ANTIBODY ENCODING mRNA AND USE THEREOF

Abstract

The invention relates to the technical field of biology, and discloses mRNA (messenger Ribonucleic Acid) for coding an antibody and application thereof. The mRNA for coding the antibody comprises mRNA for coding a light chain and mRNA for coding a heavy chain; wherein the sequences for coding the heavy chains CDR1, CDR2 and CDR3 are respectively the 201 to 221 , the 264 to 311 and the 408 to 434 as shown in SEQ ID NO: 1, and the sequences for coding the light chains CDR1, CDR2 and CDR3 are respectively the 177 to 218 , the 264 to 284 and the 381 to 413 as shown in SEQ ID NO: 5. When the mRNA is delivered into a non-human primate body, the non-human primate body can be effectively protected from novel coronavirus infection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to an mRNA encoding an antibody and an mRNA preparation, as well as the use of the mRNA encoding an antibody or the mRNA preparation in the preparation of a drug for resisting novel coronavirus infection. Background Art

[0002] The spike protein (Spike, S) of SARS-CoV-2 protrudes from the surface of the virion and is composed of the distal subunit S1 and the membrane-anchored subunit S2. The S1 subunit binds to the host cell surface receptor through its receptor binding domain (RBD) at the C-terminus, playing an important role in determining the specificity and tropism of virus infection, and can induce the production of neutralizing antibodies in the body. The S protein, especially the RBD, has become the main target for the research and development of novel coronavirus vaccines and antibody drugs. Antibody drugs have strong targeting, small side effects and significant curative effects. The novel coronavirus neutralizing antibody can directly bind to the viral surface antigen protein and then block the virus from invading host cells, which can significantly reduce the risk of hospitalization, severe illness or death of novel coronavirus patients, and is one of the effective means for the prevention and treatment of novel coronavirus infection.

[0003] However, the current dosage of antibody drugs is relatively large, and the development of traditional protein antibody drugs often relies on cell culture, with complex production processes, long cycles and high costs, which has certain limitations when used in large-scale populations. In contrast, the strategy of introducing a messenger ribonucleic acid (mRNA) molecule encoding a specific antibody into an organism through a delivery vector and using the body cells as a bioreactor to express the corresponding antibody and then exert its biological function has unique advantages: production does not depend on cell culture, the production process and flow are easy to be standardized, which is conducive to large-scale production and cost control; expressing antibodies in body cells can produce post-translational modifications of antibodies in the natural state, and it is easy to overcome the defect that traditional protein antibodies can only neutralize free viruses outside cells.

[0004] In the prior art, although there have been reports on introducing mRNA encoding protective antibodies into the body, using the body cells as a biological factory for antibody production to express the corresponding antibodies and then exert biological functions. However, after the researchers at the U.S. Army Medical Research Institute of Infectious Diseases introduced mRNA encoding vaccinia virus neutralizing antibodies into rabbits through a delivery system, it was found that although antibodies could be produced in the rabbits, the level of serum neutralizing antibodies was low, and it was unlikely to provide protection against vaccinia virus challenge infection, failing to achieve the expected technical effect. This research result indicates that there is unpredictability in the technical effect of developing mRNA antibodies based on existing antibody sequences using mRNA technology. In addition, there is currently no report on mRNA encoding antiviral antibodies that can produce a challenge protection effect in a non-human primate infection model. Summary of the Invention

[0005] The object of the present invention is to overcome the problems existing in the prior art, and provide an mRNA encoding an antibody, an mRNA preparation, and the use of the mRNA encoding an antibody or the mRNA preparation in the preparation of a drug for resisting novel coronavirus infection. Delivering the mRNA encoding an antibody into the body of a non-human primate can effectively protect the body of the non-human primate against novel coronavirus infection.

[0006] To achieve the above object, the first aspect of the present invention provides an mRNA encoding an antibody, wherein the mRNA encoding an antibody includes: an mRNA encoding a light chain and an mRNA encoding a heavy chain; wherein,

[0007] The sequences encoding heavy chain CDR1, CDR2, and CDR3 are respectively the 201-221st positions, the 264-311st positions, and the 408-434th positions shown in SEQ ID NO: 1, or sequences having more than 90% homology with the 201-221st positions, the 264-311st positions, and the 408-434th positions shown in SEQ ID NO: 1; the sequences encoding light chain CDR1, CDR2, and CDR3 are respectively the 177-218th positions, the 264-284th positions, and the 381-413th positions shown in SEQ ID NO: 5, or sequences having more than 90% homology with the 177-218th positions, the 264-284th positions, and the 381-413th positions shown in SEQ ID NO: 5;

[0008] Alternatively, the sequences encoding heavy chain CDR1, CDR2, and CDR3 are respectively the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 2, or sequences having more than 90% homology with the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 2; the sequences encoding light chain CDR1, CDR2, and CDR3 are respectively the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 6, or sequences having more than 90% homology with the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 6;

[0009] Alternatively, the sequences encoding heavy chain CDR1, CDR2, and CDR3 are respectively the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 4, or sequences having more than 90% homology with the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 4; the sequences encoding light chain CDR1, CDR2, and CDR3 are respectively the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 6, or sequences having more than 90% homology with the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 6;

[0010] Alternatively, the sequences encoding heavy chain CDR1, CDR2, and CDR3 are respectively the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 3, or sequences having more than 90% homology with the 201st to 221st positions, 264th to 311th positions, and 408th to 434th positions shown in SEQ ID NO: 3; the sequences encoding light chain CDR1, CDR2, and CDR3 are respectively the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 5, or sequences having more than 90% homology with the 177th to 218th positions, 264th to 284th positions, and 381st to 413th positions shown in SEQ ID NO: 5.

[0011] In the second aspect of the present invention, an mRNA preparation is provided, wherein the mRNA preparation contains the mRNA encoding an antibody provided by the present invention.

