BS-qPCR detection system for shunt screening of cervical cancer

Abstract

The invention relates to a BS-qPCR detection system for shunt screening of cervical cancer. Comprising primer pairs with nucleotide sequences as shown in SEQ ID No: 1 and SEQ ID No: 2. And / or a primer pair with nucleotide sequences as shown in SEQ ID No: 3 and SEQ ID No: 4. And the primer pair is targeted to an LCR region of an HPV16 type or an HPV18 type. The LCR methylation level of the HPV is directly related to E6 / E7 expression, so that the primer combination aiming at the integration site can detect the non-methylated LCR copy number of the HPV so as to determine whether a patient with the HPV needs colposcopy or not, and the aim of shunt screening of cervical cancer is fulfilled.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and particularly relates to a BS-qPCR detection system for cervical cancer triage screening. Background Art

[0002] Cervical cancer is one of the most common malignant tumors of the female reproductive system, and its incidence and mortality rates have been on the rise in recent years. Research shows that the trend of younger onset of cervical cancer is becoming more and more obvious, and cervical cancer is the second leading cause of cancer death in women aged 20 to 39. Cervical cancer is a disease that can be effectively prevented and treated through early screening and triage. Through triage, precancerous lesions and early-stage cervical cancer can be detected earlier, so as to take timely treatment measures and improve the survival rate and quality of life of patients. Cervical cancer triage usually includes steps such as cytological examination, virological detection (such as HPV detection), and colposcopy. These examination methods can complement each other, improve the accuracy of diagnosis, and reduce the occurrence of misdiagnosis and missed diagnosis.

[0003] Human papillomavirus (HPV) belongs to the genus Papillomavirus of the family Papovaviridae, and is a non-enveloped circular double-stranded DNA virus. More than 96% of cervical cancers are closely related to high-risk HPV infections. Persistent infection with high-risk HPV (such as HPV types 16 and 18) causes cervical intraepithelial neoplasia (CIN), which can eventually progress to invasive cancer.

[0004] The HPV genome is about 8000 bp in length and consists of an early coding region (Early, E region), a late coding region (Late, L region), and a long control region (LCR). The E region encodes non-structural proteins, E1, E2, E4, E5, E6, and E7. The E1 and E2 proteins mainly regulate viral DNA replication and transcription. The E4 protein promotes viral replication and the release of viral particles. E6 and E7 encode oncoproteins, which bind to the apoptosis protein P53 and the cell cycle checkpoint protein Rb respectively, and mediate their degradation, resulting in cell cycle disorders. The late coding region (L region) encodes the structural proteins L1 and L2. L1 is the main component of the virus coat and is located on the outer layer of the virion. L2 is located on the inner layer of the virion. The LCR region contains the early promoter P97, which regulates the transcription of E6 / E7.

[0005] The currently mainly used cervical cancer triage screening methods include: 1) a high-risk human papillomavirus E6 / E7 region mRNA detection kit (PCR-fluorescent probe method), which qualitatively detects the mRNA of 14 high-risk HPV E6 / E7 regions in human cervical exfoliated cell samples. It is used to screen patients with ASC-US (atypical squamous epithelial cells of undetermined significance) results in cervical cytology examinations to determine whether colposcopy is needed (for the purpose of triaging the ASC-US population); 2) a host gene methylation kit, also used for the purpose of triaging the ASC-US population. However, in the first scheme, mRNA samples are easily degraded, with high requirements for sample collection, processing, and preservation links, and low detection sensitivity for self-sampled samples. In the second scheme, due to the different methylation levels of human genes in different regions, the results produced by these kits have strong heterogeneity, resulting in low specificity and sensitivity of the detection results. Summary of the Invention

[0006] The purpose of the present invention is to disclose a BS-qPCR detection system for cervical cancer triage screening to solve one or more technical problems existing in the prior art and provide at least one beneficial option or create conditions.

[0007] To achieve the above purpose, the present invention is realized through the following technical solutions: The first aspect of the present invention is to provide a primer combination for cervical cancer triage screening.

[0008] The second aspect of the present invention is to provide a BS-qPCR detection system containing the primer combination described in the first aspect of the present invention.

