times with PBS, resuspend the cells with 20 mmol / L imidazole lysis solution, the power of the ultrasonic disruptor is 200 W, and collect the supernatant. Equilibrate the nickel column with lysis buffer before loading, wash away impurities with 50 mmol / L imidazole after loading, elute with 300 and 500 mmol / L imidazole, and collect the eluate. Figure 1 The results after purification are shown as follows. The results show that the three mutants are successfully expressed ( Figure 1 The meanings of the labels in each lane are as follows: empty: the band of Escherichia coli without plasmid in the empty vector; W: wild type; 257: single mutation at site 257; 259: single mutation at site 259; M: double-site mutation; lanes 3-6 are before purification, and lanes 7-10 are after purification). Figure 2 The results of sequencing alignment of the successfully constructed expression strains are shown as follows. The results show that the mutants are successfully constructed.

[0095] Enzyme activity assay: Add 3.45 μL of 1 mol / L Tris-HCl, 1.38 μL of 1% BSA, 0.83 μL of 1 mol / L MgCl2, 1.38 μL of 0.1 mol / L ATP, 0.28 μL of 0.1 mol / L PRPP (pentaphosphoribosyl pyrophosphate), 1.38 μL of 0.1 mol / L dithiothreitol, 58.1 μL of pure water, 1.5 μL of pure enzyme solution diluted by a certain multiple, and 6.9 μL of 200 μmol / L NAM. After reacting in a thermostatic shaker at 45 °C for 15 min, inactivate the enzyme in a 95 °C water bath for 1 min, and set pure water as the blank control.

[0096] Terminate the enzyme reaction: Inactivate the centrifuge tube by centrifugation in a 100°C water bath. Add 27.7 μL of 2 mmol / L KOH and 27.7 μL of 20% acetophenone to it. After vortex oscillation, place it in an ice bath for 2 min. Add 125 μL of 88% formic acid, centrifuge, and then shake in a thermostatic shaker at 37°C for 10 min. Measure the fluorescence with a microplate reader at an excitation wavelength of 382 nm and an emission wavelength of 445 nm.

[0097] Calculation: Calculate the enzyme activity based on the fluorescence value and the standard curve. The enzyme amounts of the 257F / 257F single gene mutant, 259K / 259V single mutant, and the double-site mutant of 257F / 257F and 259K / 259V are 2.3 mg, 2.1 mg, and 2.5 mg respectively. After calculation, the enzyme activities are 3.2 U, 3.6 U, and 4.5 U respectively. The protein standard curve is as Figure 3 shown. The standard curve of the product NMN is as Figure 4 shown.

[0098] Example 3

[0099] Taking the single gene mutation of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 4 and the mutant genes of nicotinamide phosphoribosyltransferase shown in SEQ ID NO: 5 and SEQ ID NO: 6 as examples, Example 3 provides a construction scheme for nicotinamide phosphoribosyltransferase mutants.

[0100] Construction and screening of mutants: Find the required nucleotide sequence from NCBI and perform codon optimization. Perform homology modeling on the optimized sequence and the NMN small molecule. Use Autodock for molecular docking, predict the possible binding sites with NMN according to the principle of the lowest energy, and output the mutation site results in pymol. For the mutation results obtained from the model, construct an Escherichia coli expression strain containing the nicotinamide phosphoribosyltransferase mutant, verify the mutation results, and finally confirm the 259K / 259V mutation.

[0101] Screen the codon optimization results. The codon optimization at the 257F / 257F site is more conducive to expressing an appropriate amount of nicotinamide phosphoribosyltransferase and improving the yield of NMN.

[0102] Therefore, overlapping PCR was used to design primers for site-directed saturation mutagenesis. The forward synthetic mutagenic primer for 257F was: CGCGCCGGGCTTGCCNNNCTGCTCGACCATGTT, and the reverse synthetic mutagenic primer was: CGCGCCGGGCTTGCCNNNCTGCTCGACCATGTT. The forward synthetic primer for 259K was: GTCGAGCAGTTCGGCNNNCCCGGCGCGATCTTC, and the reverse synthetic mutagenic primer was: GAAGATCGCGCCGGGNNNGCCGAACTGCTCGAC. The forward synthetic primer for the combined mutation of 257F and 259K was: CAGTTTGGCGTCCCCG, and the reverse synthetic mutagenic primer was: CCGGGGACGCCAAACTGCTCG. The forward synthetic primer for the NAMPT gene was: CAAATGGGTCGCGGATCCATGACTCGCAAT, and the reverse synthetic primer was: TCGACGGAGCTCGAATTCTCACAGCGGCGC. The above sequences are shown as SEQ ID NO: 7 to SEQ ID NO: 14. The obtained nicotinamide phosphoribosyltransferase mutant gene was constructed into the pET-28a(+) vector to obtain a recombinant expression vector of nicotinamide phosphoribosyltransferase mutant.

