Method for producing tyrosol through double-bacterium co-culture and application of tyrosol

By recombining the bifid coculture system of E. coli and Saccharomyces cerevisiae, the genetically engineered bifid coculture method was used to solve the problem of low tyrosol synthesis efficiency, achieving efficient and low-cost tyrosol production, and significantly improving the yield.

CN120290648APending Publication Date: 2025-07-11QINGDAO ARCHAEOPTERA BIOPHARMACEUTICAL CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510490191.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, tyrosol has low natural extraction rate, complex purification, chemical synthesis pollutes the environment, while enzymatic catalytic synthesis is high, and a single wild strain cannot efficiently synthesize tyrosine directly from sugar sources, and lacks a suitable way to convert tyrosine to tyrosine.

Method used

The co-culture system of recombinant E. coli and recombinant Saccharomyces cerevisiae was adopted. Through genetic engineering, recombinant E. coli overexpresses glucose-6-phosphate dehydrogenase and tyrosine synthase, knocking out the branched acid mutaase, and recombinant Saccharomyces cerevisiae overexpresses tyrosine decarboxylase and phenylacetaldehyde reductase, forming a co-culture system, and directly fermenting the sugar source as the substrate to produce tyrosine.

Benefits of technology

Efficient and low-cost tyrosol production is achieved, with a tyrosine conversion rate of up to 90%, and a yield of up to 15.67g/L, avoiding the inhibition of competitive metabolic pathways in the monocytogenes system and improving production efficiency and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290648A_ABST
    Figure CN120290648A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microbial fermentation engineering, and discloses a method for directly producing tyrosol by using a recombinant Escherichia coli and recombinant Saccharomyces cerevisiae double-bacterium co-culture system and using low-cost glucose or other sugar sources as substrates, precursors do not need to be added, the preparation method is simple, and the cost is greatly reduced. The recombinant Escherichia coli is obtained by the following steps: carrying out genetic engineering modification, over-expressing glucose-6-phosphate dehydrogenase G6PDH to regulate and control a glucose utilization pathway, over-expressing tyrosine synthase tyrA and knocking out chorismate mutase pheA; the saccharomyces cerevisiae is obtained by introducing an exogenous way and overexpressing tyrosine decarboxylase AAS and phenylacetaldehyde reductase PAR, so that the tyrosol is directly and efficiently synthesized from a sugar source. The De novo synthesis yield of the tyrosol by adopting the double-bacterium co-culture system reaches 15.67 g / L, so that the De novo synthesis yield of the tyrosol is greatly improved, and a new route is provided for producing the tyrosol by efficient fermentation of microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial fermentation engineering, and relates to a method for co-culturing two bacteria to produce hydroxytyrosol and its application. Background Art

[0002] Hydroxytyrosol (HT) is a bisphenolic compound mainly present in olives, with significant antioxidant activity and various pharmaceutical effects. It is considered to be one of the most efficient active antioxidants, capable of effectively scavenging free radicals and antioxidants, and is very beneficial to maintaining human health. The molecular structure of hydroxytyrosol contains phenolic hydroxyl and alcoholic hydroxyl groups, which endow it with unique chemical properties and application potential. The yield of natural extraction of hydroxytyrosol is low and the purification is complex; the chemical synthesis method causes great environmental pollution; while the enzymatic catalysis has a high synthesis cost. Relatively speaking, the synthesis of hydroxytyrosol using microbial cell factories has the advantages of high efficiency, greenness, and low cost, which has attracted extensive attention from scholars at home and abroad.

[0003] The yield of natural extraction of hydroxytyrosol is low and the purification is complex, chemical synthesis will cause environmental pollution, and the cost of enzymatic catalysis synthesis is high. Microbial synthesis has the advantages of high efficiency, greenness, and low cost, but a single wild strain cannot achieve the efficient direct synthesis of hydroxytyrosol from sugar sources, or the synthesis conversion efficiency is low. Through comprehensive exploration of the synthesis of hydroxytyrosol by many scholars, it is found that tyrosine is an important precursor for the synthesis of hydroxytyrosol, and the research on the conversion of tyrosine in Escherichia coli is relatively mature, but there is a lack of a suitable pathway to convert tyrosine into hydroxytyrosol, so it is difficult to achieve efficient de novo conversion. On the other hand, Saccharomyces cerevisiae has good reducing ability, which is helpful for the reduction of aldehyde to alcohol, and is a natural dominant strain for the synthesis of hydroxytyrosol. However, this strain lacks the ability to synthesize tyrosine de novo. Therefore, integrating the advantage of high tyrosine production by Escherichia coli with Saccharomyces cerevisiae is the key technology for achieving efficient de novo synthesis of hydroxytyrosol. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a method for co-culturing two bacteria to produce hydroxytyrosol and its application.

[0005] To achieve the above purpose, the present invention provides the following technical solutions:

[0006] 1. A method for co-culturing two bacteria to ferment and produce hydroxytyrosol, which uses recombinant Escherichia coli and recombinant Saccharomyces cerevisiae to construct a co-culture system and ferments with a sugar source as a substrate to produce hydroxytyrosol; the recombinant Escherichia coli contains a glucose-6-phosphate dehydrogenase gene and a tyrosine synthase gene, and the chorismate mutase gene pheA is knocked out, and the recombinant Saccharomyces cerevisiae contains a tyrosine decarboxylase gene and a phenylacetaldehyde reductase gene.