[0009] The third aspect of the present invention is to provide a kit containing the detection system described in the second aspect of the present invention.

[0010] The fourth aspect of the present invention is to provide a method for using the kit described in the third aspect of the present invention.

[0011] The primer combination described in the first aspect of the present invention includes at least one of the following primer pairs: (1) Forward primer P1 with a nucleotide sequence of 5'-TTATTATGTGTTAATGTTTTATATATTGT-3' (SEQ ID No:1) and reverse primer P2 with a nucleotide sequence of 5'-ATCTACTTTTATACTAACCAATTTCAAT-3' (SEQ ID No:2); (2)Forward primer P3 with the nucleotide sequence 5'-TTTTTTGGTGTATATAAGGTGTA-3' (SEQ ID No:3) and reverse primer P4 with the nucleotide sequence 5'-TTATATACACCATTTTCAATCCCAA-3' (SEQ ID No:4).

[0012] Through sequencing methylation analysis, it was found that the vast majority of the HPV genome was highly methylated after integration into the human genome and did not express the oncoproteins E6 / E7. Only the promoter P97 located in the LCR was hypomethylated and could continuously transcribe the regulatory region of E6 / E7. Since the methylation level of the LCR of HPV is directly related to the expression of E6 / E7, a primer combination for BS-qPCR was designed for this integration site to help detect the copy number of the unmethylated LCR of HPV to determine whether HPV patients need colposcopy (for the purpose of triaging the ASC-US population).

[0013] The PCR amplification method after bisulfite (BS) treatment uses sodium bisulfite to modify the unmethylated CpG sites in genomic DNA, converting the unmethylated cytosine (C) to uracil (U), while the methylated cytosine remains unchanged. This conversion ingeniously transforms the "modification information" (i.e., methylation status) into "base information", so that the hypomethylated LCR (promoter region) can be specifically distinguished and quantified by the BS-qPCR method, thereby predicting the expression of HPV E6 / E7 mRNA and achieving the prediction of the risk of cervical cancer occurrence.

[0014] The detection system described in the second aspect of the present invention includes the above primer combination.

[0015] In some embodiments of the second aspect of the present invention, the detection system is a qPCR detection system and further includes a qPCR premix, which contains a hot-start DNA polymerase, a double-stranded DNA specific dye, deoxynucleoside triphosphates, magnesium ions and a buffer.

[0016] Since the similarity of the LCR regions of different types of HPV is lower than that of the L1 gene used for typing and is highly specific, and the LCR region in the same type of HPV is very conservative, and the detection system is used for triage detection of HPV positive carriers, it has the advantage of high sensitivity.

[0017] The kit described in the third aspect of the present invention includes the above detection system.

[0018] In some embodiments of the third aspect of the present invention, the shown kit further includes a DNA methylation conversion reagent. The kit is used to detect the hypomethylated E6 / E7 promoter DNA in the LCR region of HPV. It is easy to use, and the requirements for sample processing and preservation are also lower than those for mRNA. Therefore, it avoids the problem of high technical threshold existing in the E6 / E7 region mRNA detection kits that are also used for cervical cancer isolation and screening on the market.

[0019] In some embodiments of the third aspect of the present invention, the shown kit further includes an internal reference forward primer P5 with the nucleotide sequence 5'-TGGTGATGGAGGAGGAGGTTTAGTAAGT-3' (SEQ ID No:5) and an internal reference reverse primer P6 with the nucleotide sequence 5'-ACCAATAAAACCTACTCCTCCCTTAA-3' (SEQ ID No:6). The kit uses β-actin (ACTB) as an internal reference gene to measure the relative expression level change of the target gene, and further helps to determine whether the sample provider belongs to high-risk personnel for cervical cancer.

[0020] The method for using the kit described in the fourth aspect of the present invention includes the following steps: 1) Collect cervical exfoliated cells of HPV patients; 2) Extract DNA from the exfoliated cells; 3) DNA methylation conversion; 4) Perform fluorescence quantitative PCR amplification on the conversion product; 5) Determine whether the HPV patient needs colposcopy through the CT value.

