Photoreceptor cell-specific bidirectional promoters and uses thereof

Abstract

The present invention relates to photoreceptor cell-specific bidirectional promoters and uses thereof. In particular, the present invention relates to a novel photoreceptor cell-specific bidirectional promoter, expression cassettes, vectors, viral particles, cells and pharmaceutical compositions comprising the bidirectional promoter, and uses thereof for treating eye diseases, such as retinal diseases.

Description

Technical Field

[0001] This invention relates to the fields of bioengineering and medicine. Specifically, this invention relates to a novel photoreceptor-specific bidirectional promoter, comprising an expression cassette, vector, viral particles, cells, and a pharmaceutical composition thereof, and its use in treating eye diseases, such as retinal diseases. Background Technology

[0002] Hereditary retinal diseases (IRDs) are among the most common genetic disorders in humans. They are a heterogeneous group of inherited diseases affecting the retina, causing visual impairment due to dysfunction and degeneration of photoreceptors, retinal pigment epithelium, or choroid, or vision loss due to maldevelopment, dysfunction, or premature death of retinal photoreceptor cells. Common forms of IRD include retinitis pigmentosa (RP), cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), macular dystrophy (MD), and achromatopsia (monochromatic rod cell disease). IRD is also one of the most genetically heterogeneous diseases in humans, with over 270 related genes identified to date. It can be inherited through autosomal recessive (AR), autosomal dominant (AD), or X-linked (XL) inheritance; mitochondrial and bigenic inheritance patterns have also been reported. The pathogenesis of IRD often involves apoptosis caused by mutations in the photoreceptor's own genes, or an imbalanced retinal microenvironment (such as neovascularization and death of retinal pigment epithelium cells) that exacerbates photoreceptor apoptosis.

[0003] The retina comprises various cell types, with the outer nuclear layer primarily composed of photoreceptor cells. Photoreceptor cells, also known as light sensor cells, are a special type of neuroepithelial cell located in the retina that converts light signals, enabling them to sense light or color. In mammals, photoreceptor cells include three types: rod cells, cone cells, and intrinsically photosensitive retinal ganglion cells.

[0004] Rod cells and cone cells have different functions. Rod cells are responsible for sensing light intensity and are primarily responsible for vision in dark environments or at night. Rod cells are extremely sensitive and can be triggered by a single photon. If rod cells are damaged, dark adaptation is reduced, making it difficult to see in low light. Cone cells have a high degree of resolution for bright light and color. Damage to cone cells can cause color weakness, which in severe cases can affect photopic vision and may even be accompanied by varying degrees of rod cell damage, further affecting dark vision.

[0005] Based on the pathogenesis of hereditary retinal diseases, current treatment strategies mainly focus on (1) overexpressing or editing related mutated genes to repair them and delay the degeneration of photoreceptor cells; (2) inhibiting angiogenesis to reduce damage to photoreceptor cells; and (3) having retinal cells express photosensitive proteins to perform photosensitive functions.

[0006] The strategy of restoring vision by utilizing the expression of photosensitizing proteins in retinal cells is currently the most popular approach. Photosensitizing proteins include endogenous photosensitizing proteins (such as opsin, rhodopsin, melanopsin, etc.) and exogenous photosensitizing proteins. Studies have found that expressing endogenous photosensitizing proteins, or their fusion with the metabolite glutamate receptor mGLUR, can restore partial vision in blind mice. Furthermore, the use of exogenous photosensitizing proteins, such as light-sensitive ion channel proteins (e.g., chr2, chrimsonR, MCO, etc.), has also achieved vision restoration in mice, and related products are already in clinical trials.

[0007] On the one hand, gene expression in retinal cells involves the use of promoters. A promoter is a cis-element that regulates gene expression, initiating the transcription process and effectively controlling the initiation, shutdown, and abundance of downstream gene expression, thereby producing the desired level of protein. Constitutive promoters have been reported for expressing target genes in retinal cells. Constitutive promoters can provide strong but tissue-free gene expression patterns in tissues. Constitutive eukaryotic promoters include those derived from the chicken β-actin (CBA) gene, phosphoglycerate kinase (PGK), or elongation factor 1α (EF1α). Other viral-derived constitutive promoters include those derived from cytomegalovirus (CMV) or synthetic promoter sequences such as CAG. However, it has been shown that the regulation of CMV promoters depends on numerous cellular signaling pathways capable of altering the expression of the introduced gene. Furthermore, because these promoters are not limited to a given cell type and induce expression in all cells to which they are delivered, such as the retinal pigment epithelium (RPE), the retina, and other ocular tissues outside the retina, such as the ciliary body, iris, cornea, etc., this can reduce the infection efficiency of the target retinal cells and create potential interference and risks.

[0008] To achieve specific expression of photosensitive proteins in retinal cells, especially photoreceptor cells, specific promoters capable of driving efficient expression of the target gene are needed; these are cell-specific promoters. Cell-specific promoters are important elements in gene regulation, possessing the ability to initiate gene expression in specific cell types, thereby enabling precise regulation of gene function in specific cell types. Therefore, they play a crucial role in maintaining cell and tissue specificity within an organism.

[0009] Cell-specific promoters can serve as an important resource for gene therapy applications. By designing gene expression vectors using cell-specific promoters, gene therapy and regulation targeting specific cell types can be achieved. Furthermore, the specificity of promoters can also be used in gene editing technologies to achieve precise editing and regulation of specific cell populations.

[0010] Currently, there are reports of obtaining gene expression restricted to retinal cells using tissue-specific promoters that induce expression in RPE or photoreceptor cells. Promoters such as those based on RPE65, VMD2, and OA1 induce gene expression in RPE cells, while promoters of human (RK) or bovine (RHO) rhodopsin kinase or mouse opsin (mOP) induce expression restricted to photoreceptor cells.

[0011] On the other hand, delivery systems to photoreceptor cells typically rely on viral infection, with adeno-associated virus (AAV) being the most widely used. AAV has garnered significant attention due to its safety profile, but its very small vector capacity can lead to a substantial drop in viral titer when carrying large functional proteins (such as Cas9) or simultaneously expressing two or more target genes or proteins, as the length exceeds the capacity. Obtaining promoters that are short but retain the ability to express downstream genes in specific tissues or cell types can address this issue to some extent. Such promoters can ensure specific expression of the target gene while reducing the AAV genome's capacity requirements, thus facilitating the carrying of larger or more target genes.

[0012] Promoters are classified into two types: unidirectional promoters and bidirectional promoters. Bidirectional promoters can drive the expression of downstream genes in the positive and negative strands, respectively. Compared with traditional unidirectional promoters, bidirectional promoters can not only achieve the expression of a single foreign gene but also the simultaneous expression of two foreign genes, making them more widely applicable in synthetic biology, genetic engineering, and other fields. Recent studies have shown that bidirectional promoters are widely present in eukaryotes and prokaryotes. Because bidirectional promoters can simultaneously drive the expression of downstream genes in two directions, they are very suitable for use in viral vectors with small loading capacity, such as AAV. Furthermore, the number of promoters currently available for bioengineering is limited. When transferring multiple genes into an organism simultaneously using the same type of promoter or promoters with similar sequences, it may cause a "co-suppression" phenomenon in gene expression, resulting in gene silencing. Bidirectional promoters, because one promoter can simultaneously achieve the expression of two foreign genes, can avoid this undesirable transgene silencing.

[0013] Nevertheless, there are currently no reports of bidirectional promoters, especially photoreceptor-specific bidirectional promoters, being used in photoreceptor-specific expression delivery systems.

[0014] Therefore, there is a strong demand for photoreceptor-specific bidirectional promoters in the field of retinal disease treatment. Such bidirectional promoters would facilitate the construction of highly efficient expression systems for photoreceptor delivery. Screening and identifying highly efficient photoreceptor-specific bidirectional promoters is of great significance for understanding the mechanisms of retinal cell fate determination, the occurrence and progression of related diseases, and especially for developing new treatments for retinal diseases. Summary of the Invention

[0015] To address the need in the field for photoreceptor-specific bidirectional promoters, the inventors of this invention obtained a novel photoreceptor-specific bidirectional promoter through artificial recombination, and identified its specificity and transcriptional activity, thus completing this invention. This novel photoreceptor-specific bidirectional promoter has significant application value in the fields of bioengineering and medicine, especially in the treatment of retinal diseases.

[0016] In one aspect of the invention, a bidirectional promoter is provided, which has photoreceptor-specific promoter activity. In one embodiment, the bidirectional promoter is capable of bidirectionally driving the expression of positive and negative strand downstream genes at high levels in photoreceptor cells.

[0017] In one embodiment, the bidirectional promoter comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0018] In one embodiment, the bidirectional promoter comprises a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0019] In one embodiment, the bidirectional promoter comprises a nucleotide sequence as shown in SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0020] In one embodiment, the bidirectional promoter consists of a nucleotide sequence having at least 70% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0021] In one embodiment, the bidirectional promoter consists of a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0022] In one embodiment, the bidirectional promoter consists of a nucleotide sequence as shown in SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0023] In another aspect of the invention, an expression box is provided that includes a bidirectional promoter according to the invention.

[0024] In one embodiment, the expression cassette further comprises a target nucleic acid operatively linked to a bidirectional promoter as described in this invention.

[0025] In one implementation, the target nucleic acid encodes a therapeutic protein, an optogenetic kinetic protein, or a reporter protein.