[0007] Furthermore, the sugar source is one or more of glucose, sucrose, fructose, and glycerol.

[0008] The preferred sugar source is glucose.

[0009] In the method for further co - culturing two bacteria for fermentative production of tyrosol, the nucleotide sequence of glucose - 6 - phosphate dehydrogenase is as shown in SEQ ID NO.1, and the nucleotide sequence of tyrosine synthase tyrA is as shown in SEQ ID NO.2.

[0010] In the method for further co - culturing two bacteria for fermentative production of tyrosol, the nucleotide sequence of tyrosine decarboxylase AAS is as shown in SEQ ID NO.3, and the nucleotide sequence of phenylacetaldehyde reductase PAR is as shown in SEQ ID NO.4.

[0011] Tyrosine decarboxylase AAS is from Petroselinum crispum, and phenylacetaldehyde reductase PAR is from Rhodococcus.

[0012] In the method for further co - culturing two bacteria for fermentative production of tyrosol, the sgRNA sequence used for knocking out the chorismate mutase gene pheA is as shown in SEQ ID NO.5.

[0013] In the method for further co - culturing two bacteria for fermentative production of tyrosol, the starting strain of Escherichia coli is MG1655, and the glucose - 6 - phosphate dehydrogenase gene and tyrosine synthase gene are constructed using the pET28a vector plasmid.

[0014] The primers for G6PDH gene amplification are as shown in P1 and P2:

[0015] P1:CTTTAAGATATACCAAAGAGAGGAGCCATGGCGGTAACG

[0016] P2:GGTCAATTCAGCAACCATTTACTCAAACTCATTCCAGG.

[0017] The primers for tyrosine synthase gene amplification are as shown in P3 and P4:

[0018] P3:TGGAATGAGTTTGAGTAAATGGTTGCTGAATTGACCGCA

[0019] P4:CAGCCGGATCTCATTACTGGCGATTGTCATTC.

[0020] The primers for pET28a linearized vector fragment amplification are as shown in P5 and P6:

[0021] P5:TGAGATCCGGCTGCTAACAAAGCCCG

[0022] P6: GTTTGCGTTACCGCCATGGCTCCTCTCTTTGGTATATCTTA。

[0023] In the method for further co - culturing two bacteria for fermenting tyrosol production, the starting strain of the recombinant Saccharomyces cerevisiae is BY4741, and the tyrosine decarboxylase gene and phenylacetaldehyde reductase gene are constructed using the pRS426 vector plasmid.

[0024] The nucleotide sequence of the tyrosine decarboxylase AAS is as shown in SEQ ID NO.3, and the nucleotide sequence of the phenylacetaldehyde reductase PAR is as shown in SEQ ID NO.4.

[0025] Preferably, the amplification primers of the tyrosine decarboxylase gene are as shown in P7 and P8:

[0026] P7: ATGTGATCTCTTGAATGGACATTGAACAATTCAGAAA

[0027] P8: GGATTGCTTTCATTCATTCGGTAATAGTGCCATTGA.

[0028] The amplification primers of the phenylacetaldehyde reductase gene are as shown in P9 and P10:

[0029] P9: CTATTACCGAATGAATGAAAGCAATCCAATACACG

[0030] P10: ATCTCGAGTTAGGATTCACAAGCCTGGAACAACAA.

[0031] The amplification primers of the pRS426 linearized vector fragment are as shown in P11 and P12:

[0032] P11: AGATCTTTTGTTTGTTTATGT

[0033] P12: TTCCAGGCTTGTGAATCCTAACTCGAGATA.

[0034] Furthermore, in the method for co - culturing two bacteria for fermenting tyrosol production, the recombinant Saccharomyces cerevisiae is inoculated first, and then the recombinant Escherichia coli is inoculated into the two - bacteria fermentation system within 0 - 24 hours for fermentation.

[0035] Preferably, the recombinant Saccharomyces cerevisiae and the recombinant Escherichia coli are separately activated into seed solutions.

[0036] Furthermore, in the method for co - culturing two bacteria for fermenting tyrosol production, the inoculation ratio of the recombinant Saccharomyces cerevisiae and the recombinant Escherichia coli is 1:0.1 - 1:10 by volume ratio.

[0037] Preferably, the inoculation ratio of the recombinant Saccharomyces cerevisiae and the recombinant Escherichia coli is 1:5 by volume.

[0038] Furthermore, after inoculating the recombinant Saccharomyces cerevisiae seed liquid and the recombinant Escherichia coli seed liquid, IPTG is added for induction 4 - 12 h after fermentation.

[0039] Furthermore, the fermentation time of the dual - strain co - culture system after adding the inducer IPTG is 24 - 96 h.

[0040] Preferably, the fermentation time of the dual - strain co - culture system is more than 72 h.

[0041] 2. The application of the method for fermenting and producing tyrosol by the dual - strain co - culture described in any one of the above in the preparation of tyrosol is also within the scope protected by the present invention.

