QRT-PCR (quantitative reverse transcription-polymerase chain reaction) kit for rapidly detecting squamous cell lung carcinoma or early lung cancer as well as application and detection method of qRT-PCR kit
The qRT-PCR kit detects SCGB3A1 gene expression, which solves the problem of low diagnosis efficiency in early lung cancer, achieves rapid and accurate screening and diagnosis of lung cancer, and improves the treatment effect and survival rate.
Patent Information
- Application Number
- CN202510465807.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-11
AI Technical Summary
The existing early-stage lung cancer diagnosis technology is inefficient and lacks high sensitivity and specific molecular markers, which leads to difficulties in early screening and diagnosis of lung cancer and missed the golden treatment period.
A qRT-PCR kit is provided, which contains reverse transcription reagents and PCR reaction reagents. Using upstream and downstream primers of the SCGB3A1 gene and β-actin as internal reference genes, the expression level of SCGB3A1 gene is detected by quantitative PCR amplification to achieve rapid and accurate diagnosis of early lung cancer and lung squamous cell carcinoma subtypes.
能够快速、准确地辅助肺癌筛查和诊断,提高早期诊断效率,帮助制定精准治疗方案,改善患者预后,实现无创检测和动态观察病情发展。
Smart Images
Figure CN120290723A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to a qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer, its use and detection method. Background Art
[0002] Lung cancer is one of the malignant tumors with the highest incidence and mortality rates globally and is a major challenge to global public health. In 2022, the newly diagnosed cases (2.48 million) and death cases (1.82 million) of lung cancer globally ranked first among all cancer cases. According to the data in the "Diagnosis and Treatment Guidelines for Primary Lung Cancer (2022 Edition)" and "Cancer Incidence and Mortality in China in 2016", lung cancer is the malignant tumor with the fastest growing incidence rate in China in the past 30 years. Whether male or female, lung cancer is the leading cause of cancer death.
[0003] Lung cancer has a hidden onset and rapid progression, and its early clinical features are usually not obvious. By the time specific symptoms appear, it has generally reached the middle and late stages, and the golden treatment period has been missed. Existing data shows that the 5-year survival rate of patients with middle and late stage lung cancer is about 10% - 20%, while the 5-year survival rate of patients with distant metastasis is less than 10%. However, the 5-year survival rate of patients with early lung cancer after clinical intervention is higher than 70%, and the 5-year survival rate of stage IA patients can be as high as 92%. Therefore, early detection and diagnosis are the keys to improving the cure rate and survival rate of lung cancer and reducing the mortality rate.
[0004] Since early lung cancer mostly has no obvious clinical features and signs, there is an extreme lack of effective screening methods and biomarkers for early lung cancer. Currently, the early clinical diagnosis of lung cancer mostly relies on technical means such as imaging and bronchoscopy. However, the efficiency of diagnosing early lung cancer using existing means is only about 15%. Therefore, the existing early diagnosis technologies cannot effectively achieve early diagnosis and treatment of lung cancer. Therefore, there is an urgent need to find and develop new effective molecular markers and detection means with high sensitivity and specificity to assist in the early screening and diagnosis of lung cancer, so as to reduce the mortality rate of lung cancer and improve the survival prognosis time and quality of patients. Summary of the Invention
[0005] Technical Problem
[0006] The present invention aims to provide a kit for rapid and accurate detection of early lung cancer and lung squamous cell carcinoma subtypes, which can help clinical lung cancer patients quickly identify the lung cancer subtype, thereby formulating a precise treatment plan, improving the efficiency of early diagnosis and treatment, and improving the prognosis of patients.
[0007] Technical Solution
[0008] The first aspect of the present invention provides a qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer, characterized in that the kit comprises a reverse transcription reagent, a PCR reaction reagent and a control product. The PCR reaction reagent comprises upstream and downstream primers of a lung cancer-related gene and upstream and downstream primers of an internal reference gene; the upstream and downstream primers of the lung cancer-related gene comprise the following primer pairs: SCBA-F: 3’-TGCTTTCTTAGTGGGCTCGG-5’; SCBA-R: 3’-CTATGAGGTGGTTCACGGGG-5’; the upstream and downstream primers of the internal reference gene comprise the following primer pairs: Actin-F: 3’-CCACGAAACTACCTTCAACTCC-5’; Actin-R: 3’-GTGATCTCCTTCTGCATCCTGT-5’.
[0009] In some embodiments, the lung cancer-related gene is SCGB3A1; the internal reference gene is β-actin.