[0026] In one embodiment, the therapeutic protein may be selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, and ACO2, or may be a neurotrophic factor selected from GDNF, VEGF, CNTF, FGF2, BDNF, and EPO; an anti-apoptotic protein selected from BCL2 and BCL2L1; an anti-angiogenic factor selected from endostatin, angiostatin, and sFlt; an anti-inflammatory factor selected from IL10, IL1R1, TGFBI, and IL4; or a cone cell activating factor (RdCVF) derived from rod cells.

[0027] In one embodiment, the optogenetic driver protein can be an optogenetic activator, preferably selected from rhodopsin, photoopsin, melanopsin, pineal opsin, pineal paraopsin, VA opsin, periopsin, neuroopsin, brain opsin, retinal pigment, RGR opsin, microbial opsins with redshifted spectral properties (e.g., ReaChR, Chrimson, or ChrimsonR), vertebrate opsins that recruit Gi / o signal transduction (e.g., short-wavelength or long-wavelength vertebrate opsins), and so on. Channel rhodopsin (e.g., channel rhodopsin-1 and channel rhodopsin-2) from Chlamydomonas microalgae and variants thereof; or optogenetic inhibitors, preferably selected from halophilic rhodopsin (e.g., NpHR, eNpHR2.0, eNpHR3.0 and Halo57), archaeal rhodopsin (e.g., Arch and AR-3), bacterial rhodopsin (e.g., eBR, Proteobacterial rhodopsin and Xanthomonas rhodopsin), Micrococcus punctatus fungal opsin (Mac), Great White Shark Cross-Halophilic Rhodopsin, and variants thereof.

[0028] In one embodiment, the reporter protein may be selected from fluorescent proteins, calcium indicators, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants of the above proteins.

[0029] In one implementation, the target nucleic acid encodes the Cas9 protein.

[0030] In one embodiment, the target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozymes, and deoxyribozymes.

[0031] In another aspect of the invention, a carrier is provided comprising a bidirectional promoter or an expression cassette according to the invention.

[0032] In one implementation, the vector is a viral vector.

[0033] In one embodiment, the viral vector is an adeno-associated virus (AAV) vector, a retroviral vector, or a parvovirus vector.

[0034] In one embodiment, the viral vector is a Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV, or SNV vector, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, adeno-associated virus (AAV) vector, simian virus 40 (SV-40) vector, bovine papillomavirus vector, Epstein-Barr virus vector, herpesvirus vector, vaccinia virus vector, Harvey murine sarcoma virus vector, murine mammary tumor virus vector, ring virus vector, or Laure's sarcoma virus vector.

[0035] In another aspect of the invention, a viral particle is provided comprising the carrier described in the invention.

[0036] In one implementation, the carrier is an AAV carrier.

[0037] In one embodiment, the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. In a preferred embodiment, the AAV serotype is selected from AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8. In a more preferred embodiment, the AAV serotype is selected from AAV-2, AAV2-7m8, or AAV-8.

[0038] In another aspect of the invention, a cell is provided comprising a bidirectional promoter according to the invention, an expression cassette according to the invention, a vector according to the invention, or a viral particle according to the invention.

[0039] In one embodiment, the cell is a photoreceptor cell.

[0040] In one embodiment, the cell is a cone cell.

[0041] In one embodiment, the cell is a rod cell.

[0042] In one embodiment, the cells are retinal pigment epithelial cells (RPE).

[0043] In one embodiment, the cells are HEK293, HEK293T, BHK, or CHO cells.

[0044] In another aspect of the invention, a pharmaceutical composition is provided comprising a bidirectional promoter according to the invention, an expression cassette according to the invention, a vector according to the invention, viral particles according to the invention, or cells according to the invention, and a pharmaceutically acceptable excipient or carrier. The pharmaceutical composition is used to treat or prevent eye diseases, preferably for the treatment or prevention of retinal diseases, more preferably for the treatment or prevention of hereditary retinal diseases.

[0045] In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Lieber's congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0046] In another aspect of the invention, a method for treating or preventing eye diseases is provided, the method comprising administering a bidirectional promoter, an expression cassette, a vector, a viral particle, a cell, or a pharmaceutical composition according to the invention to a subject in need.

[0047] In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Lieber's congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0048] In one implementation, the method includes further administering one or more other therapies to the subject, such as administering one or more other therapeutic agents, gene therapy, immunotherapy, surgery, etc.

[0049] In another aspect of the invention, the use of the bidirectional promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition according to the invention is provided in the preparation of a medicament for treating or preventing eye diseases.

[0050] In one implementation, the eye disease is a hereditary retinal disease.

[0051] In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Lieber's congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0052] In another aspect of the invention, a method for expressing a target polypeptide or nucleic acid in a cell is provided, comprising introducing a bidirectional promoter according to the invention, an expression cassette according to the invention, a vector according to the invention, or a viral particle according to the invention into the cell.

[0053] In one embodiment, the cell is a photoreceptor cell.

[0054] In one embodiment, the cell is a cone cell.

[0055] In one embodiment, the cell is a rod cell.

[0056] In one embodiment, the cells are retinal pigment epithelial cells (RPE). Attached Figure Description

[0057] This application has generally described the subject matter of this disclosure, and the following drawings, which form part of this specification and are included to further illustrate certain aspects of the invention, will be better understood by referring to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein.

[0058] Figure 1 The plasmid map of vector VB211226-1096bhj is shown, which is used to verify the bidirectional driving activity of the CA10 promoter in downstream gene expression.

[0059] Figure 2 The results of immunofluorescence staining experiments following subretinal injection of the vectors pAAV[Exp]-{CA10}>NLS-EGFP:WPRE (containing the CA10 promoter) and pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE (containing the re_CA10 promoter) into mice are shown. Sections were photographed under a fluorescence microscope at three magnifications (40x / 100x / 200x) and corresponding exposure times (2000ms / 1000ms / 500ms), with three images shown from left to right at each magnification. The first image from the left shows the expression of green fluorescent protein driven by the promoter alone; the second image from the left is a composite image of cell expression fluorescence (green) and immunofluorescence staining (red, indicating cone cell surface proteins in the photoreceptor layer) (exposure times for each channel have been adjusted); the third image from the left is a composite image of cell expression fluorescence (green), immunofluorescence staining (red, indicating cone cell surface proteins in the photoreceptor layer), and DAPI staining (blue, indicating cell nuclei) (exposure times for each channel have been adjusted). CA and re_CA represent the CA10 promoter and the re_CA10 promoter, respectively.

[0060] Figure 3 The vector pAAV-SV40 late pA-NLS_mCherry was displayed. <ca10>The plasmid map of NLS_EGFP-BGH pA shows that the protein expression cassette of NLS_mCherry is inserted in reverse upstream of the CA10 promoter.

[0061] Figure 4 The vector pAAV-SV40 late pA-NLS_mCherry was displayed.<re_CA10> The plasmid map of NLS_EGFP-BGH pA shows that the protein expression cassette of NLS_mCherry is inserted in reverse upstream of the re_CA10 promoter.

[0062] Figure 5 This shows pAAV-SV40 late pA-NLS_mCherry <ca10>NLS_EGFP-BGH pA and pAAV-SV40 late pA-NLS_mCherry<re_CA10> The results of immunofluorescence staining experiments performed after subretinal injection of the NLS_EGFP-BGH pA vector in mice. Sections were photographed under a fluorescence microscope at two magnifications (100x / 200x) and corresponding exposure times (1000ms / 500ms). Three images are shown from left to right at each magnification. The first image from the left shows the expression of promoter-driven nuclear green fluorescent protein (NLS-EGFP) alone; the second image from the left shows the expression of promoter-driven nuclear red fluorescent protein (NLS_mCherry) alone; the third image from the left is a composite image of green fluorescence, red fluorescence, and DAPI staining (blue, indicating the nucleus) in cells (exposure times for each channel were adjusted). CA and re_CA represent the CA10 promoter and the re_CA10 promoter, respectively.

[0063] Figure 6 The plasmid map of the vector VB231203-1125phu, which contains the lacZ gene, is shown. The vector was used to verify the activity of the CA10 promoter in driving the expression of downstream large genes.

[0064] Figure 7 The results of immunofluorescence staining experiments following subretinal injection of the pAAV[Exp]-CA10>LacZ_HA vector into mice are shown. Sections were photographed under a fluorescence microscope at two magnifications (100x / 200x) and corresponding exposure times (500ms / 200ms), with two images shown from left to right at each magnification. The first image from the left shows the expression of promoter-driven lacZ and HA proteins individually (red fluorescence); the second image from the left is a composite image of red fluorescence and DAPI staining (blue, indicating the cell nucleus) of cellular expression (exposure times were adjusted for each channel). CA represents the CA10 promoter.

[0065] Figure 8 The results of immunofluorescence staining experiments validating the promoter activity of the variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 are shown. Sections were photographed under a fluorescence microscope at two magnifications (100x / 200x) and corresponding exposure times (1000ms / 500ms), with three images displayed from left to right at each magnification. The first image from the left shows the expression of promoter-driven nuclear fluorescent protein (NLS-EGFP) alone; the second image from the left shows the expression of promoter-driven nuclear fluorescent protein (NLS_mCherry) alone; and the third image from the left is a composite image of green fluorescence, red fluorescence, and DAPI staining (blue, indicating the nucleus) in cells (exposure times for each channel were adjusted). CA10V1, CA10V2, CA10V3, and CA10V4 represent the respective variant promoters. Detailed Implementation

[0066] The inventors have obtained a novel photoreceptor-specific bidirectional promoter through artificial recombination. This promoter possesses photoreceptor-specific promoter activity, for example, it can specifically and bidirectionally drive the expression of downstream genes in photoreceptor cells. This novel photoreceptor-specific bidirectional promoter can be applied in the field of retinal disease treatment, for example, by simultaneously regulating the expression of two different therapeutic proteins and / or therapeutic nucleic acids in photoreceptor cells, thereby treating retinal diseases.