[0042] The beneficial effects of the present invention are as follows:

[0043] 1. In the present invention, genetic engineering transformation is carried out on Escherichia coli and Saccharomyces cerevisiae respectively. The recombinant Escherichia coli is obtained by overexpressing glucose - 6 - phosphate dehydrogenase G6PDH to regulate the glucose utilization pathway, overexpressing tyrosine synthase tyrA, and knocking out chorismate mutase pheA, blocking the metabolic shunt of chorismate to phenylalanine, forcing the carbon flow to concentrate on the tyrosine synthesis pathway, and achieving the purpose of directional transformation of Escherichia coli. The recombinant Escherichia coli TYR - 1 strain can produce 6.52 g / L of tyrosine by single fermentation.

[0044] 2. The recombinant Saccharomyces cerevisiae is obtained by introducing an exogenous pathway and overexpressing tyrosine decarboxylase AAS and phenylacetaldehyde reductase PAR, avoiding endogenous metabolic interference in the host, and efficiently converting tyrosine into tyrosol, with the conversion rate of tyrosine to tyrosol being as high as 90%.

[0045] 3. In the present invention, a dual - strain co - culture system of recombinant Escherichia coli and recombinant Saccharomyces cerevisiae is formed. For the first time, tyrosine synthesis and conversion are split into two independent bacterial populations, avoiding the inhibition of precursor accumulation by competitive metabolic pathways in a single - strain system, such as tyrosine feedback inhibiting the activity of key enzymes, significantly improving the overall pathway efficiency. Finally, tyrosol is directly produced using low - cost glucose or other sugar sources as substrates without adding precursors. The preparation method is simple, the production efficiency is improved, and the cost is reduced. Glucose and other sugar sources can be directly and efficiently synthesized into tyrosol, and the obtained tyrosol yield can reach 15.67 g / L, increasing the yield of de novo synthesized tyrosol, and providing a new route for the high - efficiency fermentation production of tyrosol by microorganisms.

[0046] 4. The growth rates of the two bacteria can be regulated. For example, Saccharomyces cerevisiae can grow preferentially to achieve a certain advantage, and Escherichia coli can be inoculated later and grow rapidly, so as to realize the growth of yeast first and then the delayed start of transformation, reduce the competition relationship between the strains, or use partitioned fermentation (such as a membrane bioreactor) to achieve metabolic relay, and achieve the synergistic effect of fermentation time sequence / space.

[0047] 5. The dual-bacteria co-culture system provided by the present invention directly uses tyrosine secreted by Escherichia coli as the substrate for yeast, eliminating the intermediate product extraction step; the consumption of tyrosine by yeast can relieve the feedback inhibition on Escherichia coli, forming a positive feedback cycle, thereby effectively establishing a "metabolite channel" between the bacterial populations, realizing in-situ substrate transfer, saving the single-bacteria sequential fermentation procedure, and greatly improving the production efficiency for industrial production. Brief Description of the Drawings

[0048] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the following drawings are provided for description:

[0049] Figure 1 It is a demonstration process diagram of the co-culture of recombinant engineered Escherichia coli TYR-1 and the recombinant engineered Saccharomyces cerevisiae TR01.

[0050] Figure 2 It is a map of the genetic engineering plasmid pET28-tyr.

[0051] Figure 3 It is a map of the genetic engineering plasmid pRS426-tyrosol.

[0052] Figure 4 It is a yield curve diagram of the synthesis of tyrosine by recombinant engineered Escherichia coli using glucose as the substrate.

[0053] Figure 5 It is a yield diagram of the synthesis of tyrosol using different sugar sources as substrates in the co-culture of the two bacteria.

[0054] Figure 6 It is a yield diagram of different inoculation ratios of the co-cultured two bacteria.

[0055] Figure 7 It is a yield diagram of tyrosol when recombinant engineered Escherichia coli TYR-1 and the recombinant engineered Saccharomyces cerevisiae TR01 are added simultaneously during the co-culture of the two bacteria.

[0056] Figure 8 It is a yield diagram of tyrosol when recombinant engineered Escherichia coli TYR-1 is added later during the co-culture of the two bacteria.

[0057] Figure 9 It is a yield diagram of tyrosol at different time points in the co-culture of the two bacteria. Detailed Embodiments

[0058] The following will clearly and completely describe the technical solutions of the preferred embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0059] In the experimental methods in the following embodiments, unless otherwise specified, they are all conventional methods. The test materials used in the following embodiments, unless otherwise specified, are all obtained from regular biochemical reagent stores. In the following embodiments, all quantitative tests are set with three repeated experiments, and the results are averaged. Unless otherwise specified in the following embodiments, the technical means used in the embodiments are conventional means well-known to those skilled in the art and commercially available common instruments and reagents. Reference can be made to "Molecular Cloning Experiment Guide (3rd Edition)" (Science Press), "Microbiology Experiment (4th Edition)" (Higher Education Press), and the manufacturer's instructions of the corresponding instruments and reagents.

[0060] In the method of the present invention, increasing the copy number of a certain gene can be achieved by constructing a recombinant plasmid containing the gene and then introducing the recombinant plasmid into the starting bacterium. These methods are commonly used in the art and will not be elaborated here.

[0061] The culture media used in the embodiments:

[0062] LB liquid medium: peptone 10.00 g / L, yeast extract 5.00 g / L, sodium chloride 10.00 g / L, pH = 7.00.

[0063] LB solid medium: peptone 10.00 g / L, yeast extract 5.00 g / L, sodium chloride 5.00 g / L, agar 20.00 g / L, pH = 7.00.