[0012] In the third aspect of the present invention, there is provided an application of the mRNA encoding an antibody provided by the present invention or the mRNA preparation provided by the present invention in the preparation of a drug for resisting novel coronavirus infection.

[0013] Through the above technical solutions, the beneficial effects of the present invention at least include:

[0014] The mRNA encoding the antibody provided by the present invention can produce a protective effect against virus challenge in a non-human primate infection model. By introducing the messenger ribonucleic acid (mRNA) encoding the antibody provided by the present invention into a non-human primate, using the body cells as a bioreactor to express the neutralizing antibody against the novel coronavirus, it can effectively protect the non-human primate body from the infection of the novel coronavirus. The production does not rely on cell culture, and the production process and flow are easy to be standardized, which is beneficial to large-scale production and cost control. Expressing the antibody in body cells can produce the post-translational modification of the antibody in the natural state, and it is easy to overcome the defect that the traditional protein antibody can only neutralize the free virus outside the cell.

[0015] In a preferred embodiment of the present invention, by appropriately combining the mRNA encoding the light chain with the mRNA encoding the heavy chain, the mRNA encoding the heavy chain including the sequence shown in SEQ ID NO: 1 is combined with the mRNA encoding the light chain including the sequence shown in SEQ ID NO: 5 and introduced into cynomolgus monkeys. Using the cynomolgus monkey body cells as a bioreactor to express the neutralizing antibody against the novel coronavirus further improves the ability of cynomolgus monkeys to resist the infection of the novel coronavirus. Brief Description of the Drawings

[0016] Figure 1 is a schematic diagram of the construction strategy of the mRNA encoding the neutralizing antibody against the novel coronavirus in Example 1 of the present invention;

[0017] Figure 2a is a schematic diagram of the detection results of the in vitro expression activity of four kinds of mRNAs encoding the antibodies against the novel coronavirus in Example 2 of the present invention;

[0018] Figure 2b is a schematic diagram of the detection results of the in vitro expression activity of the mRNA encoding the antibody against the novel coronavirus in combination 3 in Example 2 of the present invention;

[0019] Figure 3 is a schematic diagram of the detection results of the particle size of the mRNA preparation mRNA-XGv264-LNP in Example 3 of the present invention;

[0020] Figure 4 is a schematic diagram of the results of the neutralizing antibody titer in the serum of cynomolgus monkeys injected with the mRNA preparation mRNA-XGv264-LNP in Example 4 of the present invention;

[0021] Figure 5 is a schematic diagram of the results of the viral load in the nasal swabs of the mRNA preparation mRNA-XGv264-LNP in the novel coronavirus cynomolgus monkey infection model in Example 5 of the present invention;

[0022] Figure 6 It is a schematic diagram of the pharyngeal swab virus load results of the mRNA preparation mRNA-XGv264-LNP in the cynomolgus macaque infection model of novel coronavirus in Example 5 of the present invention;

[0023] Figure 7 It is a schematic diagram of the lung tissue virus load results of the mRNA preparation mRNA-XGv264-LNP in the cynomolgus macaque infection model of novel coronavirus in Example 5 of the present invention. Detailed implementation manners

[0024] The endpoints and any values within the ranges disclosed herein are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0025] The first aspect of the present invention provides an mRNA encoding an antibody, wherein the mRNA encoding the antibody includes: an mRNA encoding a light chain and an mRNA encoding a heavy chain; wherein,

[0026] The sequences encoding heavy chain CDR1, CDR2, and CDR3 are respectively the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or values within the range formed by any two of the above values, preferably 100%) homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1; the sequences encoding light chain CDR1, CDR2, and CDR3 are respectively the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or values within the range formed by any two of the above values, preferably 100%) homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5;

[0027] Alternatively, the sequences encoding the heavy chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 2, respectively, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 2; the sequences encoding the light chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, respectively, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6;

[0028] Alternatively, the sequences encoding the heavy chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 4, respectively, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 4; the sequences encoding the light chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, respectively, or sequences having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6;

[0029] Alternatively, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201st to 221st, 264th to 311th, and 408th to 434th positions shown in SEQ ID NO: 3, respectively, or sequences having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or values within the range formed by any two of the above values, preferably 100%) with the 201st to 221st, 264th to 311th, and 408th to 434th positions shown in SEQ ID NO: 3; the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177th to 218th, 264th to 284th, and 381st to 413th positions shown in SEQ ID NO: 5, respectively, or sequences having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or values within the range formed by any two of the above values, preferably 100%) with the 177th to 218th, 264th to 284th, and 381st to 413th positions shown in SEQ ID NO: 5.

[0030] According to the present invention, preferably, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201st to 221st, 264th to 311th, and 408th to 434th positions shown in SEQ ID NO: 1, respectively, and the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177th to 218th, 264th to 284th, and 381st to 413th positions shown in SEQ ID NO: 5, respectively;

[0031] Alternatively, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201st to 221st, 264th to 311th, and 408th to 434th positions shown in SEQ ID NO: 2, respectively, and the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177th to 218th, 264th to 284th, and 381st to 413th positions shown in SEQ ID NO: 6, respectively;

[0032] Alternatively, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201st to 221st, 264th to 311th, and 408th to 434th positions shown in SEQ ID NO: 4, respectively, and the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177th to 218th, 264th to 284th, and 381st to 413th positions shown in SEQ ID NO: 6, respectively;

[0033] Alternatively, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 3, respectively, and the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively.

[0034] In a preferred embodiment of the present invention, the sequences encoding the heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1, respectively, and the sequences encoding the light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively.

[0035] In a preferred embodiment of the present invention, the mRNA encoding the novel coronavirus neutralizing antibody specifically refers to the mRNA encoding the neutralizing antibody targeting the receptor-binding domain (RBD) of the novel coronavirus spike protein.

[0036] In the present invention, CDR analysis can be completed according to the website http: / / www.abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi. CDR can be determined by methods such as Kabat, Chothia, and IMGT.