[0067] definition

[0068] To facilitate understanding of this invention, certain terms are first defined. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments of the invention pertain. In describing and claiming protection for embodiments of the invention, the following terms are used preferentially according to their definitions set forth below.

[0069] In this invention, unless otherwise specifically stated, the use of the singular includes the plural, the term "a / an" means "at least one / an", and the term "or" means "and / or".

[0070] The terms "comprising" and "including" are generally interpreted as open-ended terms, intended to refer to all elements contemplated for the invention and in any possible combination thereof, covered or included in the text, paragraphs, claims, etc., in which the term is used, even if such elements or combinations are not expressly stated; and do not exclude any such one or more elements or combinations. "consisting of" and "substantially consisting of" are generally interpreted as closed-ended terms, indicating that only the elements specifically listed in conjunction with such terms, such as components, structures, steps, etc., are included. The text, paragraphs, claims, etc., of this application may therefore also relate to one or more embodiments in which the terms "comprising" and "including" are replaced by the terms "consisting of" and "substantially consisting of".

[0071] As used herein, the term "about" refers to any quantifiable variable, including but not limited to mass, volume, time, distance, and quantity, such as variations in numerical values ​​that may occur through typical measuring techniques and equipment. The term "about" also covers these variations, which can be as high as ±10%, but can also be ±9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, etc. For example, "about 100" includes all values ​​within the range of 100 plus or minus 10%. Whether or not modified by the term "about," the claims include quantity equivalents.

[0072] As used in this article, a "promoter" is a nucleotide sequence that allows RNA polymerase to bind and directs gene transcription. A promoter can regulate both the rate and efficiency of transcription of the nucleic acid to which it is operatively linked. Promoters can also be operatively linked to other regulatory elements of promoter-dependent transcription of nucleic acids that enhance ("enhancer") or repressor ("repressor") nucleic acids.

[0073] The term "bidirectional promoter" as used in this article refers to a DNA sequence located between two adjacent genes with opposite transcription directions that can simultaneously drive the transcription and expression of downstream structural genes on both the positive and negative strands (bidirectional transcription gene pairs, also known as "head-to-head" gene pairs). The distance between the transcription start sites of these two adjacent genes with opposite transcription directions is usually no more than 1 kb.

[0074] As used herein, the term "promoter activity" refers to the ability of a promoter to initiate transcription of a nucleic acid operatively linked to it. Promoter activity can be measured using procedures known in the art. For example, promoter activity can be measured by measuring the amount of mRNA transcribed using, for example, RNA blotting or polymerase chain reaction (PCR). Alternatively, promoter activity can be measured, for example, by protein blotting, ELISA, colorimetric assays, and various other activity assays, including reporter gene assays, as the amount of translated protein product.

[0075] As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other, and that the association between the elements allows them to perform their respective functions in the intended manner. For example, a promoter is operably linked to a coding sequence when it can influence the expression of that coding sequence, i.e., when the coding sequence is under the transcriptional control of the promoter.

[0076] As used herein, the term "nucleic acid" or "polynucleotide" refers to a polymer of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified non-natural or derived nucleotide bases. The backbone of the polynucleotide may contain sugar and phosphate groups (as is commonly found in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide may contain polymers of synthetic subunits such as aminophosphates, and thus may be oligodeoxynucleotide aminophosphates (P-NH2) or mixed aminophosphate-phosphodiester oligomers. The nucleic acids of the present invention can be prepared by any technique known to those skilled in the art, including chemical synthesis, recombination, and mutation. In a preferred embodiment, the nucleic acid of the present invention is a DNA molecule, which is preferably synthesized by recombination methods known to those skilled in the art.

[0077] As used herein, the terms "peptide" and "protein" are used interchangeably and refer to polymers of amino acid residues, and are not limited to a minimum length. These polymers of amino acid residues may contain native or non-native amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and polymers of amino acid residues. Both full-length proteins and fragments are covered by this definition. The term also includes post-translational modifications of peptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of this invention, "peptide" may refer to a protein comprising modifications to the parental sequence, such as deletions, additions, and substitutions, provided that the protein maintains the desired activity. These modifications may be carefully designed through site-directed mutagenesis or may be accidental, for example, by mutations in the host producing the protein or by errors caused by PCR amplification.

[0078] As used herein, the terms "variant" or "functional variant" are used interchangeably and refer to a nucleotide or amino acid sequence that differs from the original sequence but retains its essential properties and / or function. Generally, variants are closely similar to the original nucleotide or amino acid sequence overall and are completely identical in many regions. The sequence difference of a variant may lie in the substitution, deletion, or insertion of one or more nucleotides or amino acids in the sequence, which does not impair the activity of the sequence. Variants may have the same length as the original sequence, or they may be shorter or longer.

[0079] As used herein, the term "sequence identity" or "identity" refers to the percentage (%) of positional matches (identical nucleic acid residues) obtained from the alignment of two polynucleotide sequences. Sequence identity is determined by comparing the sequences while aligning them to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm that optimally aligns the sequences over their entire length (e.g., the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970), while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., the Smith and Waterman algorithm (Smith and Waterman, 1981) or the Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). The alignment for determining the percentage of nucleic acid sequence identity can be performed in various ways within the art, for example using publicly available computer software available on websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine suitable parameters for measuring the alignment, including any algorithm required to obtain the maximum alignment across the full length of the compared sequences. For the purposes of this invention, the percentage of nucleic acid sequence identity refers to the value generated using the pairwise sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to generate the optimal global alignment of two sequences, wherein all search parameters are set to default values, i.e., score matrix = BLOSUM62, gap opening penalty = 10, gap extension penalty = 0.5, terminal gap penalty = error, terminal gap opening penalty = 10, and terminal gap extension penalty = 0.5.

[0080] For the purposes of comparing sequence identity, the two polynucleotide sequences being aligned can contain any proportion of reverse complementary sequence segments without affecting the calculation of the percentage of sequence identity. For example, the two polynucleotide sequences can contain less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% reverse complementary sequence segments. The two polynucleotide sequences can contain 10%-90% reverse complementary sequence segments. The two polynucleotide sequences can contain 30%-70% reverse complementary sequence segments. The two polynucleotide sequences can contain 50%-60% reverse complementary sequence segments. The two polynucleotide sequences can contain 100% reverse complementary sequence segments, i.e., the two polynucleotide sequences are completely reverse complementary over the entire sequence. The reverse complementary sequence segments can be present at any position in the two polynucleotide sequences being aligned, for example starting from the 1st, 2nd, 3rd, 4th... or nth nucleotide and ending at the... m-4th, m-3rd, m-2nd, m-1st or mth nucleotide, where m is the length of the nucleotide sequences of the two polynucleotide sequences being aligned and n < m. One or more reverse complementary sequence segments can be present in the two polynucleotide sequences being aligned, for example 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 reverse complementary sequence segments. In one embodiment, 1-100 reverse complementary sequence segments are present in the two polynucleotide sequences being aligned. In a sequence identity alignment, the number of reverse complementary sequence segments is not restricted, and this application intends to include two aligned polynucleotide sequences containing any number of reverse complementary sequence segments. The reverse complementary sequence segments can be obtained by a dot plot-based sequence alignment algorithm, such as the publicly available computer software obtained from https: / / www.ebi.ac.uk / jdispatcher / emboss. Those skilled in the art will understand that the presence of reverse complementary sequence segments in the two polynucleotide sequences being aligned does not affect the calculation of the percentage of sequence identity, which means that when the two polynucleotide sequences are completely reverse complementary over the entire length, or when part of the sequences are reverse complementary and the other sequences are the same, the sequence identity is 100%.

[0081] As used herein, the terms "subject" and "patient" are used interchangeably and refer to an animal having a retina, preferably a mammal, such as including humans, monkeys, cows, horses, camels, pigs, goats, sheep, dogs, cats, rabbits, rats, mice, etc., more preferably a human, including adults, children and humans in the prenatal stage, and most preferably a human suffering from a retinal disease, such as a hereditary retinal disease.

[0082] As used herein, the term "treatment" refers to any action aimed at improving a patient's health condition, such as the reduction, prevention, limitation, safeguarding, or delay of a disease and its symptoms, including preventative and / or therapeutic treatments. Treatment is preventative (i.e., it protects the subject from developing an unwanted disease) if administered before the clinical onset of a condition (e.g., the subject's disease or other unwanted symptoms); treatment is therapeutic (i.e., it is intended to reduce, improve, or stabilize an existing unwanted disease or its symptoms) if administered after the onset of a condition.