[0021] Compared with the prior art, the present invention has the following beneficial effects: The BS-qPCR detection system and kit of the present invention can be operated within 5 hours, and can provide a basis for triage screening for whether the patient needs colposcopy in the future. Compared with the commercially available kits for simply detecting E6 / E7 mRNA, it has the advantages of stable detection results and lower costs, and is suitable for popularization and use. Description of the Drawings

[0022] Figure 1 It is a schematic diagram of the conservation analysis of CpG sites and primer target selection in the LCR sequences of 739 HPV16 strains; Figure 2 It is a schematic diagram of the conservation analysis of CpG sites and primer target selection in the LCR sequences of 155 HPV18 strains; Figure 3 It is an electrophoresis diagram for verifying the specificity of the BS-qPCR primers of HPV16 type; Figure 4It is the electrophoresis diagram for verifying the specificity of BS-qPCR primers for HPV type 18; Figure 5 It is the electrophoresis diagram for verifying the sensitivity of BS-qPCR primers for HPV type 16 and HPV type 18; Figure 6 It is the ROC curve diagram of BS-qPCR primers for HPV type 16 in the detection of clinical cervical exfoliated cell samples. Specific implementation manners

[0023] For the molecular biology test methods not specifically described in the following examples, all are referred to "Molecular Cloning: A Laboratory Manual" (Third Edition) or carried out according to the methods and product specifications; the biological materials for the methods, unless otherwise specified, can be obtained from commercial channels.

[0024] Example 1: Design of primers.

[0025] As a high-risk type of HPV, it is analyzed from 739 HPV type 16 samples that there are 16 CpG methylation sites in its LCR promoter and enhancer regions that are very conservative (as Figure 1 shown, the conservation score is greater than 85.12%). Therefore, the methylation sites at positions d, e that are relatively close and conservative and the methylation sites at positions m, n, o are selected for the design of BS-qPCR primers. The nucleotide sequences of the No. 1 primer pair obtained by design are shown in SEQ ID No:1 and SEQ ID No:2. The expected length of the amplification product is 316 bp.

[0026] It is analyzed from 155 HPV type 18 samples that there are 15 CpG sites in its LCR promoter and enhancer regions (as Figure 2 shown). Among them, the conservation of 14 sites is greater than 98%. The methylation sites at positions c, d, e that are relatively close and conservative and the methylation sites at positions l, m are selected for the design of BS-qPCR primers. The nucleotide sequences of the No. 2 primer pair obtained by design are shown in SEQID No:3 and SEQ ID No:4. The expected length of the amplification product is 357 bp.

[0027] Using ACTB as an internal reference, the nucleotide sequences of the No. 3 primer pair obtained by design are shown in SEQ ID No:5 and SEQ IDNo:6.

[0028] Example 2: Construction of the BS-qPCR detection system.

[0029] (1) Manually synthesize the gene fragments of the unmethylated CpG sites targeted by the primer pairs 1 and 2 in Example 1 respectively to verify whether the detection system can achieve the detection purpose. The nucleotide sequences amplified by the primer pair 1 (P1, P2) and the primer pair 2 (P3, P4) are shown in SEQ ID No:7 and SEQ ID No:8 respectively. The underlined sequences in SEQ ID No:7 correspond to the binding regions of P1 and P2 respectively, and the underlined sequences in SEQ ID No:8 correspond to the binding regions of P3 and P4 respectively.