[0037] In a preferred embodiment of the present invention, the coding region sequence of the mRNA encoding the heavy chain is the 54-1469th position shown in SEQ ID NO: 3, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54-1469th position shown in SEQ ID NO: 3; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the heavy chain is the 54-110th position shown in SEQ ID NO: 3, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54-110th position shown in SEQ ID NO: 3;

[0038] And / or, the coding region sequence of the mRNA encoding the light chain is the 54th to 773rd positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 773rd positions shown in SEQ ID NO: 5; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the light chain is the 54th to 110th positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 5.

[0039] In another preferred embodiment of the present invention, the coding region sequence of the mRNA encoding the heavy chain is the 54th to 1469th positions shown in SEQ ID NO: 4, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 1469th positions shown in SEQ ID NO: 4; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the heavy chain is the 54th to 110th positions shown in SEQ ID NO: 4, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 4;

[0040] And / or, the coding region sequence of the mRNA encoding the light chain is the 54th to 773rd positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 773rd positions shown in SEQ ID NO: 6; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the light chain is the 54th to 110th positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 6.

[0041] In another preferred embodiment of the present invention, the coding region sequence of the mRNA encoding the heavy chain is the 54th to 1469th positions shown in SEQ ID NO: 2, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 1469th positions shown in SEQ ID NO: 2; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the heavy chain is the 54th to 110th positions shown in SEQ ID NO: 2, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 2;

[0042] And / or, the coding region sequence of the mRNA encoding the light chain is the 54th to 773rd positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 773rd positions shown in SEQ ID NO: 6; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the light chain is the 54th to 110th positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 6.

[0043] In a more preferred embodiment of the present invention, the coding region sequence of the mRNA encoding the heavy chain is the 54th to 1469th positions shown in SEQ ID NO: 1, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 1469th positions shown in SEQ ID NO: 1; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the heavy chain is the 54th to 110th positions shown in SEQ ID NO: 1, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 1;

[0044] And / or, the coding region sequence of the mRNA encoding the light chain is the 54th to 773rd positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 773rd positions shown in SEQ ID NO: 5; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the light chain is the 54th to 110th positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 54th to 110th positions shown in SEQ ID NO: 5.

[0045] According to the present invention, preferably, the mRNA encoding the light chain and the mRNA encoding the heavy chain each independently contain a 5' non-coding region sequence, a coding region sequence, and a 3' non-coding region sequence connected in series.

[0046] In the present invention, connecting in series means connecting polynucleotide elements in a functional manner, and the connected polynucleotide sequences are continuous.

[0047] In a preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the heavy chain is the 1st to 44th positions shown in SEQ ID NO: 3, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 1st to 44th positions shown in SEQ ID NO: 3;

[0048] And / or, the 3' non-coding region sequence of the mRNA encoding the heavy chain is the 1470th to 1583rd positions shown in SEQ ID NO: 3, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or values within the range formed by any two of the above values and within the range, preferably 100%) homology with the 1470th to 1583rd positions shown in SEQ ID NO: 3.

[0049] In another preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the heavy chain is the 1st to 44th positions shown in SEQ ID NO: 2, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) with the 1st to 44th positions shown in SEQ ID NO: 2;

[0050] and / or, the 3' non-coding region sequence of the mRNA encoding the heavy chain is the 1470th to 1583rd positions shown in SEQ ID NO: 2, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) with the 1470th to 1583rd positions shown in SEQ ID NO: 2.

[0051] In another preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the heavy chain is the 1st to 44th positions shown in SEQ ID NO: 4, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) with the 1st to 44th positions shown in SEQ ID NO: 4;

[0052] and / or, the 3' non-coding region sequence of the mRNA encoding the heavy chain is the 1470th to 1583rd positions shown in SEQ ID NO: 4, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) with the 1470th to 1583rd positions shown in SEQ ID NO: 4.

[0053] In another preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the heavy chain is the 1st to 44th positions shown in SEQ ID NO: 1, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) with the 1st to 44th positions shown in SEQ ID NO: 1;

[0054] And / or, the 3' non-coding region sequence of the mRNA encoding the heavy chain is the 1470-1583rd positions shown in SEQ ID NO: 1, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 1470-1583rd positions shown in SEQ ID NO: 1.

[0055] In a preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the light chain is the 1-44th positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 1-44th positions shown in SEQ ID NO: 6;

[0056] And / or, the 3' non-coding region sequence of the mRNA encoding the light chain is the 774-887th positions shown in SEQ ID NO: 6, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 774-887th positions shown in SEQ ID NO: 6.

[0057] In another preferred embodiment of the present invention, the 5' non-coding region sequence of the mRNA encoding the light chain is the 1-44th positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 1-44th positions shown in SEQ ID NO: 5;

[0058] And / or, the 3' non-coding region sequence of the mRNA encoding the light chain is the 774-887th positions shown in SEQ ID NO: 5, or a sequence having more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or the range formed by any two of the above values and the values within the range, preferably 100%) homology with the 774-887th positions shown in SEQ ID NO: 5.

[0059] In a preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain comprises the sequence shown in SEQ ID NO: 3, or a sequence having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 3;

[0060] and / or, the sequence of the mRNA encoding the light chain comprises the sequence shown in SEQ ID NO: 5, or a sequence having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 5.

[0061] In another preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain comprises the sequence shown in SEQ ID NO: 4, or a sequence having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 4;

[0062] and / or, the sequence of the mRNA encoding the light chain comprises the sequence shown in SEQ ID NO: 6, or a sequence having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 6.

[0063] In another preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain comprises the sequence shown in SEQ ID NO: 2, or a sequence having a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 2;

[0064] And / or, the sequence of the mRNA encoding the light chain comprises the sequence shown in SEQ ID NO: 6, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 6.