[0010] In some embodiments, the control product is RNA extracted from normal lung tissue.
[0011] In some embodiments, the reverse transcription reagent comprises an oligo thymine primer, a random primer, nuclease-free deionized water, magnesium chloride (MgCl2), a PCR nucleotide mixture, a ribonuclease inhibitor and a reverse transcriptase; the reverse transcription reaction system comprises: 3 μL of 1 mg / mL total RNA, 1 μL of the oligo thymine primer, 1 μL of the random primer, 5 μL of nuclease-free deionized water, 4 μL of 5× reverse transcription buffer solution, 2 μL of magnesium chloride, 1 μL of the PCR nucleotide mixture, 0.5 μL of the ribonuclease inhibitor, 1.5 μL of nuclease-free deionized water and 1 μL of the reverse transcriptase.
[0012] In some embodiments, the PCR reaction reagent further comprises a qPCRMaster Mix; the PCR reaction system comprises: 0.5 μL of each pair of upstream and downstream primers, 1 μL of cDNA template, 10 μL of 2× qPCRMaster Mix and 8 μL of ultrapure water.
[0013] The second aspect of the present invention provides the use of the qRT-PCR kit according to any one of the above in the identification of early lung cancer for non-disease diagnosis and treatment purposes.
[0014] The third aspect of the present invention provides the use of the qRT-PCR kit according to any one of the above in the identification of lung squamous cell carcinoma for non-disease diagnosis and treatment purposes.
[0015] The fourth aspect of the present invention provides a method for detecting lung squamous cell carcinoma or early lung cancer, and the method is for non-diagnostic and therapeutic purposes; the method includes the following steps: (1) extracting total RNA from a sample; (2) reverse transcribing the extracted RNA to generate cDNA; (3) using the cDNA as a template, respectively performing quantitative PCR amplification with the upstream and downstream primers of the above-mentioned lung cancer-related genes and the upstream and downstream primers of the internal reference gene; (4) analyzing the amplification results of the quantitative PCR and making a judgment.
[0016] In some embodiments, the reaction procedure of the PCR amplification in step (3) is: pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 1 min, for a total of 45 cycles.
[0017] In some embodiments, the sample is bronchoalveolar lavage fluid, whole blood or lung tissue.
[0018] Technical effects
[0019] The present invention firstly discovers that the expression of SCGB3A1 has obvious changes in the early stage of lung cancer occurrence, and can significantly distinguish normal lung tissue from early lung cancer; and the expression of SCGB3A1 is significantly different in lung adenocarcinoma and lung squamous cell carcinoma. Based on this, the subtypes of lung squamous cell carcinoma can be significantly distinguished and diagnosed. The rapid and accurate diagnostic kit for detecting early lung cancer and subtypes of lung squamous cell carcinoma based on the expression level of the SCGB3A1 gene provided by the present invention can quickly, accurately and conveniently assist in the screening, early diagnosis of lung cancer in clinical patients and further diagnosis of subtypes of lung squamous cell carcinoma, so as to formulate a precise and effective treatment plan for clinical lung cancer patients, and improve the cure effect, survival time and quality of patients.
[0020] Specifically, the kit of the present invention can use bronchoalveolar lavage fluid or whole blood as a sample for lung cancer diagnosis, realizing non-invasive detection, facilitating the dynamic observation of the disease development, and selecting a new treatment plan according to the disease condition, while improving the patient compliance; in the early stage of lung cancer, there are usually no obvious symptoms. When symptoms appear, it is often in the middle and late stages, with poor treatment effect and low 5-year survival rate (less than 10%). The kit of the present invention assists in the early screening and diagnosis of lung cancer, and significantly improves the expected survival by seizing the treatment opportunity, which is of great significance for improving the survival rate and quality of life of patients. Description of the drawings
[0021] Figure 1A Shows the changes in the expression level of the SCGB3A1 gene in different lung cancer samples;
[0022] Figure 1B Shows the expression and diagnostic value of SCGB3A1 in NSCLC (non-small cell lung cancer) tissue samples from the TCGA database;
[0023] Figure 1CVerification of SCGB3A1 expression and diagnostic value in lung cancer and NSCLC tissue samples from the GEO database;
[0024] Figure 2A Melting curve graph during primer quantitative PCR amplification;
[0025] Figure 2B Melting peak graph during primer quantitative PCR amplification;
[0026] Figure 3A Expression of SCGB3A1 in normal lung tissue and lung abnormal tissues at different stages in clinical samples;