[0064] Seed medium: peptone 10.00 g / L, yeast extract 5.00 g / L, NaCl 10.00 g / L, ampicillin 100 mg / L.

[0065] Shake flask catalytic medium (M9 basal salts): disodium hydrogen phosphate 6.78 g / L, potassium dihydrogen phosphate 3 g / L, sodium chloride 0.5 g / L, ammonium chloride 1 g / L, Ca 2+ , Mg 2+ etc., glucose 20.00 g / L, ampicillin 100 mg / L.

[0066] Fermenter catalytic medium: disodium hydrogen phosphate 6.78 g / L, potassium dihydrogen phosphate 3 g / L, sodium chloride 0.5 g / L, ammonium chloride 1 g / L, Ca 2+ , Mg 2+etc., glucose 20.00 g / L, ampicillin 100 mg / L.

[0067] Preparation of mixed liquid medium for co-cultivation of two bacteria:

[0068] Medium 1: 6.78 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, Ca2+, Mg2+, tryptone (10 g / L), yeast extract (12 g / L), NaCl (5 g / L) and glucose (50 g / L);

[0069] Medium 2: 6.78 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, Ca2+, Mg2+, tryptone (10 g / L), yeast extract (12 g / L), NaCl (5 g / L) and sucrose (50 g / L);

[0070] Medium 3: 6.78 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, Ca2+, Mg2+, tryptone (10 g / L), yeast extract (12 g / L), NaCl (5 g / L), sucrose (25 g / L) and glucose (25 g / L).

[0071] The above media were autoclaved at 121 °C for 20 min, and ampicillin and kanamycin were added to make their final concentrations 50 μg / mL and 35 μg / mL respectively.

[0072] Transformation of Escherichia coli competent cells by heat shock method: First, take 10 μL of the ligation product and add it to 100 μL of freeze-thawed competent cells, and incubate on ice for 20 min; then place the competent cells in a 42 °C metal bath for heat shock for 90 s, quickly place on ice, and incubate on ice for 5 min; then add 1 mL of fresh LB liquid medium, and incubate at 37 °C with shaking for 60 min; finally, take 200 μL of the bacterial solution and spread it on an LB solid plate with corresponding resistance, and culture overnight at 37 °C.

[0073] Preparation of Saccharomyces cerevisiae competent cells and transformation by electroporation method: ① Pick a single colony and inoculate it into 5 mL of YPD liquid medium, and place it in a constant temperature shaker with a rotation speed of 200 rpm and a temperature of 30 °C for overnight culture; ② Take 1 mL of the bacterial solution and transfer it to 50 mL of YPD medium, and culture it under the same conditions until OD 600It is about 1.3 to 2; ③ Transfer to a 50 mL sterilized centrifuge tube, ice-bath for 10 min, centrifuge at 2500 rpm, and recover the cells; ④ Suspend the bacterial solution with 30 mL of pre-cooled sterilized water, centrifuge at 4 °C and 2500 rpm for 1 min, and discard the supernatant; ⑤ Resuspend the cells with 30 mL of pre-cooled 1 M sorbitol solution, centrifuge at 4 °C and 2500 rpm for 10 min, and discard the supernatant; ⑥ Dissolve the precipitate in 200 μL of sorbitol solution, transfer it to a pre-cooled 1.5 mL centrifuge tube, and thus prepare the Saccharomyces cerevisiae competent cells. ⑦ Take 5 μL of plasmid or 10 μL of concentrated linear fragment, add it to 50 μL of competent cells, ice-bath for 5 min, and transfer it to a pre-cooled 1 mm sterile electroporation cuvette; ⑧ Perform electroporation on the electroporation cuvette at a voltage of 750 V / mm, then immediately add 1 mL of YPD medium, suspend the cells and transfer them to a 1.5 mL centrifuge tube, and let them recover statically in a 30 °C incubator for 2 h; ⑨ Wash the recovered cells with sterile water, take 200 μL and spread it on a solid YPD / SD agar plate with the corresponding resistance or auxotrophic selection marker, and culture it at 30 °C.

[0074] G6PDH: Glucose-6-phosphate dehydrogenase;

[0075] tyrA: Tyrosine synthase;

[0076] AAS: Tyrosine decarboxylase;

[0077] PAR: Phenylacetaldehyde reductase.

[0078] Construction and Yield Detection of Recombinant Escherichia coli Producing Tyrosine in Example 1

[0079] 1. The specific steps for constructing the recombinant Escherichia coli producing tyrosine are as follows:

[0080] Through screening in the NCBI database, the corresponding G6PDH gene (SEQ ID NO.1, Genebank accession number: NZ_CP059929.1) from Escherichia coli MG1655 was selected, and the corresponding G6PDH fragment was obtained by full gene synthesis through Beijing Tsingke Biotechnology Co., Ltd.; similarly, the tyrA gene was selected from Escherichia coli MG1655, and the tyrA fragment (SEQ ID NO.2, NC_004431.1) was obtained by full gene synthesis.