[0065] In a more preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain comprises the sequence shown in SEQ ID NO: 1, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 1;

[0066] And / or, the sequence of the mRNA encoding the light chain comprises the sequence shown in SEQ ID NO: 5, or a sequence having a homology of more than 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any range formed by any two of the above values and the values within the range, preferably 100%) with the sequence shown in SEQ ID NO: 5.

[0067] According to the present invention, preferably, downstream of the 3' non-coding region sequence of the mRNA encoding the light chain and downstream of the 3' non-coding region sequence of the mRNA encoding the heavy chain each contain a polyadenylic acid (poly A) sequence, and the poly A sequence is represented by An, where n represents the number of A, and n can be, for example, 50 - 250. In the 5'→3' direction, the direction close to the 3' end is downstream.

[0068] According to the present invention, preferably, at least one of the uracil and / or cytosine in part or all of the mRNA encoding the antibody has been chemically modified to be able to reduce the immunogenicity of the mRNA encoding the antibody in vivo, improve the stability of the mRNA encoding the antibody in vivo, and enhance the expression ability of the mRNA encoding the antibody in vivo.

[0069] According to the present invention, preferably, the chemical modification includes replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the uracil in the mRNA encoding the antibody, preferably replacing 100% of the uracil in the mRNA encoding the antibody,

[0070] Among them, the substance for replacing uracil is selected from at least one of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-T-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxypseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-O-methyluridine;

[0071] And / or, the chemical modification includes replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of cytosine in the mRNA encoding the antibody with 5-methylcytosine, preferably replacing 100% of cytosine in the mRNA encoding the antibody.

[0072] In a preferred embodiment of the present invention, the chemical modification includes replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of uracil in the mRNA encoding the antibody with N1-methylpseudouridine, preferably replacing 100% of uracil in the mRNA encoding the antibody.

[0073] In the present invention, according to the requirements of different mRNAs, different cap structures or cap analogs can be flexibly added to the 5' end of the mRNA; among them, the cap structure can be selected from, for example, m 7 GpppG, m2 7 , 3’-O GpppG, m 7 Gppp(5’)N1 and m 7 Gppp(m 2’-O )N1, and the cap analog can be selected from, for example, at least one of m 7 G(5')ppp(5')G, m 7 G(5’)ppp(5’)(2’OMeA)pG, m 7 (3’OMeG)(5’)ppp(5’)(2’OMeA)pG.

[0074] In some preferred embodiments of the present invention, the 5' end of the mRNA encoding the antibody has a cap structure, and the cap structure is m 7 GpppG.

[0075] The second aspect of the present invention provides an mRNA preparation, wherein the mRNA preparation contains the mRNA encoding the antibody provided by the present invention.

[0076] According to the present invention, preferably, the mRNA preparation further contains a delivery vector, and the delivery vector is a nano-lipid sphere (LNP).

[0077] In the present invention, the mRNA preparation can be prepared by the following method: encapsulating the mRNA stock solution in nano-lipid spheres, then dialyzing in a phosphate buffer solution, and then concentrating; wherein, the mRNA stock solution is the mRNA encoding an antibody provided by the present invention. In the mRNA stock solution, the molar ratio of the mRNA encoding the heavy chain to the mRNA encoding the light chain is 1:1.

[0078] According to the specific embodiments of the present invention, NanoAssemblr Ignite + The LNP lipid nanoparticle drug manufacturing system is used to quickly mix the mRNA stock solution with lipid excipients (for example, purchased from Suzhou Abbott Biopharma Co., Ltd.), so as to encapsulate the mRNA encoding the antibody in nano-lipid spheres, and obtain an mRNA-LNP preparation; further, the mRNA-LNP preparation is dialyzed in a phosphate buffer solution (PBS solution, for example, purchased from VIVICUM Co., Ltd.) at 4°C for 16-24 h, and then ultrafiltered and concentrated through a 100KDa ultrafiltration tube (for example, purchased from Merck Millipore Co., Ltd.) to obtain the mRNA preparation mRNA-XGv264-LNP.

[0079] The third aspect of the present invention provides an application of the mRNA encoding an antibody provided by the present invention or the mRNA preparation provided by the present invention in the preparation of a drug for resisting novel coronavirus infection.

[0080] According to the present invention, the mRNA preparation can be delivered into a biological organism by intravenous injection. The intravenous injection amount is adjusted according to the tolerance of different organisms. For example, for cynomolgus monkeys, the intravenous injection amount is such that the amount of the mRNA preparation injected per kg body weight of the cynomolgus monkey is 0.1-5 mg.

[0081] The present invention will be described in detail below through examples and comparative examples. In the following examples and comparative examples, unless otherwise specified, all are conventional methods; the reagents and materials used, unless otherwise specified, can be obtained from commercial channels.

[0082] Example 1

[0083] This example is used to illustrate the design and synthesis method of mRNA encoding a novel coronavirus neutralizing antibody.