[0083] For example, in some embodiments, the term refers to the improvement or eradication of a disease or disease-related symptoms. In other embodiments, the term refers to minimizing the spread or worsening of the disease by administering one or more therapeutic agents to a subject suffering from the disease. Specifically, the term "treatment of an eye disease" can refer to providing improved vision, preventing the disease from progressing to complete blindness, preventing the spread of damage to undamaged eye cells, improving damage in injured eye cells, preventing retinal damage, or rescuing an eye with mild or advanced disease. In some embodiments, the term refers to preventing, mitigating, or stopping retinal disease by providing a therapeutic protein that corrects a patient's genetic defects. In some other embodiments, the term refers to treatment using optogenetics to restore the retina or restore vision.

[0084] As used herein, the term "prevention" means preventing the occurrence of a disease, symptom, or condition. When used in connection with a medical condition such as an eye disease, for example, a retinal disease, it means that when the promoters, expression cassettes, vectors, viral particles, cells, and / or compositions of the present invention are administered to a subject in need, the frequency of the occurrence of symptoms of the medical condition (e.g., an eye disease or a retinal disease, especially a hereditary retinal disease) is reduced, the onset of symptoms is delayed, or the condition is completely eliminated in a subject who has not received said administration.

[0085] Photoreceptor-specific bidirectional promoter

[0086] In one aspect of the invention, a photoreceptor-specific bidirectional promoter is provided, which possesses photoreceptor-specific promoter activity. For example, the photoreceptor-specific bidirectional promoter can drive the expression of both positive and negative downstream genes at a high level in photoreceptor cells. Optionally, the photoreceptor-specific bidirectional promoter can also be used to drive the expression of downstream genes unidirectionally at a high level in photoreceptor cells. As used herein, the term "photoreceptor cell" refers to a special type of neuroepithelial cell located in the retina that has the function of converting light signals, typically including rod cells, cone cells, and intrinsically photosensitive retinal ganglion cells. The term also refers to photoreceptor precursor cells or progenitor cells that can differentiate into photoreceptor cells after transplantation into the subretinal space.

[0087] The photoreceptor-specific bidirectional promoter of the present invention can drive the expression of a target gene primarily in photoreceptor cells (e.g., cone cells and rod cells), preferably, the photoreceptor-specific bidirectional promoter can drive the expression of the target gene only in photoreceptor cells. The term "photoreceptor-specific" as used herein when referring to a promoter should be interpreted as having activity primarily in photoreceptor cells. It should be understood that generally low residual expression activity in other tissues or cells besides photoreceptor cells cannot be completely excluded. Preferably, the activity of the photoreceptor-specific bidirectional promoter in non-photoreceptor cells is less than 90% of its activity in photoreceptor cells, for example, less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In one embodiment, the activity of the photoreceptor-specific bidirectional promoter in non-photoreceptor cells is 1%-90%, 1%-80%, 1%-70%, 1%-60%, 1%-50%, 1%-40%, 1%-30%, 1%-20%, 1%-10%, 1%-9%, 1%-8%, 1%-7%, 1%-6%, 1%-5%, 1%-4%, 1%-3%, or 1%-2% of its activity in photoreceptor cells. In a preferred embodiment, the photoreceptor-specific bidirectional promoter is substantially inactive in non-photoreceptor cells. In a more preferred embodiment, the photoreceptor-specific bidirectional promoter is inactive in non-photoreceptor cells. In a preferred embodiment, the photoreceptor-specific promoter of the present invention is inactive in ganglia, bipolar, aprocessile-free, horizontal, Müller, and / or glial cells.

[0088] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0089] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0090] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a functional variant of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In one embodiment, the functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide sequences having substitutions, deletions, and / or insertions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or more nucleotides compared to the nucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 110, 120, 130, 140, 150, or more nucleotides.

[0091] In one embodiment, the functional variant is capable of hybridizing with the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or its complementary strand under low, medium or high stringency conditions.

[0092] The term "low stringency" as used in this article means that probes of at least 100 nucleotides in length are pre-hybridized and hybridized at 42°C in 5X SSPE, 0.3% SDS, 200 μg / mL cleaved and denatured salmon sperm DNA, and 25% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the vector material is washed three times with 2X SSC and 0.2% SDS at 50°C for 15 minutes each time.

[0093] The term "moderately stringent conditions" as used in this article means that probes of at least 100 nucleotides in length are pre-hybridized and hybridized at 42°C in 5X SSPE, 0.3% SDS, 200 μg / mL cleaved and denatured salmon sperm DNA, and 35% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the vector material is washed three times with 2X SSC and 0.2% SDS at 55°C for 15 minutes each time.

[0094] The term "highly stringent conditions" as used in this article refers to probes of at least 100 nucleotides in length that are pre-hybridized and hybridized at 42°C in 5X SSPE, 0.3% SDS, 200 μg / mL cleaved and denatured salmon sperm DNA, and 50% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the vector material is washed three times with 2X SSC and 0.2% SDS at 65°C for 15 minutes each time.

[0095] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a nucleotide sequence as shown in SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0096] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention consists of a nucleotide sequence having at least 70% sequence identity with SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0097] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

[0098] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention comprises a functional variant of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In one embodiment, the functional variant has substitutions, deletions, and / or insertions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 nucleotides compared to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In one embodiment, the functional variant is capable of hybridizing with the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or its complementary strand under low, moderate, or high stringency conditions.

[0099] In one embodiment, the photoreceptor-specific bidirectional promoter of the present invention consists of a nucleotide sequence as shown in SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0100] Expression Box

[0101] In another aspect of the invention, an expression cassette is provided, comprising the photoreceptor-specific bidirectional promoter of the present invention. As used herein, the term "expression cassette" refers to a nucleic acid construct comprising a coding sequence and one or more control sequences required for the expression of said coding sequence. In particular, one of these control sequences is the promoter of the present invention. Typically, the expression cassette comprises a coding sequence required for the expression of a selected gene product and regulatory sequences preceding (5' non-coding sequence) and following (3' non-coding sequence) said coding sequence. Thus, the expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' untranslated region typically containing a polyadenylation site and / or a transcription terminator. The expression cassette may also comprise other regulatory elements, such as enhancer sequences, multiple cloning site sequences facilitating the insertion of DNA fragments into a vector, and / or splicing signal sequences. The expression cassette is typically contained within a vector to facilitate cloning and transformation.

[0102] In one embodiment, the expression cassette further comprises a target nucleic acid operatively linked to the photoreceptor-specific bidirectional promoter of the present invention. In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide. The target polypeptide can be any polypeptide that needs to be expressed in photoreceptor cells. For example, the target polypeptide can be a therapeutic protein, an optogenetic kinetic protein, or a reporter protein. Preferably, the photoreceptor-specific bidirectional promoter of the present invention is operatively linked to two different target nucleic acids, thereby simultaneously driving the specific expression of the two different target nucleic acids in photoreceptor cells.

[0103] In one embodiment, the target nucleic acid is a therapeutic gene, i.e., a gene encoding a therapeutic protein. As used herein, the term "therapeutic gene" refers to a gene encoding a therapeutic protein useful in the treatment of a pathological condition. When expressed, the therapeutic gene provides a beneficial effect to the cells or tissues in which it is present or to a patient in whom the gene is expressed. Examples of beneficial effects include improvement or relief of signs or symptoms of a disease, symptom, or condition; prevention or suppression of a disease, symptom, or condition; or provision of a desired characteristic. Therapeutic genes include genes that partially or completely correct genetic defects in a patient. In particular, the therapeutic gene may be, but is not limited to, a nucleic acid sequence encoding a protein useful in gene therapy to alleviate defects caused by the absence, deficiency, or suboptimal level of said protein in the cells or tissues of a subject. The therapeutic peptide may, for example, provide peptide and / or enzyme activity that is absent, deficient, or present at suboptimal levels in photoreceptor cells, or provide indirect counteraction to unbalanced peptide and / or enzyme activity in photoreceptor cells. The therapeutic peptide may also be used to reduce peptide activity by, for example, acting as a dominant inactivating peptide. Preferably, the therapeutic polypeptide provides polypeptide and / or enzyme activity that is absent, defective, or present at suboptimal levels in photoreceptor cells, more preferably polypeptide and / or enzyme activity that is absent or defective in photoreceptor cells.

[0104] Examples of therapeutic genes include, but are not limited to, nucleic acids used to replace deleted or mutated genes known to cause retinal diseases, such as MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, and ACO2. These therapeutic genes may also encode neurotrophic factors such as GDNF, CNTF, FGF2, BDNF, and EPO; anti-apoptotic genes such as BCL2 and BCL2L1; anti-angiogenic factors such as endostatin, angiostatin, and sFlt; anti-inflammatory factors such as IL10, IL1R1, TGFBI, and IL4; or rod cell-derived cone cell activating factor (RdCVF). Preferably, the photoreceptor-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above-mentioned therapeutic genes in photoreceptor cells.

[0105] Additional signal peptides can be added to therapeutic proteins, specifically to allow them to be introduced into certain organelles (such as mitochondria), secreted from the cell, or inserted into the cell membrane.

[0106] In one embodiment, the target peptide is a tool enzyme used in the gene editing method. In one embodiment, the target peptide is a tool enzyme in the CRISPR / Cas system, such as the Cas9 protein.

[0107] In one embodiment, the target polypeptide is an optogenetic kinase. As used herein, the term "opogenetic kinase" refers to a photochemically reactive polypeptide that uses vitamin A or its isoforms as a chromophore. An optogenetic kinase is a light-gated ion pump or channel that absorbs and is activated by light. The optogenetic kinase can be derived from prokaryotes or eukaryotes. In particular, it can be a microbial opsin or a vertebrate opsin. The optogenetic kinase can be an optogenetic activator or an optogenetic inhibitor.