[0030] 5'-GTATTGTATGTATGTTGAATTAGTGTTGTTTGTTGTGTATATGTTTGTATGTGTTTGTATGTGTTTGTAAATATTAAGTTGTATGTGTGTTTGTATGTATGGTATAATAAATATGTGTGTATGTGTTTTTAAATGTTTGTGTAATTATTGTGTTATGTAATATAAATAAATTTATTGTTTTAATATTTATTAATTGTGTTGTGGTTATTTATTGTATATAAATTATATTTGTTATATTTTGTTTTTGTTTTATATATATTATATTTTGTAGTGTTAGTGGTTATTTTGTAGTTTTAATTGAATTTGGTTGTATGTTTTTTGGTATAAAATGTGTTTTTTTAAATAGTTTTATGTTAGTAATTATGGTTTAAATTTGTATGTTTTTTGTTTGTTATGTGTGTTAAATTTTTGTTTTTTTGATTTGTATTGTTTGTTAATTATTTTATTGTTTTTTATATTGTATTATGTGTAATTATTGAATTATTATGTATATTGTGTTATATAAAATAAA TTATTATGTG TTAATGTTTTATATATTGTTGTTAGGTATATATTTTTGGTTTGTTTTAATTAATTTAATTGTATATTTGGTATAAGGTTTAAATTTTTAAGGTTAATTAAATGTTATTTTAGTTTATATATGAATTGTGTAAAGGTTAGTTATATATTGTTTATTTGTAAAATTGTATATGGGTGTGTGTAAATTGTTTTGGGTTATATATTTATAAGTAATTTATATAATAATATTAAATTATAATAATTTATGTATAAAATTAAGGGTGTAATTGAAATTGGTTGA ATTGAAATTGGTTAGTATAAAAGTAG AT ATTTTATGTATTAAAAGAGAATTGTA-3' (SEQ ID No:7).

[0031] 5'-TATGTGTGTGTGTATATATATATATATTTATTGTTGTGTTTGTATGTTTTGTGTTTGTGTTTGTTGTATGATTGTATTGTATGGTATGTATGGTTGTTGTTGTATGTTGTATGTTATTATATTTGTTGGTATGTGGTATTAAATAAAATATGTTTTGTGGTTTTGTGTGTTATGTGGTTGTGTTTTAGTGAGTAATAATTGTATTTGTGTTTGTGGTATGGGTGTTGTTTGTTGGGTTATATATTGTTTTGTATTTTAAGTTATAAAATTGTATATTTTATAGTATTTATTTTATTTTATAATTTTTTATTTTGTTGTGTAATTGATTTTGGTTGTTTTTGGTTTATGTTTGTGGTTTTTTGTATAATATAGTATGTTGGTATTATTGTAAATTTTAATTTTTTGGGTATTGTTTTTATATATTTTGAATAATTGGTGTGT TTTT TTGGTGTATATAAGGTGTATTTGGTATTAGTTATTTTTTTGTTTAGGTGTGTTATAATAATTGTTTGTATAATTATATTTATTTTTTAAGTAATAAAATTGTTTTTAGGTATATATTTTAGTTTGTTTTTATTTAAGTTAATTGTATATTTGGTTTGTATAATTATTTTTATGTTTAATATTTTGTTTATTTTTAATATGAATTATAATATGATTAAGTTGTGTATATATAGTTTATGTAATTGAAATAGGTTGGGTAGTATATATTATATTTTTTATTAATATTTTTAATAATTGTAGTATATAAAAAAGGGAGTAATTGAAAATGG TTGGGATTGAAAATGGTGTATATAA AAGATGTGAGAAATATATTATAATATT-3' (SEQ ID No:8).

[0032] (II). Preparation of reaction system: The total volume of the BS-PCR detection system is 10 μL, among which about 10 ng of the DNA sample after BS treatment is required, 0.4 μL of the upstream primer, 0.4 μL of the downstream primer, 5 μL of qPCR Master Mix, and the balance is made up with enzyme-free DEPC water.

[0033] The amplification program is shown in Table 1.

[0034]

[0035] The specific verification results of the HPV16 type BS-qPCR primers (P1 and P2) are as Figure 3 shown. DNA samples of the HPV16 type (CaSki), HPV18 type (HeLa) of the cervical cancer cell line and the HPV-negative cervical cancer cell line (C33A) are extracted for qPCR of the LCR region of the HPV16 type, and the amplification products are used for agarose gel electrophoresis. Figure 3 At (A) in the figure is the gel electrophoresis map of the DNA of CaSki cells after specific amplification of the HPV16-BS-qPCR primers after BS treatment. The positive control (non-methylated LCR DNA) is the LCR (labeled as HPV16-LCR) in the CaSki cells amplified by PCR. Figure 3 At (B) in the figure is the gel electrophoresis map of the DNA of cervical cancer cells (CaSki, C33A, Hela) after specific amplification of the HPV16-BS-qPCR primers after BS treatment. C33A (HPV-negative) and HeLa (HPV18 type) are used as negative controls, and the length of the amplified LCR positive fragment in CaSki cells is 316 bp.Figure 3 At position (C), the HPV16-BS-qPCR primers specifically amplified the DNA of cervical exfoliated cells from HPV16-positive patients, without cross-reactivity with the other 14 HPV types (types 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82). The samples were the DNA after bisulfite treatment of different types of HPV-LCR PCR products. These results indicated that the HPV16-type BS-qPCR primers (P1 and P2) were specific for the BS-converted HPV sequences.