[0084] (1) mRNA design method

[0085] Amino acid sequences of the heavy and light chains of the neutralizing antibody XGv264 targeting the RBD protein of the novel coronavirus (Wang K, et al. Memory B cell repertoire from triple vaccinees against diverse SARS-CoV-2 variants. doi: 10.1038 / s41586-022-04466-x). Based on the developed SmartCodon codon optimization system (software copyright registration number: 2021SR1466792) (including multiple algorithm models such as codon adaptation index, codon context relationship, secondary structure, restriction enzyme cleavage site, potential double-stranded nucleic acid sequence, etc.) and considerations such as antibody half-life modification, multiple mRNAs encoding the heavy and light chains of the protective antibody against the novel coronavirus were optimized and designed. According to the sense strand, that is, in the 5'→3' direction, it sequentially includes the following elements: 5' untranslated region (5'UTR), signal peptide, antibody heavy / light chain coding region (excluding the signal peptide), 3' untranslated region (3'UTR), and poly A tail. The schematic diagram of the mRNAs encoding the antibody light and heavy chains is shown in Figure 1Specifically, the sequences of the encoded antibody heavy chain mRNA constructs are the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 respectively, with a poly A tail ligated downstream, and the sequences of the encoded antibody light chain mRNA constructs are the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively, with a poly A tail ligated downstream, all given in the sense strand (5'-3') form. Among them, the signal peptide sequences of the four encoded antibody heavy chain mRNAs are the 54th to 110th positions shown in SEQ ID NO: 1, the 54th to 110th positions shown in SEQ ID NO: 2, the 54th to 110th positions shown in SEQ ID NO: 3, and the 54th to 110th positions shown in SEQ ID NO: 4; the signal peptide sequences of the two encoded antibody light chain mRNAs are the 54th to 110th positions shown in SEQ ID NO: 5 and the 54th to 110th positions shown in SEQ ID NO: 6. The CDR1, CDR2, and CDR3 sequences of the four encoded antibody heavy chain mRNAs are the 201st to 221st positions, the 264th to 311st positions, and the 408th to 434th positions shown in SEQ ID NO: 1, the 201st to 221st positions, the 264th to 311st positions, and the 408th to 434th positions shown in SEQ ID NO: 2, the 201st to 221st positions, the 264th to 311st positions, and the 408th to 434th positions shown in SEQ ID NO: 3, and the 201st to 221st positions, the 264th to 311st positions, and the 408th to 434th positions shown in SEQ ID NO: 4; the CDR1, CDR2, and CDR3 sequences of the two encoded antibody light chain mRNAs are the 177th to 218th positions, the 264th to 284th positions, and the 381st to 413th positions shown in SEQ ID NO: 5, and the 177th to 218th positions, the 264th to 284th positions, and the 381st to 413th positions shown in SEQ ID NO: 6. The CDR analysis of the present invention was completed based on the website http: / / www.abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi.

[0086] In the above mRNA constructs, the 5'UTR RNA sequences and 3'UTR RNA sequences are shown in Table 1.

[0087] Table 2

[0088]

[0089] Based on the above sequences, a total of 4 combinations of encoded antibody heavy chain / light chain mRNA constructs were designed. Among them, combination 1 consists of mRNA-XGv264-HC-1 (SEQ ID NO: 1 + poly A tail) and mRNA-XGv264-LC-1 (SEQ ID NO: 5 + poly A tail), combination 2 consists of mRNA-XGv264-HC-2 (SEQ ID NO: 2 + poly A tail) and mRNA-XGv264-LC-2 (SEQ ID NO: 6 + poly A tail), combination 3 consists of mRNA-XGv264-HC-3 (SEQ ID NO: 3 + poly A tail) and mRNA-XGv264-LC-1 (SEQ ID NO: 5 + poly A tail), and combination 4 consists of mRNA-XGv264-HC-4 (SEQ ID NO: 4 + poly A tail) and mRNA-XGv264-LC-2 (SEQ ID NO: 6 + poly A tail).

[0090] (2) Synthesis method of mRNA

[0091] Based on the above-optimized sequence and expression vector ABOP-028 (Zhang NN, et.al. A Thermostable mRNA Vaccine against COVID-19. doi:10.1016 / j.cell.2020.07.024), the corresponding antibody heavy-chain DNA transcription template plasmids pAB028-XGv264-HC-1, pAB028-XGv264-HC-2, pAB028-XGv264-HC-3, pAB028-XGv264-HC-4 and antibody light-chain DNA transcription template plasmids pAB028-XGv264-LC-1, pAB028-XGv264-LC-2 were further constructed. The above-constructed DNA transcription templates were linearized using BsaⅠ restriction endonuclease (purchased from NEB). Using the above linearized plasmids as templates respectively, with natural triphosphate nucleotides (ATP, CTP, and GTP, purchased from Nanjing Novoprotein Scientific Inc.) and N1-methylpseudouridine (N1-MePseudo·UTP, purchased from Nanjing Novoprotein Scientific Inc.) as substrates, in vitro transcription (IVT) reactions were carried out using T7 RNA polymerase (purchased from Nanjing Novoprotein Scientific Inc.); DNase I (purchased from Nanjing Novoprotein Scientific Inc.) was added to digest the template DNA; 7.5 M lithium chloride solution (purchased from Invitrogen) was added to purify the mRNA; the obtained mRNA was capped at the 5' end using vaccinia virus capping enzyme (10 U / μL, purchased from Nanjing Novoprotein Scientific Inc.), and the capping structure methylation was completed using cap structure 2'-O-methyltransferase (50 U / μL, purchased from Nanjing Novoprotein Scientific Inc.); finally, 7.5 M lithium chloride solution (purchased from Invitrogen) was added to purify the capped mRNA, obtaining mRNAs encoding antibody heavy chains: mRNA-XGv264-HC-1, mRNA-XGv264-HC-2, mRNA-XGv264-HC-3, mRNA-XGv264-HC-4 and mRNAs encoding antibody light chains: mRNA-XGv264-LC-1, mRNA-XGv264-LC-2.

[0092] Example 2

[0093] This example is used to illustrate the identification and screening of the in vitro expression of mRNA encoding antibodies.