[0103] The recombinant expression vector of nicotinamide phosphoribosyltransferase mutant was transformed into Escherichia coli BL21(DE3), and spread on LB medium containing kanamycin with a final concentration of 50 mg / L [10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract powder], and cultured overnight in an inverted position in a 37 °C incubator. Single colonies were picked, stored in 1.5 mL centrifuge tubes for micro-expansion culture, and then stored in 2 mL bacterial storage tubes for freezing.

[0104] Primary screening and secondary screening: The bacterial liquid in the bacterial storage tube was inoculated into a 250 ml flask until OD 600After transferring at a value of 0.8 into a new 250 mL shake flask and culturing at 37 °C for 8 h, IPTG (isopropyl-β-D-thiogalactoside, IPTG) was added to induce overnight. The next day, NAM and glucose were added as feedstock, and 5 mL samples were taken at 4, 6, 8, 10, and 12 h after the addition of the feedstock respectively. The samples were ultrasonically disrupted and then centrifuged at 8000 rpm for 10 min, and the supernatant was taken for detection. In a 1 mL centrifuge tube, 27.7 μL of 2 mol / L KOH and 1% BSA were added, and then 27.7 μL of 20% acetophenone was added. After briefly vortexing and mixing evenly, it was placed on ice and fully ice-bathed for 2 min. 125 μL of 88% formic acid was added, and after vortexing and mixing evenly, it was reacted in a constant temperature shaker at 37 °C for 10 min, and then centrifuged. 80 μL was aspirated into a black 96-well plate, and the excitation light of the microplate reader was set to 382 nm and the emission light was 445 nm for fluorescence detection. Strains with high fluorescence values were selected for bacteria preservation, and after secondary fermentation culture, the NMN yield was further detected by HPLC.

[0105] The results are shown in Table 1. The yield of the 257F / 257F single mutant was 6.88 mg / L, with a 5.3% increase; the yield of the 259K / 259V single mutant was 9.38 mg / L, with a 36.3% increase; and the yield of the two-point combined mutant was 10.05 mg / L, with a 46.1% increase. Table 1 shows the comparison of the yields of the plasmid in Escherichia coli before and after.

[0106] In Example 3, the preferred nicotinamide phosphoribosyltransferase mutants of the present invention screened were the 259K / V single mutant, the 257F / 257F and 259K / 259V two-point mutants.

[0107] Table 1:

[0108] Mutant NMN production Improvement amount Wild type 6.53 mg / L -- 257F / 257F 6.88 mg / L 5.3％ 259K / 259V 9.38 mg / L 36.3％ 257F / 257F, 259K / 259V 10.05 mg / L 46％

[0109] Example 4

[0110] Example 4 provides the temperature application range of the nicotinamide phosphoribosyltransferase mutant.

[0111] An appropriate amount of enzyme solution was taken and incubated at 25 - 60 °C for 10 min respectively, and then the enzyme activity at different temperatures was measured at pH = 7, with the enzyme activity at the optimal temperature as the control (100%). The results obtained are as Figure 5 shown. Under different temperature conditions, the mutant enzyme activity was higher than that of the wild type. Figure 5 Among them, at 45 °C, the wild type and NAMPT-M (the 257F / 257F and 259K / 259V two-point mutants) both reached the highest, which were 89% and 97% respectively.

[0112] Example 4 also provides the pH application range of the nicotinamide phosphoribosyltransferase mutant.

[0113] Take an appropriate amount of enzyme solution and incubate it in buffers with different pH values (pH 4 - 9) for 10 min. At the optimal temperature (preferably 30 - 55 °C, or 40 - 45 °C, or 40 °C, or 45 °C), measure the enzyme activities of the wild type and the mutant in buffers with different pH values, and use their enzyme activities under the optimal pH conditions as the control (100%). The results are as Figure 6 shown. Under different pH conditions, the relative enzyme activities of the 257F / 257F and 259K / 259V double-site mutants are higher than those of the wild type.

[0114] Example 5

[0115] Example 5 provides an optimization scheme for the production conditions of the nicotinamide phosphoribosyltransferase mutant constructed from the 257F / 257F and 259K / 259V double-site mutant genes shown in SEQ ID NO: 6.

[0116] Measurement of the growth curve and cell mass: Transfer the mutated bacterial solution into a shake flask, and take 3 ml of the bacterial solution at 2, 4, 6, 8, 10, 12, 14, and 16 h respectively for OD 600 value detection. In the first 12 h, it is in the exponential growth period, and the OD 600 value becomes higher as time goes by. Later, the OD 600 value gradually stabilizes. Concentrate the samples by a certain multiple, centrifuge them, and then weigh them to obtain the linear relationship between the two. The results are shown in Figure 7 、 Figure 8 .