[0036] The specific verification results of the HPV18-type BS-qPCR primers (P3 and P4) are as Figure 4 shown. DNA samples were extracted from the cervical cancer cell lines of HPV16 type (CaSki), HPV18 type (HeLa), and HPV-negative cervical cancer cell line (C33A) for qPCR of the HPV18-LCR region, and the amplification products were used for agarose gel electrophoresis. Figure 4 At position (A), the gel electrophoresis pattern showed the specific amplification of the DNA of HeLa cells treated with BS by the HPV18-BS-qPCR primers. The non-methylated DNA (LCR) positive control was the LCR (labeled as HPV18-LCR) amplified by PCR in HeLa cells. Figure 4 At position (B), the gel electrophoresis pattern showed the specific amplification of the DNA of cervical cancer cells (Hela, C33A, CaSki) treated with BS by the HPV18-BS-qPCR primers. C33A (HPV-negative) and CaSki (HPV16 type) were used as negative controls, and a 357-bp positive LCR fragment was amplified in HeLa cells. Figure 4 At position (C), the HPV18-BS-qPCR primers specifically amplified the DNA of cervical exfoliated cells from HPV18-positive patients, without cross-reactivity with the other 14 HPV types (16, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, 82). The samples were the DNA after bisulfite treatment of different types of HPV-LCR PCR products. These results indicated that the HPV18-type BS-qPCR primers (P3 and P4) were specific for the amplification of BS-converted HPV sequences.

[0037] The HPV-LCR PCR products were serially diluted 10-fold from 10 ng / μL to 10 -6 ng / μL to detect the sensitivity of BS-qPCR amplification. The detection results are as Figure 5 shown. The detection sensitivities of both sets of BS-qPCR primers (P1 and P2, P3 and P4) reached 1×10 -2 ng / μL DNA.

[0038] Example 3: Clinical Detection.

[0039] (I). Sample Treatment: (1) According to the cervical cancer screening guideline method, cervical exfoliated cells of 48 HPV patients were collected and placed in 2 mL of sample collection solution containing methanol and disodium ethylenediaminetetraacetate. The samples of each patient were evenly divided and used for control with the BS-qPCR detection system and the E6 / E7 region mRNA detection kit respectively.

[0040] (2) The QIAGEN DNA extraction kit was used to extract DNA from the cells, which was dissolved in 50 μL of DEPC water, and the DNA concentration was detected for standby.

[0041] (3) The DNA was treated with BS. 130 μL of BS conversion reagent and 20 μL of DNA were added into a 200 μL PCR tube, incubated at 98 °C for 10 minutes, and then incubated at 64 °C for 2.5 hours.

[0042] (4) The PCR tube was placed in a centrifuge and centrifuged at 12000 rpm for 10 minutes, and the supernatant was aspirated for standby.

[0043] (II). BS-qPCR Detection The BS-qPCR detection system was constructed according to the configuration provided in Example 2 and the samples were detected.

[0044] (III). Result Interpretation: ΔCT = CT （HPV-LCR） -CT （ACTB） CT （HPV-LCR） is the CT value measured by amplifying the sample with primer pair 1 or primer pair 2, and CT （ACTB） is the CT value measured by amplifying the sample with primer pair 3. ΔCT represents the relative cycle number of LCR and ACTB detection. The larger the ΔCT value, the lower the initial copy number of hypomethylated HPV-LCR. The clinical detection results of 48 HPV patients are shown in Table 2.