[0081] G6PDH gene SEQ ID NO.1:

[0082]

[0083] The tyrA gene SEQ ID NO.2: 1122bp

[0084]

[0085] 2. The high-fidelity polymerase TaKaRa Ex Taq was purchased from Takara Biotechnology (Beijing) Co., Ltd. Using the vector of the synthesized G6PDH gene sequence as a template and P1 and P2 as primers, PCR amplification was carried out according to the PCR reaction system in Table 1 and the PCR reaction program in Table 2 as follows:

[0086] Table 1 PCR reaction system

[0087]

[0088] Table 2: 3 step PCR

[0089]

[0090] The G6PDH gene was amplified to obtain PCR product 1 with a length of 1521 bp. Similarly, using the vector of the synthesized tyrA gene sequence as a template and P3 and P4 as primers, the tyrA gene was amplified to obtain PCR product 2 with a length of 1153 bp. Similarly, using pET28a as a template and P5 and P6 as primers, the linearized vector fragment of pET28a was amplified to obtain PCR product 3 with a length of 5233 bp. The above 3 PCR products were purified for later use.

[0091] The primers used above are as follows (5’-3’):

[0092] P1:CTTTAAGATATACCAAAGAGAGGAGCCATGGCGGTAACG

[0093] P2:GGTCAATTCAGCAACCATTTACTCAAACTCATTCCAGG

[0094] P3:TGGAATGAGTTTGAGTAAATGGTTGCTGAATTGACCGCA

[0095] P4:CAGCCGGATCTCATTACTGGCGATTGTCATTC

[0096] P5:TGAGATCCGGCTGCTAACAAAGCCCG

[0097] P6:GTTTGCGTTACCGCCATGGCTCCTCTCTTTGGTATATCTTA。

[0098] 3. Ligate the purified PCR product fragment 1 and PCR product fragment 2 in a seamless cloning manner to form a single fragment, obtaining the linearized fragment 4. Further, ligate the linearized fragment 4 with the pET28a linearized vector PCR product 3 to obtain the recombinant plasmid pET28a-tyr (the plasmid map is as shown in Figure 2 ). Further transform the recombinant plasmid pET28a-tyr into Escherichia coli DH5α to obtain the engineered strain pET28a-tyr-DH5α. In this example, the SuperFusionCloning Mix (2x) seamless cloning kit purchased from UE Biotechnology Co., Ltd. was used. The specific experimental steps are as follows:

[0099] Table 3 Prepare the following reaction system (10 μl) in an ice-water bath

[0100]

[0101] 3.1: After preparing the reaction system according to Table 3 in an ice-water bath, gently pipette several times to mix each component, avoiding generating bubbles, and do not vortex. Place the reaction system at 50 °C for 15 - 60 min. Place the reaction tube in an ice-water bath to cool, and directly proceed with transformation or store at -20 °C.

[0102] 3.2: Transformation of the cloning product: Add 5 - 10 μL of the reaction solution to 100 μL of competent cells, gently pipette to mix, and place on ice for 30 min. Heat shock at 42 °C for 45 - 60 s, and then place on ice for 5 min. Add 500 μL of SOC or LB liquid medium, and culture with shaking at 37 °C for 40 - 60 min (200 rpm). Spread the bacterial solution evenly on a plate containing the corresponding antibiotic, and incubate it upside down in a 37 °C incubator overnight.

[0103] 3.3: Detection of positive clones (colony PCR identification): Pick a single colony and mix it in 10 μL of dd H2O. Take 1 μL as a template for colony PCR identification, and send the positive result to Qingke Biotechnology Co., Ltd. for sequencing. Transfer the colonies with correct sequencing results to LB solid medium and culture at 37 °C for 12 hours to obtain the engineered strain pET28a-tyr-DH5α, and store it in glycerol at -80 °C.

[0104] Plasmid extraction: Operate using the Tiangen plasmid mini extraction kit to obtain the usable plasmid pET28a-tyr.

[0105] 4. Gene knockout: Using the principle of homologous recombination, the pheA gene (NC_000913.3) of Escherichia coli MG1655 was knocked out by the CRIPR-Cas9 method to obtain the strain MG1655 ΔpheA , and all the methods used are conventional operations in this field. The specific steps are as follows:

[0106] The Escherichia coli pheA gene sequence was determined using NCBI (NCBI Reference Sequence: NC_000913.3), and single-guide RNA (sgRNA) was designed to target a specific site (5'-3') of this gene:

[0107] sgRNA: GATGGGAATAAGAACCTTTGGGG; SEQ ID NO.5.

[0108] The flanking 500-bp genomic sequences upstream and downstream of the pheA gene in Escherichia coli MG1655 were selected, and a knockout plasmid was designed. All operations were performed using the GeneArt CRISPR Nuclease Vector - OFP_gRNA gene knockout kit to obtain the knockout plasmid CRISPR-pheA-OUT.

[0109] Furthermore, the designed gene knockout plasmid CRISPR-pheA-OUT was transformed into Escherichia coli MG1655 competent cells by the following method to obtain the genetically engineered strain MG1655 ΔpheA , and the specific operations were as follows: Take a streaked plate, pick a single colony from it, inoculate it into 10 mL of LB liquid medium, and culture it overnight at 37 °C with 180 rpm. Then, transfer the overnight culture (1% inoculum) to 50 mL of LB liquid medium and culture it at 37 °C with 180 rpm until the OD 600 reaches 0.4 - 0.6. Transfer the bacterial liquid to a 50 mL sterile centrifuge tube in a laminar flow hood, centrifuge at 4 °C and 5500 rpm for 8 min, and discard the supernatant in the laminar flow hood. Then, add an appropriate amount of pre-cooled sterile CaCl2 solution (0.1 M), gently pipette the bacteria on the tube wall to suspend them, and immediately place them on ice for 30 min; then, centrifuge at 4 °C and 5500 rpm for 5 min to collect the bacteria, and discard the supernatant in the laminar flow hood. Resuspend the cells with an appropriate amount of pre-cooled sterile CaCl2 glycerol solution (0.1 M CaCl2, 15% glycerol) according to the amount of bacteria, aliquot 100 μL per tube on ice, and use immediately or store at -80 °C for later use.