[0108] Optogenetic activators cause cells to depolarize upon exposure to light. When cells depolarize, the internal negative charge of the cell briefly becomes positive. This shift from negative to positive in the cellular environment allows for the transfer of electrical impulses both within the cell and optionally between cells. Examples of optogenetic activators include, but are not limited to, rhodopsin, photoopsin, melanopsin, pineal opsin, pineal paraopsin, VA opsin, periopsin, neuroopsin, brain opsin, retinal pigment, RGR opsin, microbial opsins with redshifted spectral properties (e.g., ReaChR, Chrimson, or ChrimsonR), vertebrate opsins that recruit Gi / o signaling (e.g., short-wavelength or long-wavelength vertebrate opsins), channel rhodopsin from Chlamydomonas microalgae (e.g., channel rhodopsin-1 and channel rhodopsin-2, from Chlamydomonas reinhardtii), and variants of the above proteins. Numerous variants of channel rhodopsin (e.g., codon-optimized variants, mutants, chimeras) are continuously generated to improve certain characteristics of these proteins. Examples of these variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), and hCatch(T). 159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C) and SwitChR (see Prakash et al., NatMethods. 2012 Dec; 9(12):1171-9 for a review).

[0109] Optogenetic inhibitors induce cellular hyperpolarization upon light exposure. During hyperpolarization, the internal negative charge of the cell becomes more negative for a short period. This shift to a more negative charge inhibits action potentials by increasing the stimulus required to shift the membrane electrical displacement towards the action potential threshold. In a particular embodiment, the optogenetic inhibitor is a light-gated ion pump that transports chloride ions inward and / or cations outward upon absorption of photons. Any suitable light-gated, retina-dependent ion pump that transports chloride ions inward or cations outward upon absorption of photons can be used as an optogenetic inhibitor. Examples of optogenetic inhibitors include, but are not limited to, halophilic rhodopsin such as halophilic rhodopsin (NpHR), enhanced halophilic rhodopsin (eNpHR2.0 and eNpHR3.0) and redshifted halophilic rhodopsin Halo57, archaeal rhodopsin-3 (AR-3), archaeal rhodopsin (Arch), bacterial rhodopsin such as enhanced bacterial rhodopsin (eBR), Proteobacterium rhodopsin, Xanthomonas rhodopsin, Micrococcus punctatus fungal opsin (Mac), Great White Shark cross-halophilic rhodopsin, and variants of the above proteins.

[0110] In a particularly preferred embodiment, the optogenetic kinesin is an optogenetic activator, preferably selected from channel rhodopsin, Chrimson R, and variants thereof.

[0111] Preferably, the photoreceptor-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two or more of the above-mentioned optogenetic kinetic proteins in photoreceptor cells.

[0112] In one embodiment, the target polypeptide is a reporter protein. Preferably, the reporter protein is detectable in living photoreceptor cells. Expression of the reporter protein under the control of the promoter of the present invention allows for the specific detection or recognition of photoreceptor cells. The reporter protein may be a fluorescent protein (e.g., green fluorescent protein GFP including EGFP, red fluorescent protein RFP, yellow fluorescent protein YFP, blue fluorescent protein BFP, cyan fluorescent protein CFP, etc.), a calcium indicator (such as GCamP), luciferase, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants thereof. In a particular embodiment, the reporter protein is selected from fluorescent proteins, calcium indicators, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants thereof. Preferably, the photoreceptor-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above-mentioned reporter proteins in photoreceptor cells.

[0113] In one embodiment, the target nucleic acid encodes any nucleic acid to be expressed, such as any target nucleic acid to be expressed in photoreceptor cells. Specifically, the nucleic acid to be expressed can be a therapeutic nucleic acid. In one embodiment, the therapeutic nucleic acid is selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, sgRNA, ribozymes, and deoxyribozymes (DNAzymes). In a particular embodiment, when the target nucleic acid is transcribed by the promoter of the present invention, it can treat or prevent eye diseases by interfering with the translation or transcription of abnormal or excessive proteins associated with eye diseases. For example, the RNA encoded by the target nucleic acid can highly specifically eliminate mRNA encoding abnormal and / or excessive proteins or reduce their expression levels, thereby achieving the purpose of treating eye diseases. Preferably, the photoreceptor-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above-mentioned therapeutic nucleic acids in photoreceptor cells.

[0114] carrier

[0115] In another aspect of the invention, a vector is provided comprising the photoreceptor-specific bidirectional promoter of the invention or the expression cassette of the invention. As used herein, the term "vector" refers to a nucleic acid molecule used as a medium for transferring genetic material, particularly delivering nucleic acids into host cells, in vitro or in vivo. Vectors include, but are not limited to, plasmids, phage particles, granules, transposable elements, viruses, and artificial chromosomes (e.g., YAC). Preferably, the vector of the invention is suitable for gene or cell therapy, particularly for targeting the eye, such as photoreceptor cells.

[0116] In one embodiment, the vector is a viral vector. As used herein, the term "viral vector" refers to a virus-based composition capable of acting as a carrier for delivering target nucleic acid molecules, such as heterologous nucleic acids, into cells. A viral vector can deliver heterologous nucleic acids into a recipient body, with or without insertion into the recipient's genomic nucleic acid. In one embodiment, the viral vector is a virus in which the viral genome has been manipulated to accommodate nucleic acid sequences that are non-natural relative to the viral genome. Viral vectors can be generated by introducing one or more mutations into the viral genome of a virus, thereby accommodating non-natural nucleic acid sequences inserted into the virus. Typically, a payload targeting the target nucleic acid molecule can be provided by modifying the viral genome, deleting non-essential sequences, and making it contain only the minimum components required to assemble a functional recombinant virus or viral particle. Viral vectors include any elements required to establish expression of the target polypeptide in the host cell, such as promoters, ITRs, ribosome-binding elements, terminators, enhancers, selection markers, introns, polyA signals, and / or origins of replication.

[0117] In one embodiment, the viral vector is, for example, a vector derived from Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV, or SNV; a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), or equine infectious anemia virus (EIAV)); an adenovirus (Ad) vector; an adeno-associated virus (AAV) vector; simian virus 40 (SV-40) vector; bovine papillomavirus vector; Epstein-Barr virus vector; herpesvirus vector; vaccinia virus vector; Harvey murine sarcoma virus vector; murine mammary tumor virus vector; ring virus vector; or Lauer's sarcoma virus vector. In a particular embodiment, the vector is a retroviral vector, preferably a lentiviral vector, or a nonpathogenic parvovirus vector. As is known in the art, depending on the specific viral vector to be used, a suitable sequence should be introduced into the vector of the present invention to obtain a functional viral vector, such as an AAV terminal inverted repeat (ITR) for an AAV vector or a long terminal repeat (LTR) for a lentiviral vector.

[0118] In a preferred embodiment, the vector is an adeno-associated virus (AAV) vector. Human parvovirus adeno-associated virus (AAV) is a replication-dependent virus with a natural defect regarding replication, enabling it to integrate into the genome of an infected cell to establish latent infection. This last property appears to be unique among mammalian viruses because the integration occurs at a specific site on chromosome 19 in the human genome, known as AAV S1 (19q13.3-qter). Therefore, AAV has attracted considerable interest as a potential vector for human gene therapy. The advantageous properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and its capacity to infect a wide range of cell lines derived from different tissues.

[0119] As used herein, the term "AAV vector" refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not of AAV origin) flanked by at least one AAV terminal inverted repeat (ITR), preferably two ITRs. Such an AAV vector, when present in a host cell infected with a suitable helper virus (or a virus expressing suitable helper virus function) and expressing the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins), can be replicated and packaged into infectious viral particles. The term "terminal inverted repeat" or "ITR" is well-known in the art and refers to a relatively short, oppositely oriented sequence located at the ends of a viral genome. An "AAV terminal inverted repeat (ITR)" sequence is a sequence of approximately 145 nucleotides located at both ends of a native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two optional orientations, causing heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (referred to as A, A', B, B', C, C, and D regions) that allow intra-chain base pairing within this portion of the ITR. The AAV ITR used in the vector of this invention can have a wild-type nucleotide sequence or can be altered by insertion, deletion, or substitution. The serotype of the terminal inverted repeat (ITR) of the AAV vector can be selected from any known human or non-human AAV serotype. The promoter or expression cassette of this invention can be introduced into the vector by any method known to those skilled in the art.

[0120] The vector may also contain one or more nucleic acid sequences encoding selectable markers such as auxotrophic markers (e.g., LEU2, URA3, TRP1, or HIS3), detectable tags such as fluorescent or luminescent proteins (e.g., GFP, eGFP, DsRed, CFP), or proteins that provide resistance to chemical / toxic compounds (e.g., the MGMT gene providing resistance to temozolomide). These markers can be used to select or detect host cells containing the vector and can be easily selected by a skilled technician based on the host cells.

[0121] Virus particles

[0122] In another aspect of the invention, a viral particle is provided that includes the carrier of the invention.