[0045]

[0046]

[0047] (IV). Result Analysis: The pathological diagnosis results of the above 48 samples were divided into two groups: low-grade lesions and high-grade lesions / cancer. The detection results (i.e., ΔCt values) of the two groups were analyzed by ROC curve using SPSS statistical software, and the ROC curve was obtained (as shown in Figure 6 ), and at the same time, the results of the diagnostic efficacy of the following BS-qPCR detection method were calculated by SPSS software (as shown in Table 3).

[0048]

[0049] Use the ROC curve to determine the Cut-off value of ΔCT for high-risk cervical cancer. The results show that samples with a ΔCT value ≤ 6.005 are high-risk samples, and it is recommended to perform further examinations (such as colposcopy) to obtain a clear diagnosis and treatment as early as possible. Samples with a ΔCT value > 6.005 are low-risk samples, and it is recommended to review them with the results of other auxiliary examinations and conduct regular reexaminations.

[0050] Comparative Example 1: Detection effect of a high-risk human papillomavirus E6 / E7 region mRNA detection kit (PCR-fluorescent probe method).

[0051] (1). Sample treatment: (1) Obtain cervical exfoliated cells from 37 HPV patients.

[0052] (2) Use the kit of Kap Biosystems to extract RNA with a volume of 10 μL. The extracted sample RNA needs to be immediately used for RT-PCR amplification detection.

[0053] (2). Reagent preparation and amplification: The total reaction volume is 25 μL per person, including 5 μL of the sample, 19.5 μL of the RT-PCR mixture, and 0.5 μL of the enzyme mixture. One positive control and one blank control need to be set for each reaction.

[0054] Set the reporter fluorescence and quenching fluorescence of the two fluorescence detection channels according to Table 4; select none for Passive Reference.

[0055]

[0056] Set the program on the fluorescence PCR instrument according to Table 5.

[0057]

[0058] The result comparison between Example 3 and Comparative Example 1 is shown in Tables 6 and 7.

[0059]

[0060]

[0061]

[0062] As can be seen from Table 6 and Table 7, the positive likelihood ratio of the BS-qPCR detection system provided by the present invention is as high as 6.8, far higher than 3.0 of the commercially available similar products, reflecting that the BS-qPCR detection system has a reliable auxiliary effect in the shunt screening of HPV patients and high-grade lesions, cancer, etc.

[0063] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and without departing from the spirit or basic characteristics of the present invention, the present invention can be implemented in other specific forms. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, it is intended to embrace all changes falling within the meaning and scope of the equivalent elements of the claims in the present invention.

Claims

1. A primer combination, characterized in that, Comprising at least one pair of the following primer pairs: (1) Forward primer P1 with a nucleotide sequence as shown in SEQ ID No:1 and reverse primer P2 with a nucleotide sequence as shown in SEQ ID No:2; (2) Forward primer P3 with a nucleotide sequence as shown in SEQ ID No:3 and reverse primer P4 with a nucleotide sequence as shown in SEQ ID No:

4.

2. Use of the primer combination according to claim 1 in cervical cancer triage screening.

3. A detection system, characterized in that, Comprising the primer combination according to claim 1.

4. The detection system according to claim 3, wherein The detection system is a qPCR detection system and further comprises a qPCR premix, and the qPCR premix contains a hot-start DNA polymerase, a double-stranded DNA specific dye, deoxynucleoside triphosphates, magnesium ions and a buffer.

5. Use of the detection system according to claim 3 or 4 in cervical cancer triage screening.

6. A kit, characterized in that, Comprising the detection system according to claim 3 or 4.

7. The kit according to claim 6, wherein Further comprises an internal reference forward primer P5 with a nucleotide sequence as shown in SEQ ID No:5 and an internal reference reverse primer P6 with a nucleotide sequence as shown in SEQ ID No:

6.

8. The kit according to claim 6, wherein Further comprises a DNA methylation conversion reagent.

9. Use of the kit according to any one of claims 6 to 8 in cervical cancer triage screening.

10. The method of using the kit according to claim 6, characterized in that, Comprising the steps: 1) Collecting cervical exfoliated cells of HPV patients; 2) Extracting DNA from the exfoliated cells; 3) DNA methylation conversion; 4) Performing fluorescence quantitative PCR amplification on the conversion product; 5) Judging whether the HPV patient needs colposcopy by the CT value.

Images