[0110] The plasmid CRISPR-pheA-OUT was transformed into the competent cells of strain MG1655 by the chemical method to obtain the genetically engineered strain MG1655 ΔpheA , and the specific operations were as follows: The specific operations were as follows:

[0111] Add 1 μL of plasmid to 100 μL of competent cells, gently pipette and mix well, place on ice for 30 min, heat shock at 42 °C for 45 - 60 s, and then place on ice for 5 min. Add 500 μL of SOC or LB medium, incubate with shaking at 37 °C for 40 - 60 min (200 rpm). Spread the bacterial solution evenly on a plate containing the corresponding antibiotic, and incubate the plate upside down in a 37 °C incubator overnight. Pick a single colony and transfer it to LB medium (containing 50 mg / L kanamycin sulfate), incubate at 37 °C for 12 hours, take the bacterial solution and store it at -80 °C for later use, thus completing the construction of the engineered strain MG1655 ΔpheA Construction.

[0112] 5. Transformation: Transform the plasmid pET28a-tyr into the gene knockout strain MG1655 ΔpheA competent cells by chemical method to obtain the genetically engineered strain TYR-1. The competent cells are prepared by chemical method, which are all conventional operations in the art. The specific operations are as follows:

[0113] Add 1 μL of plasmid to 100 μL of competent cells, gently pipette and mix well, place on ice for 30 min, heat shock at 42 °C for 45 - 60 s, and then place on ice for 5 min. Add 500 μL of SOC or LB medium, incubate with shaking at 37 °C for 40 - 60 min (200 rpm). Spread the bacterial solution evenly on a plate containing the corresponding antibiotic, and incubate the plate upside down in a 37 °C incubator overnight. Pick a single colony and transfer it to LB medium (containing 50 mg / L kanamycin sulfate), incubate at 37 °C for 12 hours, take the bacterial solution and store it at -80 °C for later use, thus completing the construction of the engineered strain TYR-1.

[0114] 6. Inoculate the genetically engineered bacterium TYR-1 into LB liquid medium to obtain a seed solution. Inoculate the seed solution into the inorganic salt medium at a ratio of 1:50, add 50 g / L of glucose at 30 °C and 220 rpm, and ferment for 96 hours to obtain a fermentation broth. Use HPLC to measure the tyrosine yield in the fermentation broth, and the results are as Figure 4 shown.

[0115] The results show that after 96 hours of fermentation, the tyrosine yield of the recombinant engineered Escherichia coli TYR-1 can reach 6.52 g / L, while the tyrosine content increases slowly around 72 hours of fermentation and the glucose content level is low.

[0116] Example 2 Construction of recombinant Saccharomyces cerevisiae TR01

[0117] The specific steps for the construction of recombinant Saccharomyces cerevisiae TR01 are as follows:

[0118] 1. Through screening in the NCBI database, a tyrosine decarboxylase AAS from Petroselinum crispum and a phenylacetaldehyde reductase PAR from Rhodococcus were selected, and the corresponding fragments were obtained by total gene synthesis through Beijing Tsingke Biotechnology Co., Ltd.

[0119] 2. Using the vector of the synthesized AAS gene sequence as a template, PCR amplification was carried out with P7 and P8 as primers according to the PCR reaction system in Table 1 and the PCR reaction program in Table 2;

[0120] The AAS gene was amplified to obtain a 1503bp PCR product 5 fragment; similarly, using the vector of the synthesized PAR gene sequence as a template, the PAR gene was amplified with P9 and P10 as primers to obtain a 1076bp PCR product 6 fragment; similarly, using the vector pRS426 as a template, the linearized vector fragment of pRS426 was amplified with P11 and P12 as primers to obtain a 6531bp PCR product 7. The above 3 PCR products were purified for later use.

[0121] AAS gene SEQ ID NO.3: 1497bp

[0122]

[0123] PAR gene SEQ ID NO.4: 1047bp

[0124]

[0125] pET28a linearized vector: SEQ ID NO.6: 5209 bp

[0126]

[0127] The primers used above are as follows (5'-3'):

[0128] P7: ATGTGATCTCTTGAATGGACATTGAACAATTCAGAAA

[0129] P8: GGATTGCTTTCATTCATTCGGTAATAGTGCCATTGA

[0130] P9: CTATTACCGAATGAATGAAAGCAATCCAATACACG

[0131] P10: ATCTCGAGTTAGGATTCACAAGCCTGGAACAACAA

[0132] P11: AGATCTTTTGTTTGTTTATGT

[0133] P12: TTCCAGGCTTGTGAATCCTAACTCGAGATA.