[0123] In one embodiment, the vector is an AAV vector and is packaged in an AAV-derived capsid to produce adeno-associated virus (AAV) particles or AAV particles. Therefore, the term "adeno-associated virus particle / AAV particle" as used herein refers to a viral particle consisting of at least one AAV capsid protein and a capsidated AAV vector genome. AAV viruses are typically classified and designated according to their serotypes. A "serotype" corresponds to a variant subspecies of AAV, possessing unique reactivity through the expression profile of its capsid surface antigens, which can be used to distinguish it from other variant subspecies. AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. Furthermore, non-naturally engineered variants and chimeric AAVs can also be useful. In particular, the capsid protein can be a variant containing one or more amino acid substitutions that enhance transduction efficiency. In one embodiment, the capsid is preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8 serotype capsids, more preferably from AAV-2-derived capsids such as AAV-2 or AAV2-7m8 capsids.

[0124] Different AAV serotypes are used to optimize transduction of specific target cells or to target specific cell types (e.g., photoreceptor cells) within specific target tissues. AAV particles may contain viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variant of AAV. For example, the AAV particles may contain the AAV2 capsid protein and at least one, preferably two, AAV2 ITRs. Any combination of AAV serotypes for producing AAV particles is provided herein. AAV viruses can be engineered using conventional molecular biology techniques to optimize these particles for cell-specific delivery of nucleic acid sequences, minimization of immunogenicity, regulation of stability and particle lifespan, efficient degradation, and accurate delivery to the cell nucleus.

[0125] In this field, numerous methods are known for the production of viral particles, particularly AAV particles, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) Virology 71(11):8780-8789) and baculovirus-AAV hybrids. AAV production cultures for producing AAV viral particles require: 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293T cells, or, in the case of baculovirus production systems, insect-derived cell lines such as SF-9; 2) suitable helper viral functions provided by wild-type or mutant adenoviruses (e.g., temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs that provide helper viral functions; 3) AAV rep and cap genes and gene products; 4) target nucleic acids side-linked with at least one AAV ITR sequence, such as the vector of the present invention; and 5) suitable culture media and culture media components known in the art for supporting AAV production.

[0126] In this invention, the host cells used for producing AAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can be a packaging cell in which the AAV rep and cap genes are stably maintained, or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293T, A549, or HeLa cells. The AAV particles are then purified and formulated using standard techniques known in the art.

[0127] cell

[0128] In another aspect of the invention, a cell is provided comprising, or having been transformed with, the photoreceptor-specific bidirectional promoter, expression cassette, vector, or viral particle of the present invention. The cell can be any cell, including animal cells, plant cells, bacterial cells, or yeast cells. Preferably, the cell is a mammalian cell or insect cell. More preferably, the cell is a mammalian cell, such as cells of humans, monkeys, cattle, horses, camels, pigs, goats, sheep, dogs, cats, rabbits, rats, or mice. Most preferably, the cell is a human cell.

[0129] In one embodiment, the cell is a photoreceptor cell. In one embodiment, the cell is a cone cell. In one embodiment, the cell is a rod cell. In one embodiment, the cell is a retinal pigment epithelial (RPE) cell. In one embodiment, the cell is a HEK293, HEK293T, BHK, or CHO cell.

[0130] The promoters, expression cassettes, vectors, or viral particles of the present invention can be transferred into cells using any technique known in the art. These techniques include, but are not limited to, calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipid transfection, or viral infection. Furthermore, the promoters, expression cassettes, vectors, or viral particles of the present invention can be maintained ectopically in the host cells or integrated into the genome. In a preferred embodiment, the promoters, expression cassettes, vectors, or viral particles of the present invention are delivered into host cells via viral infection. Preferably, the viral particles of the present invention are used, and more preferably, the AAV particles of the present invention are used.

[0131] Pharmaceutical Composition

[0132] In another aspect of the invention, a pharmaceutical composition is provided comprising the photoreceptor-specific bidirectional promoter, expression cassette, vector, viral particles, or cells of the present invention, and a pharmaceutically acceptable excipient or carrier. The pharmaceutical composition is used to treat or prevent eye diseases, preferably to treat or prevent retinal diseases, more preferably to treat or prevent hereditary retinal diseases.

[0133] As used herein, the term "pharmaceutical composition" refers to a formulation comprising an active compound or ingredient, namely the promoter, expression cassette, vector, viral particle, or cell of the present invention, for the prevention, maintenance, or treatment of a tissue state or disease in a subject.

[0134] As used herein, the term "pharmaceutically acceptable" means that the drug or reagent is approved by a national regulatory agency (e.g., the National Medical Products Administration (NMPA) or the U.S. Food and Drug Administration (FDA)) or listed in a recognized pharmacopoeia (e.g., the Pharmacopoeia of the People's Republic of China or the United States Pharmacopoeia) for use in animals, such as mammals, and particularly humans. The term "excipient" refers to a natural or synthetic substance that adheres to and enhances the action of the active pharmaceutical ingredient in a drug. The excipient is harmless to the subject at concentrations consistent with the effective activity of the active pharmaceutical ingredient. Excipients include, for example, buffers, disintegrants, binders, lubricants, fillers, plasticizers, surfactants, wetting agents, film-forming agents, coating materials, and colorants, etc. The term "carrier" refers to a substance capable of delivering the active pharmaceutical ingredient to a desired compartment in the subject, such as a specific cell type (e.g., retinal cells, preferably photoreceptor cells), and which, upon administration via a selected route and regimen, can be used to provide and control the release of the drug. In this application, "pharmaceutically acceptable excipient" and "pharmaceutical acceptable carrier" may be used interchangeably.

[0135] Generally, pharmaceutically acceptable excipients / carriers are relatively inert substances that facilitate the administration of the active pharmaceutical ingredient and can be provided as liquid solutions or suspensions, emulsions, or solid forms suitable for dissolving or suspending in a liquid prior to use. For example, excipients / carriers can provide shape or consistency, or act as diluents. Suitable excipients / carriers include, but are not limited to, stabilizers, wetting and emulsifiers, salts for altering osmotic pressure, encapsulating agents, pH buffers, and buffers. Suitable excipients / carriers include any pharmaceutical preparation suitable for direct delivery to the eye, which can be administered without excessive toxicity. Pharmaceutically acceptable excipients / carriers include, but are not limited to, water, petroleum, animal or vegetable oils, mineral oil, synthetic oil, sorbitol, Tween compounds, glycerin, physiological saline solutions, magnesium chloride solutions, dextran or other sugar solutions, various alcohols such as glycols like ethylene glycol, propylene glycol or polyethylene glycol, and ethanol. Pharmaceutically acceptable excipients / carriers may also include pharmaceutically acceptable salts, such as inorganic acid salts like hydrochlorides, hydrobromides, phosphates, sulfates, etc., and salts of organic acids such as acetates, propionates, malonates, benzoates, etc. A full discussion of pharmaceutically acceptable excipients / carriers can be found, for example, in Remington's Pharmaceutical Sciences, 15th edition. The selection and precise properties of pharmaceutically acceptable excipients / carriers can be determined by those skilled in the art based on the specific route of administration.

[0136] Preferably, the pharmaceutical compositions of the present invention are formulated for administration to the eye, for example, intraocular, intravitreal, or subretinal, particularly by direct retinal, subretinal, and / or intravitreal injection. For ocular delivery, the pharmaceutical compositions are preferably in the form of an aqueous solution that is pyrogen-free and has suitable pH, isotonicity, and stability. Those skilled in the art can prepare suitable aqueous solutions using, for example, isotonic carriers such as sodium chloride solution, Ringer's solution, lactated Ringer's solution, Hartmann solution, etc. If desired, the pharmaceutical compositions of the present invention may also contain preservatives, stabilizers, buffers, antioxidants, and / or other additives. The active pharmaceutical ingredient may also be formulated in a formulation for slow release to achieve delayed release, or contained in microcapsules formed of biocompatible polymers or in liposome carrier systems.

[0137] The pharmaceutical compositions of the present invention can be packaged in single doses or multiple doses, or in the form of a cassette. The specific dosage and dosage regimen of the pharmaceutical compositions of the present invention can be adjusted and determined by a physician based on the purpose of use, the type and severity of the disease to be treated, the age, sex, weight, health status, tolerance, and route of administration of the subject.

[0138] In one embodiment, the pharmaceutical composition of the present invention comprises the cells of the present invention, preferably human cells, i.e., cells transformed or transfected with the expression cassette, vector, or viral particles of the present invention, preferably with AAV particles. Optionally, the cell-containing composition can be cryopreserved at any temperature suitable for cell storage. For example, the cells can be frozen at about -20°C, -80°C, or any other suitable temperature. Cryopreserved cells can be stored in suitable containers and prepared for storage to reduce the risk of cell damage and maximize the likelihood of cell survival upon thawing. Alternatively, the cells can also be maintained at refrigerated room temperature, such as about 4°C.

[0139] In one embodiment, the pharmaceutical composition of the present invention comprises the viral particles of the present invention, and each unit dose contains 10 8 Up to 10 13 10 virus particles, preferably 10 9 Up to 10 12 One, more preferably 10 10 Up to 10 11 A virus particle.

[0140] In one embodiment, the pharmaceutical composition of the present invention may further comprise one or more other active compounds such as corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors, or any combination thereof.

[0141] The pharmaceutical compositions of the present invention can also be used in combination with one or more other therapies for the treatment or prevention of eye diseases, preferably retinal diseases, more preferably hereditary retinal diseases. In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturgeon's disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0142] Treatment

[0143] In another aspect of the invention, a method for treating or preventing an eye disease is provided, the method comprising administering a photoreceptor-specific bidirectional promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the invention to a subject in need, preferably to the eye of the subject. In one embodiment, the photoreceptor-specific bidirectional promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the invention is administered to a subject in need, for example, in an eye, at a therapeutically or preventively effective amount.