[0094] One day before transfection, 293TN cells were seeded into a 12-well plate, and the cell density was 2×10 5cells / well. When the cells in the wells reached 70 - 80% confluence, Lipofectamine MessengerMAX liposomal transfection reagent (purchased from Thermo) was used to co-transfect 293TN cells with 4 groups of combined mRNAs encoding heavy / light chain of antibodies, namely mRNA-XGv264-HC-1 / mRNA-XGv264-LC-1, mRNA-XGv264-HC-2 / mRNA-XGv264-LC-2, mRNA-XGv264-HC-3 / mRNA-XGv264-LC-1, and mRNA-XGv264-HC-4 / mRNA-XGv264-LC-2, respectively, at a molar ratio of 1:1 (mRNA-HC:mRNA-LC). Six hours after transfection, the transfection supernatant was replaced with Opti-MEM medium (purchased from Thermo). The control group was the same as the experimental group in all steps except that mRNA-HC and mRNA-LC were not added. The cell culture supernatants of the experimental group 24 hours after transfection and the control group were collected respectively, and cell debris was removed by centrifugation at 5000g. The content of human IgG antibody in the cell supernatant was detected using a human immunoglobulin G (IgG) enzyme-linked immunosorbent assay kit (purchased from Sangon Biotech Co., Ltd.) as follows: 30 minutes before the experiment, take out the kit and restore it to room temperature; add 100 μL of standard working solution and test serum samples to each reaction well. The standard should be done in duplicate. After sealing the plate, incubate at 37°C for 1.5 h. Discard the liquid and spin dry. Add 100 μL of biotin-labeled immunoglobulin G antibody working solution to each reaction well, and incubate in a 37°C incubator for 1 h after sealing the plate. Wash the plate 5 times with the washing solution. Add 100 μL of HRP-labeled streptavidin working solution to each reaction well, and incubate in a 37°C incubator for 30 min after sealing the plate. Wash the plate 5 times with the washing solution. Add 90 μL of chromogenic reagent to each reaction well, and incubate at 37°C in the dark for about 15 min after sealing the plate. Add 50 μL of stop solution to each reaction well, and measure the OD value at a wavelength of 450 nm with an enzyme-linked immunosorbent assay reader within 5 min. The average OD values of the standards and samples were calculated by subtracting the OD value of the zero well from the OD value of each standard and sample. With the standard concentration as the abscissa and the absorbance OD value as the ordinate, a standard curve was plotted, and the IgG content (ng / mL) in the sample was calculated. The detection results are as Figure 2a and Figure 2b shown, as Figure 2aIt can be seen that among the cell transfection supernatants corresponding to the 4 combinations of encoded antibody heavy chain / light chain mRNA constructs, the co-transfection of mRNA-XGv264-HC-1 and mRNA-XGv264-LC-1 (Combination 1) had the best expression efficiency, and the IgG content in the corresponding cell transfection supernatant was the highest. Therefore, mRNA-XGv264-HC-1 and mRNA-XGv264-LC-1 were selected for subsequent experiments. From Figure 2b It can also be seen that there were significant differences in the mRNA constructs encoding antibodies of Combination 3 compared with the control group.

[0095] Example 3

[0096] This example is used to illustrate the nano-lipid particle (LNP) encapsulation of mRNA encoding antibodies against SARS-CoV-2.

[0097] mRNA-XGv264-HC-1 and mRNA-XGv264-LC-1 obtained in Example 1 were mixed at a molar ratio of 1:1 to obtain a stock solution of mRNA encoding the XGv264 antibody. Using NanoAssemblr Ignite + The LNP lipid nanoparticle drug manufacturing system was used to quickly mix the stock solution of mRNA encoding the antibody with a lipid excipient combination (purchased from Suzhou Abbots Biotechnology Co., Ltd.), encapsulate the mRNA encoding the antibody in nano-lipid particles to obtain an mRNA-LNP preparation; further, the mRNA-LNP preparation was dialyzed overnight at 4°C in a PBS solution (purchased from VIVICUM Co., Ltd.) and then ultrafiltered and concentrated through a 100KDa ultrafiltration tube (purchased from Merck Millipore Co., Ltd.) to obtain the mRNA preparation mRNA-XGv264-LNP. Its particle size was detected using an Unchained Labs Stunner high-throughput concentration and particle size analyzer, and the detection results are as Figure 3 shown. From Figure 3 It can be seen that the particle size of the prepared mRNA-XGv264-LNP was approximately 73.76 nm, which was within the expected particle size range (50 - 120 nm).

[0098] Example 4

[0099] This example is used to illustrate the identification of the in vivo expression of mRNA encoding antibodies against SARS-CoV-2.

[0100] Two 3-year-old cynomolgus monkeys were injected via the intravenous route with the mRNA-XGv264-LNP prepared in Example 3 at a dose of 1 mg / kg. Blood samples were collected from the cynomolgus monkeys at 6 h, 12 h, 24 h, 36 h after administration, and at 3 d, 5 d, 7 d, 10 d, 14 d, 21 d, 28 d, 35 d, 42 d, 49 d, 56 d, 63 d, 70 d after administration, and the sera were separated. The sera were inactivated at 56 °C for 30 min and then used for the pseudovirus neutralization test. The method was as follows: A 96-well cell culture plate was taken, and the serum samples were serially diluted 3-fold with DMEM medium containing 2% FBS (DMEM-2% FBS), and the final volume of each well was 100 μL. The cell control and virus control wells were not involved in the serial dilution. The SARS-CoV-2 pseudovirus (purchased from Beijing Tiantan Biological Company) was diluted with DMEM-2% FBS culture medium to 1.3×10 4 TCID 50 / mL, and 50 μL of the diluted virus was added to the experimental wells and the virus control wells. The 96-well plate was placed in an incubator at 37 °C and 5% CO2 for 1 h. The Huh7 cells were digested and counted, and 3.5 - 4×10 4 cells per well were seeded onto the incubated cell culture plate, and the cell volume added was 100 μL. The total volume of each well was 250 μL, and the cells were cultured in an incubator at 37 °C and 5% CO2 for 24 h. After 24 h, the 96-well plate was taken out, 150 μL of the supernatant was aspirated, 100 μL of the luciferase detection reagent (purchased from PerkinElmer) was added, and the reaction was carried out in the dark at room temperature for 2 min. After pipetting and mixing evenly, 100 μL was taken and transferred to a 96-well white microplate, and the luminescence value (RLU) of each well was read using a multifunctional microplate reader. The neutralization inhibition rate was calculated according to the following formula:

[0101]

[0102] The neutralizing antibody titer was expressed as the reciprocal of the serum dilution corresponding to an inhibition rate of 50% (50% Neutralization Titer, NT 50 ), and the detection results were as shown in Figure 4 . As can be seen from Figure 4 , after delivering the mRNA encoding the novel coronavirus protective antibody XGv264 into the cynomolgus monkeys, neutralizing antibodies with activity could be rapidly produced and persisted for several weeks.