[0134] 3. Ligate the purified PCR product fragment 5 and PCR product fragment 6 into a single fragment in a seamless cloning manner to obtain linearized fragment 8. Further, ligate linearized fragment 8 with the linearized pRS426 vector to obtain the recombinant plasmid pRS426-tyrosol (the plasmid map is as Figure 3 shown). Then, further transform the recombinant plasmid pRS426-tyrosol into Escherichia coli DH5α to obtain the engineered strain pRS426-tyrosol-DH5α. In this example, the Super Fusion Cloning Mix (2x) seamless cloning kit purchased from UE Biotechnology Co., Ltd. was used. The specific experimental steps are as follows:

[0135] 3.1: After preparing the reaction system according to Table 3 in an ice-water bath, gently pipette the components several times to mix them evenly, avoiding the generation of bubbles. Do not vortex. Place the reaction system at 50°C and react for 15 - 60 min. Place the reaction tube in an ice-water bath to cool, and directly proceed with transformation or store at -20°C.

[0136] 3.2: Transformation of the cloning product: Add 5 - 10 μL of the reaction solution to 100 μL of competent cells, gently pipette to mix evenly, and place on ice for 30 min. Heat shock at 42°C for 45 - 60 s, then place on ice for 5 min. Add 500 μL of SOC or LB medium, and incubate with shaking at 37°C for 40 - 60 min (200 rpm). Spread the bacterial solution evenly on a plate containing the corresponding antibiotic, and invert and culture overnight in a 37°C incubator.

[0137] 3.3: Detection of Positive Clones (Colony PCR Identification): Pick a single colony and resuspend it in 10 μL of ddH₂O. Take 1 μL as a template for colony PCR identification, and send the positive results to Qingke Biotechnology Co., Ltd. for sequencing. Transfer the colonies with correct sequencing results to YPD medium and culture them at 37 °C for 12 hours to obtain the engineered strain pRS426-tyrosol-DH5α, which is stored in glycerol at -80 °C.

[0138] 4. Transformation: Transform the plasmid pRS426-tyrosol into the competent cells of Saccharomyces cerevisiae BY4741 by the chemical method to obtain the genetically engineered strain TR01. The competent cells are prepared by the chemical method, which are all conventional operations in the art. The specific operations are as follows:

[0139] 4.1. Take 100 μL of BY4741 competent cells melted on ice, and sequentially add 1 μL of each of the pre-cooled target recombinant plasmids PDWZ0319 and PDWZ0320, 10 μL of Carrier DNA (98 °C, 5 min, quickly ice-bath, repeat once), and 500 μL of PEG / LiAc, and pipette several times to mix evenly. Incubate in a water bath at 30 °C for 30 min (invert 6 - 8 times to mix evenly at 15 min).

[0140] 4.2. Place the tube in a water bath at 42 °C for 15 min (invert 6 - 8 times to mix evenly at 7.5 min).

[0141] 4.3. Centrifuge at 5000 rpm for 40 s to discard the supernatant, resuspend with 400 μL of ddH₂O, and centrifuge for 30 s to discard the supernatant;

[0142] 4.4. Resuspend with 50 μL of ddH₂O and culture at 30 °C for 48 h.

[0143] 4.5. Take 100 μL of the bacterial solution and evenly spread it on an SD plate lacking ampicillin and Ura. Invert the plate and culture it overnight at 30 °C. Use a sterile pipette tip or inoculation loop to pick a single colony into 20 μL of SD medium and mix evenly. Directly take 1 μL as the PCR template. Inoculate the remaining bacterial solution of the PCR-positive colony into an SD medium lacking His and Ura and culture it overnight to obtain the engineered strain TR01, which is stored in glycerol at -80 °C.

[0144] Example 3 Synthesis of Tyrosol from Sugar Source by Dual-Bacteria Mixed System

[0145] Co-culture the recombinant engineered Escherichia coli TYR-1 described in Example 1 and the recombinant engineered Saccharomyces cerevisiae TR01, and the demonstration process is as Figure 1 shown.

[0146] 1. Preparation of TYR-1 seed culture: Pick a single colony of TYR-1 from an agar plate and inoculate it into 5 mL of LB liquid medium with 50 μg / mL kanamycin resistance. Place it in a constant temperature shaker at 200 rpm and 37 °C for 12 hours to make the OD 600 reach about 0.8 - 1.

[0147] 2. Preparation of TR01 seed culture: Pick a single colony of TR01 from an agar plate and inoculate it into 5 mL of LB liquid medium with 50 μg / mL ampicillin resistance. Place it in a constant temperature shaker at 200 rpm and 30 °C for 36 hours to make the OD 600 reach about 0.8 - 1.

[0148] 3. Preparation of mixed seed culture: Mix the TYR-1 seed culture and the TR01 seed culture in a volume ratio of 1:1 to obtain a mixed seed culture.

[0149] 4. Take 1 mL of the mixed seed culture and inoculate it into 50 mL of different media (Medium 1 - Medium 3). Ferment at 30 °C and 200 rpm for 6 h, then add 1 mM isopropyl-β-D-thiogalactoside (IPTG) for induction, and then continue to ferment at 30 °C and 200 rpm for 96 h. Take the supernatant to measure the yield of tyrosol. The results are as Figure 5 shown.

[0150] 5. Figure 5 The results show that the most suitable medium for co-culturing the two strains is Medium 1, which contains 50 g / L glucose. At this time, the yield of tyrosol synthesized from the glucose source in the co-culture system of the two strains is 12.2 g / L. When the medium is 50 g / L sucrose, the yield of tyrosol is 9.9 g / L. When the medium is glucose + sucrose, the yield of tyrosol is 10.7 g / L.