[0144] As used herein, "therapeutic or preventative effective amount" means the amount by which the promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the present invention, when administered to a subject, achieves a desired therapeutic or preventative effect, such as reducing, preventing, halting, slowing, or eliminating the progression of physical changes associated with or resulting from an eye disease (e.g., retinal disease). "Therapeutic or preventative effective amount" generally varies depending on the subject's sex, age, general condition, administration method, etc., and can be determined by those skilled in the art using conventional experimental methods. In one embodiment, the subject is a mammal, preferably a human.

[0145] In one embodiment, the eye disease is a retinal disease. In one embodiment, the eye disease is a hereditary retinal disease (IRD). In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0146] In one embodiment, the treatment method of the present invention includes administering the promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the present invention to the eye of a subject, such as intraocularly, intraocularly, intravitreally, or subretinally.

[0147] In one embodiment, the treatment method of the present invention further includes administering one or more other therapies to the subject, including administering one or more other therapeutic agents, gene therapy, immunotherapy, surgery, etc. For example, the therapeutic agent may be selected from corticosteroids, antibiotics, analgesics, immunosuppressants, or nutritional factors, or any combination thereof.

[0148] In one embodiment, the promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the present invention may be administered before or after the onset of symptoms of the eye disease, such as before or after partial or complete photoreceptor cell degeneration, and / or before or after partial or complete loss of vision.

[0149] Pharmaceutical Uses

[0150] In another aspect of the invention, the use of the photoreceptor-specific bidirectional promoter, expression cassette, vector, viral particle, cell, or pharmaceutical composition of the invention in the preparation of a medicament for the treatment or prevention of eye diseases is provided.

[0151] In one embodiment, the eye disease is a retinal disease. In one embodiment, the eye disease is a hereditary retinal disease (IRD). In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0152] Methods of expression

[0153] In another aspect of the invention, a method for expressing a target polypeptide or nucleic acid in cells is provided, comprising introducing a photoreceptor-specific bidirectional promoter, expression cassette, vector, or viral particle of the invention into the target cell. In one embodiment, the cell is a photoreceptor cell. In one embodiment, the cell is a cone cell. In one embodiment, the cell is a rod cell. In one embodiment, the cell is a retinal pigment epithelial (RPE) cell.

[0154] The technical solutions claimed in this invention can be implemented using the specific description and sequence of this application, combined with techniques known to those skilled in the art. Such techniques include, for example, conventional cloning techniques in molecular biology and various experimental techniques commonly used in biochemistry (such as those described in textbooks), as well as any suitable methods.

[0155] The invention is further described below with reference to non-limiting embodiments.

[0156] Example

[0157] Example 1: Expression vector construction and promoter activity verification (mice)

[0158] A photoreceptor-specific bidirectional promoter sequence was obtained through artificial recombination and named the CA10 promoter (SEQ ID NO:1). To verify that the CA10 promoter is a promoter capable of bidirectionally driving downstream gene expression, a plasmid map was constructed using the VB211226-1096bhj vector (internal construction, see https: / / en.vectorbuilder.com / vector / VB211226-1096bhj.html, plasmid map as shown below). Figure 1 As shown, two expression vectors were constructed. Using conventional restriction enzyme digestion and ligation methods, the CAG promoter in the VB211226-1096bhj vector was replaced with the CA10 promoter to construct the expression vector pAAV[Exp]-{CA10}>NLS-EGFP:WPRE, with the CA10 promoter upstream and the nuclear green fluorescent protein (NLS-EGFP) gene downstream. Similarly, the CAG promoter in the VB211226-1096bhj vector was replaced with the reverse complementary sequence of the CA10 promoter (re_CA10, SEQ ID NO:6), constructing the expression vector pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE, with the re_CA10 promoter upstream and the nuclear green fluorescent protein (NLS-EGFP) gene downstream.

[0159] Following standard virus packaging methods, the expression vectors containing CA10 and re_CA10 promoters were mixed with the other two helper vector plasmids (carrying Rep / Capsid genes and E2 / E4 / VA genes, respectively) and transfected into 293T cells for virus packaging. After harvesting the virus, it was purified with cesium chloride to finally obtain virus particles (AAV8 type) for in vivo animal validation experiments.

[0160] Mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral dose of 1E+10GC / eye. Two weeks after injection, tissue samples were collected for sectioning and immunofluorescence staining. The primary antibody used in the immunofluorescence process was rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which specifically binds to surface proteins of cone cells in the photoreceptor (PR) layer, thereby effectively distinguishing between cone and rod cells. The secondary antibody used was goat anti-rabbit IgG with red fluorescence (purchased from Thermofisher, catalog number A-11012). Simultaneously, DAPI was used to stain the nuclei of cells in each layer; DAPI imaging showed a blue color.

[0161] The slices were photographed to obtain expression slice images of the CA10 and re_CA10 promoters, as shown below. Figure 2 As shown.

[0162] from Figure 2 It can be seen that green fluorescence only appears in photoreceptor cells, proving that placing the CA10 promoter upstream of the fluorescent protein's open reading frame, whether forward or reversed, can drive the expression of downstream proteins, and the expression intensity is very strong. Overall, the CA10 promoter is expressed only in photoreceptor cells, with no expression in other cells, demonstrating very high photoreceptor cell specificity.

[0163] Example 2: Verification of bidirectional promoter expression activity (mice)

[0164] Based on the expression vectors pAAV[Exp]-{CA10}>NLS-EGFP:WPRE and pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE described in Example 1, an NLS_mCherry protein expression cassette was inserted retrogradely upstream of the CA10 and re_CA10 promoters in both vectors using conventional enzyme digestion and ligation methods, respectively, to construct the corresponding expression vectors pAAV-SV40late and pA-NLS_mCherry. <ca10>NLS_EGFP-BGH pA and expression vector pAAV-SV40 late pA-NLS_mCherry<re_CA10> NLS_EGFP-BGH pA was used to observe the expression of both fluorescent expression cassettes simultaneously driven by the CA10 and re_CA10 promoters. The vector pAAV-SV40 late pA-NLS_mCherry <ca10>NLS_EGFP-BGH pA and vector pAAV-SV40 late pA-NLS_mCherry<re_CA10> The vector frames of NLS_EGFP-BGH pA are as follows: Figure 3 and Figure 4 As shown.

[0165] Virus packaging was performed using the same method as in Example 1 to obtain high-purity virus particles (AAV8 type).

[0166] Mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral injection dose of 1E+9GC / eye. One month after injection, tissue samples were collected and sectioned. The expression of red fluorescent protein and green fluorescent protein was observed using different channels of a fluorescence microscope. At the same time, the cell nuclei of each cell layer were stained with DAPI, and the DAPI image was blue.

[0167] The slices were photographed to obtain bidirectional expression slice images of the CA10 and re_CA10 promoters, as shown below. Figure 5 As shown.

[0168] from Figure 5 It can be seen that the CA10 promoter can efficiently drive the expression of fluorescent proteins downstream of both the positive and negative strands simultaneously, and the expression of fluorescent proteins is limited to photoreceptor cells, exhibiting high photoreceptor specificity. Under the same experimental comparison conditions, the expression intensity of the downstream genes driven by the CA10 promoter on both sides is basically the same.

[0169] Example 3: Promoter Activity Verification (Large Gene)

[0170] Because the expression cassette of fluorescent proteins is relatively short, it may differ from that of large genes. Therefore, the lacZ gene was used as a replacement gene for the large gene for experimental verification. Based on the VB231203-1125phu vector (internal construction, see https: / / en.vectorbuilder.com / vector / VB231203-1125phu.html), as shown... Figure 6 As shown, the CBh promoter was replaced with the CA10 promoter using conventional enzyme digestion and ligation methods to construct the expression vector pAAV[Exp]-CA10>LacZ_HA, which has the CA10 promoter upstream and the lacZ gene with the tag protein HA downstream.

[0171] Virus packaging was performed using the same method as in Example 1 to obtain high-purity virus particles (AAV8 type).

[0172] Mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral dose of 8E+9GC / eye. One month after injection, tissue samples were collected for sectioning and immunofluorescence staining. The primary antibody used in the immunofluorescence process was an anti-HA tag antibody (purchased from Thermofisher, catalog number 14-6756-81), which specifically binds to the HA tag protein, indirectly confirming whether the lacZ gene is transcribed and translated normally. The secondary antibody used was goat anti-rabbit IgG with red fluorescence (purchased from Thermofisher, catalog number A-11012). Simultaneously, DAPI was used to stain the nuclei of cells in each cell layer; DAPI imaging showed a blue color.

[0173] The slides were photographed to obtain slide images of large genes expressing the CA10 promoter, as shown below. Figure 7 As shown.

[0174] from Figure 7 It can be seen that the CA10 promoter can normally drive the expression of the lacZ gene and HA-tagged protein in photoreceptor cells, demonstrating that the CA10 promoter has the ability to express large genes. Therefore, this promoter can be used to specifically express functional therapeutic proteins in photoreceptor cells.