[0117] Among them, Figure 7 is the growth curve of Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant. Figure 8 is the relationship between the absorbance value and the cell mass of Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant gene.

[0118] Single-factor optimization of the shake flask:

[0119] Preparation of the seed solution: Transfer 500 μL of the mutant into a 250 mL shake flask in a sterile environment, into 50 mL of LB medium containing 50 mg / L kanamycin at a final concentration, and culture it in a shaker at 37 °C and 200 rpm for 12 h. Then, it is used as the seed solution for subsequent fermentation and transfer.

[0120] Optimization of the fermentation induction timing: Transfer the seed solution into the LB medium at a ratio of 1%, and culture it in a shaker at 37 °C and 200 rpm. During fermentation, when the OD 600When the values are 0.4, 0.6, 0.8, 1, 1.2, 1 M IPTG is added later for induction for 12 h, and then NAM with a final concentration of 2 g / L and glucose with a final concentration of 2 g / L are added. Sampling is carried out at 4, 6, 8, 10, and 12 h after feeding respectively. The samples are centrifuged and concentrated at 5000 rpm and 4 °C, then resuspended with PBS, sonicated and centrifuged again, and the supernatant is taken as the sample. At OD 600 When the induction starts at 1.2, the highest yield reaches 12 mg / L, and the yield increases by 20%, as shown in Figure 9 .

[0121] Optimization of the concentration of IPTG for fermentation: The seed liquid is transferred into the fermentation medium at 1%, and cultured in a shaker at 37 °C and 200 rpm. When the OD 600 value is 1.2, IPTG with concentrations of 0.25 mM, 0.5 mM, 0.75 mM, 1 mM, and 1.25 mM are added for induction for 12 h, and then NAM with a final concentration of 2 g / L and glucose with a final concentration of 2 g / L are added. Sampling is carried out at 4, 6, 8, 10, and 12 h after feeding respectively. The samples are centrifuged and concentrated at 5000 rpm and 4 °C, then resuspended with PBS, sonicated and centrifuged again, and the supernatant is taken as the sample. When the concentration of IPTG is 0.75 mM, the highest yield is 12.1 mg / L, and the yield increases by 21%, as shown in Figure 10 .

[0122] Optimization of the fermentation induction duration: The seed liquid is transferred into the fermentation medium at 1%, and cultured in a shaker at 37 °C and 200 rpm. When the OD 600 value is 0.6, 1 mM IPTG is added and induced for 8, 10, 12, 14, and 16 h respectively, and then NAM with a final concentration of 2 g / L and glucose with a final concentration of 2 g / L are added. Sampling is carried out at 4, 6, 8, 10, and 12 h after feeding respectively. The samples are centrifuged and concentrated at 5000 rpm and 4 °C, then resuspended with PBS, sonicated and centrifuged again, and the supernatant is taken as the sample. When induced for 12 h after adding IPTG, the highest yield is 12.6 mg / L, and the yield increases by 26%, as shown in Figure 11 .

[0123] Optimization of the fermentation feeding ratio: The seed liquid is transferred into the fermentation medium at 1%, and cultured in a shaker at 37 °C and 200 rpm. When the OD 600After induction with 1 mM IPTG concentration for 12 h when the value was 0.6, NAM with a final concentration of 1 g / L, glucose with a final concentration of 1 g / L, NAM with a final concentration of 1 g / L and glucose with a final concentration of 2 g / L, NAM with a final concentration of 1 g / L and glucose with a final concentration of 3 g / L, NAM with a final concentration of 2 g / L and glucose with a final concentration of 1 g / L, and NAM with a final concentration of 3 g / L and glucose with a final concentration of 1 g / L were added. Sampling was carried out at 4 h, 6 h, 8 h, 10 h, and 12 h after feeding respectively. The samples were centrifugally concentrated at 5000 rpm and 4 °C, resuspended with PBS, sonicated and then centrifuged again, and the supernatant was taken as the sample. The highest yield was 13.5 mg / L when the glucose:NAM ratio was 2:1, which was increased by 36%, as shown in Figure 12 .

[0124] Optimization of fermentation temperature: The seed liquid was transferred into the fermentation medium at 1%, and cultured in a shaker at 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, and 200 rpm respectively. At OD 600 After induction with 1 mM IPTG concentration for 12 h when the value was 0.6, NAM with a final concentration of 2 g / L and glucose with a final concentration of 2 g / L were added. Sampling was carried out at 4 h, 6 h, 8 h, 10 h, and 12 h after feeding respectively. The samples were centrifugally concentrated at 5000 rpm and 4 °C, resuspended with PBS, sonicated and then centrifuged again, and the supernatant was taken as the sample. The highest yield was 12.5 mg / L at 30 °C, and the yield was increased by 25%, as shown in Figure 13 .