[0151] Example 4 Optimization of the co-culture system of two strains:

[0152] For parallel comparison, the preparation of the TYR-1 seed culture and the TR01 seed culture is the same as in Example 3.

[0153] 1. Optimization of inoculation ratio: Mix the TYR-1 and TR01 seed cultures in volume ratios of 10:1, 5:1, 2:1, 1:1, 1:2, 1:5, and 1:10 to obtain mixed seed cultures. Take 1 mL of the mixed seed culture and inoculate it into 50 mL of Medium 1. Ferment at 30 °C and 200 rpm for 4 h, then add 1 mM IPTG for induction, and then continue to ferment at 27 °C and 200 rpm for 96 h. Take the supernatant to measure the yield of tyrosol. The results are as Figure 6As shown, the yields are 12.32 g / L, 12.57 g / L, 13.15 g / L, 12.23 g / L, 12.02 g / L, 13.7 g / L, and 12.11 g / L in sequence.

[0154] 2. Optimization of inoculation time: Take 1 mL of TR01 seed liquid and inoculate it into 50 mL of Medium 1. Ferment at 30 °C and 200 rpm for 4 h, then add 1 mM IPTG for induction, and continue to ferment at 27 °C and 200 rpm for 96 h. Inoculate the Escherichia coli TYR-1 seed liquid at 0 h of fermentation and 12 h after the growth of Saccharomyces cerevisiae TR01 respectively. Take the supernatant to measure the yield of tyrosol. The results are as Figure 7 (0 h) and Figure 8 (12 h) shown. The results show that the yields of de novo synthesis of tyrosol in the dual-bacteria co-culture system with different inoculation times of Escherichia coli TYR-1 are 14.01 g / L and 14.82 g / L respectively.

[0155] 3. Optimization of fermentation time: Take 1 mL of mixed seed liquid (volume ratio 1:1) and inoculate it into 50 mL of Medium 1. Ferment at 30 °C and 200 rpm for 8 h, then add 1 mM IPTG for induction, and continue to ferment at 27 °C and 200 rpm for 24 h, 36 h, 48 h, 72 h, and 96 h. Take the supernatant to measure the yield of tyrosol. The results are as Figure 9 shown. The results show that the most suitable fermentation time for the dual-bacteria co-culture is more than 72 h. At this time, the yield of de novo synthesis of tyrosol in the dual-bacteria co-culture system is 15.67 g / L.

[0156] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A method for co-culturing two bacteria to ferment and produce tyrosol, characterized in that, A co-culture system was constructed using recombinant Escherichia coli and recombinant Saccharomyces cerevisiae to ferment and produce tyrosol using sugar sources as substrates; the recombinant Escherichia coli contains the glucose-6-phosphate dehydrogenase gene and the tyrosine synthase gene, and the chorismate mutase gene pheA was knocked out, and the recombinant Saccharomyces cerevisiae contains the tyrosine decarboxylase gene and the phenylacetaldehyde reductase gene.

2. The method for co-culturing two bacteria to ferment and produce tyrosol according to claim 1, wherein The sugar source is one or more of glucose, sucrose, fructose, and glycerol.

3. The method for co-culturing two strains for fermentative production of tyrosol according to claim 1, wherein The nucleotide sequence of glucose-6-phosphate dehydrogenase G6PDH is as shown in SEQ ID NO.1, and the nucleotide sequence of tyrosine synthase tyrA is as shown in SEQ ID NO.

2.

4. The method for co-culturing two strains for fermentative production of tyrosol according to claim 1, wherein The nucleotide sequence of the tyrosine decarboxylase AAS is as shown in SEQ ID NO.3, and the nucleotide sequence of the phenylacetaldehyde reductase PAR is as shown in SEQ ID NO.

4.

5. The method for co-culturing two bacteria to ferment and produce tyrosol according to any one of claims 1-4, characterized in that, The sgRNA sequence used to knock out the chorismate mutase gene pheA is as shown in SEQ ID NO.

5.

6. The method for co-culturing two bacteria to ferment and produce tyrosol according to claim 5, wherein The starting strain of the Escherichia coli is MG1655, and the glucose-6-phosphate dehydrogenase gene and the tyrosine synthase gene were constructed using the pET28a vector plasmid.

7. The method for co-culturing two bacteria to ferment and produce tyrosol according to claim 5, wherein The starting strain of the recombinant Saccharomyces cerevisiae is BY4741, and the tyrosine decarboxylase gene and the phenylacetaldehyde reductase gene were constructed using the pRS426 vector plasmid.

8. The method for co-culturing two bacteria to ferment and produce tyrosol according to claim 1, characterized in that, First, the recombinant Saccharomyces cerevisiae was inoculated, and then the recombinant Escherichia coli was inoculated into the dual-bacteria fermentation system within 0 to 24 hours for fermentation.

9. The method for co-culturing two bacteria to ferment and produce tyrosol according to claim 1, characterized in that, The inoculation ratio of the recombinant Saccharomyces cerevisiae and the recombinant Escherichia coli is 1:0.1 to 1:10 by volume.

10. Application of the method for fermenting and producing tyrosol by co-culturing the two bacteria according to any one of claims 1-9 in the preparation of tyrosol.