[0103] Example 5

[0104] This example was used to illustrate the evaluation of the protective effect against virus challenge of the mRNA encoding the novel coronavirus antibody.

[0105] The mRNA-XGv264-LNP (0.6 mg / kg) prepared in Example 3 was injected into the experimental group of cynomolgus monkeys (n = 3 monkeys / group) via the intravenous route, and a control group of cynomolgus monkeys without drug administration (n = 3 monkeys / group) was set up simultaneously. Two days after administration, the Omicron BA.1 strain of SARS-CoV-2 (2×10 6 PFU) was used to infect the cynomolgus monkeys via the intranasal route. Nasal swabs and throat swabs of the cynomolgus monkeys in each group were collected daily within 4 days after infection, and lung tissues were collected on the 5th day after infection. RNA was extracted from the nasal, throat swabs and lung tissues, and the OneStep PrimeScript TM RT-PCR Detection Kit (purchased from TaKaRa) was used to detect the viral load in the swabs and lung tissues by real-time fluorescence quantitative PCR method. The detection primers and probes used are shown in Table 3.

[0106] Table 3

[0107] Primer Name Sequence (5’-3’) Number sgRNA-F CGATCTCTTGTAGATCTGTTCTC SEQ ID NO:9 sgRNA-R ATATTGCAGCAGTACGCACACA SEQ ID NO:10 sgRNA-P FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 SEQ ID NO:11

[0108] The specific amplification system is shown in Table 4, and the PCR program is shown in Table 5.

[0109] Table 4

[0110] Reagent Dosage (μL) 2×One Step RT-PCR BufferⅡ 10 TaKaRa Ex Taq HS 0.4 PrimeScript RT Enzyme MixⅡ 0.4 Forward Primer sgRNA-F 0.4 Reverse Primer sgRNA-R 0.4 Probe sgRNA-P 0.4 RNA 2 Water 6 Total Volume 20

[0111] Table 5

[0112]

[0113]

[0114] The detection results of the viral load in the nasal swabs are shown in Figure 5 , the detection results of the viral load in the throat swabs are shown in Figure 6 , and the detection results of the viral load in the lung tissues are shown in Figure 7 . From Figure 5 , Figure 6 and Figure 7 , it can be seen that the viral loads in the nasal, throat swabs and lungs of the cynomolgus monkeys in the mRNA-XGv264-LNP administration group were significantly lower than those in the control group, indicating that mRNA-XGv264-LNP can effectively protect cynomolgus monkeys against SARS-CoV-2 infection.

[0115] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

[0116] SEQ ID NO: 1:

[0117]

[0146] SEQ ID NO: 2

[0147]

[0176] SEQ ID NO: 3

[0177]

[0206] SEQ ID NO: 4

[0207]

[0236] SEQ ID NO: 5

[0237] CUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACUUUGGCGCCGCCACCAUGGGAUGGAGCUGCAUCAUUCUGUUCCUGGUGGCAACAGCCACCGGGGUGCACUCACAGAGUGCUCUGACCCAGCCCGCCAGCGUGAGCGGCAGCCCUGGGCAGAGCAUUACUGUGAGCUGCACUGGUACCAGCUCCGACCUGGGAAACUUCCAGUACGUGAGCUGGUACCAGCACCACCCAGGGAAGGCUCCCAAGCUGCUGAUCUACGAGGUCAGCCACAGGCCCAGCGGGGUGAGUAAUCGGUUCUCCGGCUCCAAGAGCGGGAACACCGCCUCCCUGACCAUCAGCGGGCUGCAGGCCGAGGACGAGGCCGAUUACUACUGUUGUAGUUACACUACAACAACCAUCCCUGUGGCCUUUGGGGGGGGGACACGGUUGACCGUGCUGGGGCAGCCCAAGGCUGCCCCCAGCGUGACCCUGUUUCCACCUAGCUCCGAGGAGCUGCAGGCCAAUAAGGCUACGCUGGUGUGCUUGAUCUCUGACUUCUAUCCUGGGGCCGUGACUGUGGCCUGGAAGGCCGACAGCAGCCCCGUGAAGGCCGGGGUGGAGACUACCACCCCGAGCAAGCAGAGCAAUAACAAGUACGCCGCUAGCUCUUAUCUGAGCCUGACCCCGGAGCAGUGGAAGAGUCACCGGAGCUACAGCUGCCAGGUGACUCACGAGGGGUCAACCGUGGAGAAGACCGUGGCCCCCACCGAGUGCUCCUGAUAAGAAUUCUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACUAGU

[0253] SEQ ID NO: 6

[0254] CUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACUUUGGCGCCGCCACCAUGGGAUGGAGCUGCAUCAUUCUGUUCCUGGUGGCCACAGCCACGGGGGUGCACUCACAGAGCGCCCUGACCCAGCCGGCCUCUGUGAGUGGGUCGCCAGGACAGAGUAUCACGGUGAGUUGCACCGGCACGAGUAGCGACCUGGGGAACUUCCAGUACGUCAGCUGGUAUCAGCAUCACCCCGGCAAGGCGCCGAAGCUGCUGAUCUACGAGGUCAGCCACCGGCCCUCCGGGGUGAGCAACCGGUUCUCCGGCUCCAAGUCGGGGAACACGGCCAGCCUGACGAUCUCCGGGCUGCAGGCCGAGGACGAGGCCGACUACUAUUGUUGCUCCUACACGACCACCACGAUCCCUGUGGCCUUCGGGGGCGGGACAAGGCUGACGGUGCUGGGGCAGCCCAAGGCUGCCCCGUCCGUCACCUUGUUCCCGCCCUCGAGCGAGGAGCUGCAGGCCAACAAGGCGACGCUGGUGUGUCUGAUCAGUGACUUCUAUCCUGGGGCCGUGACUGUGGCCUGGAAGGCCGACAGCAGCCCCGUGAAGGCCGGGGUGGAGACUACCACCCCGAGCAAGCAGAGCAACAAUAAGUACGCGGCCUCGUCCUACCUGAGCCUGACGCCCGAGCAGUGGAAGUCCCACAGGUCCUACUCGUGCCAGGUGACACACGAGGGGUCGACGGUGGAGAAGACAGUGGCGCCCACCGAGUGCUCCUGAUAAGAAUUCUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACUAGU

Claims

1. An mRNA encoding an antibody, characterized in that, The mRNA encoding the antibody comprises: mRNA encoding a light chain and mRNA encoding a heavy chain; wherein, the sequences encoding the heavy chain CDR1, CDR2, and CDR3 are respectively the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1, or sequences having more than 90% homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1; the sequences encoding the light chain CDR1, CDR2, and CDR3 are respectively the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, or sequences having more than 90% homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5; alternatively, the sequences encoding the heavy chain CDR1, CDR2, and CDR3 are respectively the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 2, or sequences having more than 90% homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 2; the sequences encoding the light chain CDR1, CDR2, and CDR3 are respectively the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, or sequences having more than 90% homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6; alternatively, the sequences encoding the heavy chain CDR1, CDR2, and CDR3 are respectively the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 4, or sequences having more than 90% homology with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 4; the sequences encoding the light chain CDR1, CDR2, and CDR3 are respectively the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, or sequences having more than 90% homology with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6; Alternatively, the sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 3, respectively, or sequences having a homology of more than 90% with the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 3; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively, or sequences having a homology of more than 90% with the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO:

5.

2. The mRNA encoding the antibody according to claim 1, wherein The sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1, respectively; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively; Alternatively, the sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 2, respectively; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, respectively; Alternatively, the sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 4, respectively; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 6, respectively; Alternatively, the sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 3, respectively; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively.

3. The mRNA encoding an antibody according to claim 1 or 2, characterized in that, The sequences encoding heavy-chain CDR1, CDR2, and CDR3 are the 201-221st, 264-311st, and 408-434th positions shown in SEQ ID NO: 1, respectively; the sequences encoding light-chain CDR1, CDR2, and CDR3 are the 177-218th, 264-284th, and 381-413th positions shown in SEQ ID NO: 5, respectively.

4. The mRNA encoding an antibody according to any one of claims 1-3, characterized in that, The coding region sequence of the mRNA encoding the heavy chain is the 54th to 1469th positions shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the 54th to 1469th positions shown in SEQ ID NO: 1; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the heavy chain is the 54th to 110th positions shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the 54th to 110th positions shown in SEQ ID NO: 1; and / or, the coding region sequence of the mRNA encoding the light chain is the 54th to 773rd positions shown in SEQ ID NO: 5, or a sequence having more than 90% homology with the 54th to 773rd positions shown in SEQ ID NO: 5; wherein, the signal peptide sequence in the coding region sequence of the mRNA encoding the light chain is the 54th to 110th positions shown in SEQ ID NO: 5, or a sequence having more than 90% homology with the 54th to 110th positions shown in SEQ ID NO:

5.

5. The mRNA encoding an antibody according to any one of claims 1-4, characterized in that, The mRNA encoding the light chain and the mRNA encoding the heavy chain each independently contain a 5' non-coding region sequence, a coding region sequence, and a 3' non-coding region sequence connected in series; Preferably, the 5' non-coding region sequence of the mRNA encoding the heavy chain is the 1st to 44th positions shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the 1st to 44th positions shown in SEQ ID NO: 1; and / or, the 3' non-coding region sequence of the mRNA encoding the heavy chain is the 1470th to 1583rd positions shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the 1470th to 1583rd positions shown in SEQ ID NO: 1; Preferably, the 5' non-coding region sequence of the mRNA encoding the light chain is the 1st to 44th positions shown in SEQ ID NO: 5, or a sequence having more than 90% homology with the 1st to 44th positions shown in SEQ ID NO: 5; and / or, the 3' non-coding region sequence of the mRNA encoding the light chain is the 774th to 887th positions shown in SEQ ID NO: 5, or a sequence having more than 90% homology with the 774th to 887th positions shown in SEQ ID NO:

5.

6. The mRNA encoding an antibody according to any one of claims 1-5, characterized in that, The sequence of the mRNA encoding the heavy chain includes the sequence shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the sequence shown in SEQ ID NO: 1; and / or, the sequence of the mRNA encoding the light chain includes the sequence shown in SEQ ID NO: 5, or a sequence having more than 90% homology with the sequence shown in SEQ ID NO:

5.

7. The mRNA encoding an antibody according to any one of claims 1-6, characterized in that, In the mRNA encoding the antibody, some or all of the uracil and / or cytosine have been chemically modified, which can reduce the immunogenicity of the mRNA encoding the antibody in vivo, improve the stability of the mRNA encoding the antibody in vivo, and enhance the expression ability of the mRNA encoding the antibody in vivo by at least one of them; Preferably, the chemical modification includes replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of uracil in the mRNA encoding the antibody with N1-methylpseudouridine, preferably replacing 100% of uracil in the mRNA encoding the antibody.

8. The mRNA encoding an antibody according to any one of claims 1-6, characterized in that, The 5' end of the mRNA encoding the antibody has a cap structure or a cap analog; Preferably, the 5' end of the mRNA encoding the antibody has a cap structure, and the cap structure is m 7 GpppG.

9. An mRNA preparation, characterized in that, The mRNA preparation contains the mRNA encoding the antibody according to any one of claims 1-8; Preferably, the mRNA preparation further contains a delivery carrier, and the delivery carrier is a nano-lipid sphere.

10. Use of the mRNA encoding the antibody according to any one of claims 1-8 or the mRNA preparation according to claim 9 in the preparation of a drug for resisting novel coronavirus infection.

Images