[0175] Example 4: Construction and activity verification of functional variants of the CA10 promoter

[0176] After confirming the bidirectional expression specificity of the CA10 promoter, a series of CA10 variant promoters were constructed by random mutations and deletions / replacements, including CA10V1 (SEQ ID NO:2), CA10V2 (SEQ ID NO:3), CA10V3 (SEQ ID NO:4), and CA10V4 (SEQ ID NO:5). The sequence identity between the variant promoters and the CA10 promoters is shown in the table below:

[0177] CA10 CA10V1 CA10V2 CA10V3 CA10V4 CA10 100％ - - - - CA10V1 82.57％ 100％ - - - CA10V2 96.54％ 79.14％ 100％ - - CA10V3 91.07％ 74.06％ 87.93％ 100％ - CA10V4 90.37％ 75.60％ 87.01％ 84.75％ 100％

[0178] Following the method described in Example 2, a series of expression vectors were constructed, consisting of the variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 in the middle, the nuclear red fluorescent protein (NLS-mCherry) gene upstream, and the nuclear green fluorescent protein (NLS-EGFP) gene downstream. These vectors were then virally packaged and purified, and promoter activity was verified in mice. Finally, expression slices of the promoters were obtained, as shown in the figure. Figure 8 As shown.

[0179] from Figure 8 It can be seen that all variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 can bidirectionally drive the expression of downstream genes of both the positive and negative strands at high levels in photoreceptor cells, with slightly different expression intensities, while maintaining the photoreceptor-specific expression characteristics. Therefore, a series of photoreceptor-specific bidirectional promoters with different expression intensities were obtained. The inverse complementary sequences of variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively.

[0180] While the above embodiments illustrate various aspects of the invention, these embodiments are given by way of illustration rather than limitation. Based on the foregoing discussion and embodiments, those skilled in the art can identify the essential features of various aspects of this disclosure, and various changes and modifications can be made to them to suit various uses and conditions without departing from the spirit and scope of this disclosure. Therefore, from the foregoing description, various modifications will be apparent to those skilled in the art in addition to the specific solutions shown and described herein. Such modifications should also be considered to fall within the scope of the appended claims.

[0181] The sequence information involved in this invention is as follows:

[0182] CA10 promoter sequence (347bp): SEQ ID NO:1

[0183] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCCATCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCCCCAGGAACCCTCGACAGGGCCCGGTCTCTCTCGTCCAGCAAG GGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0184] CA10V1 promoter sequence (347bp): SEQ ID NO:2

[0185] GAGCTAATTATAGCAGTGCTTCATGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCCCCAGGAACCCTCGACAGGGCCCGGTCTCTCTCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0186] CA10V2 promoter sequence (347bp): SEQ ID NO:3

[0187] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATACCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCGCCAGGAACCCTCGAAAGGGCCCGGTCTTTCGCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACATCACAATGCTCAGTCTCAGCCGTGGTCGCGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0188] CA10V3 promoter sequence (335bp): SEQ ID NO:4

[0189] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATACCCTGGGAGCCCGGGGCTGACTCAGCACCAAGCTAAATCCCAGCCGTGGACACGGAGACTGATCTAACCGGATTCCAAGCATCCCCAGAAACCCTCGACAGGTCCCGCTCTCTCTGGTCCAGCAAGGGCAGGGACGGGGGGGCAGACACAGCACCAGGCTTAATCCCAGCCGGGGTCACGGAGGACGCTTGGGAGTGGCAAGATTGTGCTAGATAAAGACAATACCCTGAGGTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0190] CA10V4 promoter sequence (333bp): SEQ ID NO:5

[0191] TCGATCGAGGGCCCTTGGCCTGAAAGATGACAGCAGCCCCCATACCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGCATGATCTACTCAGATTCCAAGCATCCCCAGGAACCCTCGGGACGGGTCTCTCTCGTCCGCGAGCAAGGGCAGGGAGCGACGGGCCTAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCGAGTGGCAAGAAGGTGCTAAAAGACAATCCCCTGAGCTGCTTGGCATAATCCGATTAGATCATTCTGCCCGGAAGCACTGCTATAATTAGCTC

[0192] re_CA10 promoter sequence (347bp): SEQ ID NO:6[[ID=I0]]

[0193] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGAGAGAGACCGGGCCCTGTCGAGGGTTCCTGGGGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0194] re_CA10V1 promoter sequence (347bp): SEQ ID NO:7

[0195] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATAGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGAGAGAGACCGGGCCCTGTCGAGGGTTCCTGGGGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGGCATGAAGCACTGCTATAATTAGCTC

[0196] re_CA10V2 promoter sequence (347bp): SEQ ID NO:8

[0197] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGCGACCACGGCTGAGACTGAGCATTGTGATGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGCGAAAGACCGGGCCCTTTCGAGGGTTCCTGGCGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0198] re_CA10V3 promoter sequence (335bp): SEQ ID NO:9

[0199] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCACCTCAGGGTATTGTCTTTATCTAGCACAATCTTGCCACTCCCAAGCGTCCTCCGTGACCCCGGCTGGGATTAAGCCTGGTGCTGTGTCTGCCCCCCCGTCCCTGCCCTTGCTGGACCAGAGAGAGCGGGACCTGTCGAGGGTTTCTGGGGATGCTTGGAATCCGGTTAGATCAGTCTCCGTGTCCACGGCTGGGATTTAGCTTGGTGCTGAGTCAGCCCCGGGCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0200] re_CA10V4 promoter sequence (333bp): SEQ ID NO:10

[0201] GAGCTAATTATAGCAGTGCTTCCGGGCAGAATGATCTAATCGGATTATGCCAAGCAGCTCAGGGGATTGTCTTTTAGCACCTTCTTGCCACTCGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTAGGCCCGTCGCTCCCTGCCCTTGCTCGCGGACGAGAGAGACCCGTCCCGAGGGTTCCTGGGGATGCTTGGAATCTGAGTAGATCATGCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTTCAGGCCAAGGGCCCTCGATCGA

Claims

1. A bidirectional promoter having photoreceptor-specific promoter activity, wherein the bidirectional promoter consists of a nucleotide sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

2. An expression box, wherein the expression box comprises the bidirectional promoter according to claim 1.

3. The expression cassette of claim 2, wherein the expression cassette further comprises a target nucleic acid operatively linked to the bidirectional promoter; wherein the target nucleic acid encodes a therapeutic protein, an optogenetic kinesin, or a reporter protein, or the target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, miRNA, antisense RNA, ribozymes, and deoxyribozymes.

4. A carrier, wherein the carrier comprises the bidirectional promoter according to claim 1 or the expression cassette according to claim 2 or 3.

5. The vector according to claim 4 is a viral vector.

6. The vector according to claim 5, wherein the viral vector is an adeno-associated virus (AAV) vector, a retroviral vector, or a parvovirus vector.

7. The vector according to claim 5, wherein the viral vector is a MoMLV vector, MSCV vector, SFFV vector, MPSV vector, SNV vector, lentiviral vector, adenovirus vector, simian virus 40 vector, bovine papillomavirus vector, Epstein-Barr virus vector, herpesvirus vector, vaccinia virus vector, Harvey's mouse sarcoma virus vector, mouse mammary tumor virus vector, ring virus vector, or Laure's sarcoma virus vector.

8. A viral particle, wherein the viral particle comprises a vector according to any one of claims 4 to 7.

9. The virus particle according to claim 8, wherein the vector is an AAV vector.

10. The virus particle according to claim 9, wherein the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74 and AAVdj.

11. The virus particle according to claim 9, wherein the AAV serotype is selected from AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8.

12. The virus particle according to claim 11, wherein the AAV serotype is AAV-2, AAV2-7m8, or AAV-8.

13. A cell, wherein the cell comprises a bidirectional promoter according to claim 1, an expression cassette according to claim 2 or 3, a vector according to any one of claims 4 to 7, or a viral particle according to any one of claims 8 to 12.

14. The cell according to claim 13, wherein the cell is a photoreceptor cell, retinal pigment epithelial cell (RPE), HEK293, HEK293T, BHK or CHO cell.

15. The cell according to claim 13, wherein the cell is a cone cell and / or a rod cell.

16. A pharmaceutical composition comprising a bidirectional promoter according to claim 1, an expression cassette according to claim 2 or 3, a vector according to any one of claims 4 to 7, a viral particle according to any one of claims 8 to 12, or a cell according to any one of claims 13 to 15, and a pharmaceutically acceptable excipient or vector.

17. Use of the bidirectional promoter of claim 1, the expression cassette of claim 2 or 3, the vector of any one of claims 4 to 7, the viral particle of any one of claims 8 to 12, the cell of any one of claims 13 to 15, or the pharmaceutical composition of claim 16 in the preparation of a medicament for treating or preventing an eye disease, wherein the eye disease is a retinal disease.

18. The use according to claim 17, wherein the eye disease is a hereditary retinal disease.

19. The use according to claim 17, wherein the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, achromatopsia (rod monochromaticity), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

20. A method for expressing a target polypeptide or nucleic acid in a cell, wherein the method comprises introducing a bidirectional promoter according to claim 1, an expression cassette according to claim 2 or 3, a vector according to any one of claims 4 to 7, or a viral particle according to any one of claims 8 to 12 into the cell, and wherein the method is for non-therapeutic purposes.

21. The method of claim 20, wherein the cell is selected from photoreceptor cells or retinal pigment epithelial cells (RPE).

22. The method of claim 20, wherein the cells are selected from cone cells and / or rod cells.

Images