[0125] Optimization of fermentation pH: The seed liquid was transferred into the fermentation medium with pH values of 4, 5, 6, 6.5, 7, and 8 at 1%, and cultured in a shaker at 37 °C and 200 rpm. At OD 600 After induction with 1 mM IPTG concentration for 12 h when the value was 0.6, NAM with a final concentration of 2 g / L and glucose with a final concentration of 2 g / L were added. Sampling was carried out at 4 h, 6 h, 8 h, 10 h, and 12 h after feeding respectively. The samples were centrifugally concentrated at 5000 rpm and 4 °C, resuspended with PBS, sonicated and then centrifuged again, and the supernatant was taken as the sample. The highest yield was 12.5 mg / L at the optimal pH of 7, and the yield was increased by 25%, as shown in Figure 14 .

[0126] Example 5 was the single-factor optimization of fermentation conditions. The effects of fermentation duration, induction time, pH, temperature, feeding ratio, and inducer on the strain and yield during fermentation were studied to understand the subsequent optimization direction. Through the screening of mutation sites and single-factor optimization, a high-yield NMN original strain has been successfully constructed. After overexpression of other metabolic genes and knockout of side-reaction metabolic genes in the later stage, the yield will be increased and used in subsequent industrial production.

[0127] The above embodiments are merely examples given for clear illustration, and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or variations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or variations derived therefrom still fall within the protection scope of the present invention.

Claims

1. A nicotinamide phosphoribosyltransferase mutant, characterized in that, The lysine at position 259 of the nicotinamide phosphoribosyltransferase amino acid sequence shown in SEQ ID NO: 2 is mutated to valine.

2. A nicotinamide phosphoribosyltransferase mutant gene encoding the nicotinamide phosphoribosyltransferase mutant according to claim 1, characterized in that, The nucleotide sequence of the said gene is the nucleotide sequence described in a) or b) as follows: a) The nucleotide sequence is the gene sequence shown in SEQ ID NO: 5; b) The nucleotide sequence is the gene sequence shown in SEQ ID NO:

6.

3. A recombinant expression vector of nicotinamide phosphoribosyltransferase mutant, characterized in that, Comprising the nicotinamide phosphoribosyltransferase mutant gene as claimed in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The said recombinant expression vector is selected from at least one of pET series vectors, pUC series vectors, pCold series vectors, pSUMO series vectors, pDsRed series vectors, pBAD series vectors, pMAL series vectors, pACYC series vectors, pQE series vectors, pGEX series vectors, pPIC9K vector, pPICZ series vectors, pGAPZ series vectors, pFLD vector, pUB110 vector, pHT series vectors, pWB980 vector, pBE-S vector, pHY-Pgrac vector, pAX01 vector, pDG1730 vector.

5. An engineered bacterium comprising the recombinant expression vector as claimed in claim 3 or 4.

6. The engineered bacterium according to claim 5, wherein, The said engineered bacterium includes at least one of Pichia pastoris, Bacillus subtilis, Bacillus licheniformis, Escherichia coli.

7. A method for preparing β-nicotinamide mononucleotide, characterized in that, The Escherichia coli expression system is selected, and the preparation method comprises the following steps: Step 1: Transform the obtained recombinant expression vector of nicotinamide phosphoribosyltransferase mutant into Escherichia coli to obtain Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant gene as claimed in claim 2; Step 2: Oscillate and culture the Escherichia coli containing the nicotinamide phosphoribosyltransferase mutant gene as claimed in claim 2 in LB medium to obtain a seed solution; Step 3: Inoculate the seed solution into the fermentation medium, and culture it at 30 °C with shaking until the OD 600 value reaches 0.

8. Then add 0.75 mM IPTG for induction for 12 h, and then add NAM and glucose, and continue culturing with shaking; Step 4: Collect the supernatant for subsequent purification of β-nicotinamide mononucleotide.

8. The preparation method according to claim 7, characterized in that, The mass ratio of the said glucose to NAM is 2:

1.

9. Use of the nicotinamide phosphoribosyltransferase mutant as claimed in claim 1, the gene of the nicotinamide phosphoribosyltransferase mutant as claimed in claim 2, the recombinant expression vector of the nicotinamide phosphoribosyltransferase mutant as claimed in claim 3 or 4, and the engineered bacterium as claimed in claim 5 or 6 in the preparation of β-nicotinamide mononucleotide.

Images