[0027] Figure 3B Expression changes of SCGB3A1 in lung cancer tissues with different tumor sizes (T), lymph node metastasis (N), and distant metastasis (M) from GEO - sourced samples;
[0028] Figure 3C Expression difference and diagnostic value of SCGB3A1 in adjacent - normal tissues of lung adenocarcinoma (LUAD) and adjacent - normal tissues of lung squamous cell carcinoma (LUSC) from the TCGA database;
[0029] Figure 4A Expression difference and diagnostic value of SCGB3A1 in LUAD and LUSC from the TCGA database compared with adjacent - normal tissues and between LUAD and LUSC tissues;
[0030] Figure 4B Verification of expression difference and diagnostic value of SCGB3A1 in LUAD and LUSC from the GEO database compared with adjacent - normal tissues and between LUAD and LUSC tissues;
[0031] Figure 5A Diagnostic value of SCGB3A1 expression changes in lung tissues of LUAD and LUSC patients and diagnostic value of differentiating LUSC patients from LUAD patients;
[0032] Figure 5B Diagnostic value of SCGB3A1 expression changes in bronchoalveolar lavage fluid of LUAD and LUSC patients and diagnostic value of differentiating LUSC patients from LUAD patients;
[0033] Figure 5C Diagnostic value of SCGB3A1 expression changes in whole - blood samples of LUAD and LUSC patients and diagnostic value of differentiating LUSC patients from LUAD patients. Detailed implementation methods
[0034] For the convenience of evaluating the technical solutions of the application, the terms and expressions involved in the present invention are generally described and defined as follows.
[0035] The term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or apparatus. Without further limitation, an element defined by the phrase "comprising an..." does not exclude the presence of additional identical elements in the process, method, article or apparatus comprising the element.
[0036] In each group of comparative experiments provided by the present invention, unless otherwise specified, except for the differences pointed out in each group, other experimental conditions, materials, etc. are kept consistent for comparability.
[0037] The reagents, instruments and equipment used in the embodiments of the present invention can be purchased from the market without detailed description.
[0038] The following further describes a qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer, its use and detection method provided by the present invention.
[0039] Example 1 Lung cancer diagnosis
[0040] In this embodiment, by collecting clinical tissue samples, including 10 normal lung samples and 20 NSCLC samples (including 10 LUAD samples and 10 LUSC samples), the expression of SCGB3A1 (whose CDS sequence is shown in SEQ ID NO.5) was analyzed (as Figure 1A shown). The expression of SCGB3A1 in lung cancer, including small cell lung cancer, non-small cell lung cancer (NSCLC) and its subtypes lung adenocarcinoma, lung squamous cell carcinoma and large cell lung cancer, as well as other lung cancer subtypes, was analyzed through the data analysis of the GEO database (as Figure 1B shown); the expression changes of SCGB3A1 in NSCLC (including LUAD and LUSC) were verified through the data of the TCGA (The Cancer Genome Atlas) database (as Figure 1C shown). It should be noted that NSCLC is the main type of lung cancer, accounting for about 85% - 90% of the total number of lung cancers; LUAD and LUSC are the main types of NSCLC, among which LUAD accounts for 50% - 60% of NSCLC; LUSC accounts for 25% - 30% of the total number of lung cancers. The TCGA database mainly contains the data sets of LUAD and LUSC, so only the information of LUAD and LUSC is included in the data analysis for the TCGA source.
[0041] 1) Method and data analysis
[0042] The SCGB3A1 expression matrix from the TCGA cohort was downloaded using the UCSC Xena database (http: / / xena.ucsc.edu / ). The expression matrix of the GSE30219 dataset was downloaded using the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ). The downloaded raw expression data were classified and grouped according to tissue type, and a scatter plot of individual values was drawn in Prism 8.0. The data were presented as median ± standard deviation (SD). The normality and homogeneity of variance of the data were detected, and then the T-test or non-parametric test was used to compare the differences between the two groups of data. When P < 0.05, the data between groups were considered to have statistical significance.
[0043] ROC curve analysis was performed on the expression of SCGB3A1. The sensitivity (Specificity%) was used as the ordinate, and 1 - specificity (1 - specificity%) was used as the abscissa. The higher the specificity and sensitivity, the higher the diagnostic value. The area under the ROC curve (AUC) was calculated to evaluate the diagnostic value of SCGB3A1 expression for NSCLC or lung cancer. The AUC index was as follows: AUC < 0.5 indicated no diagnostic value; 0.5 < AUC < 0.7 indicated diagnostic value; 0.7 < AUC < 0.9 indicated good diagnostic value; AUC > 0.9 indicated very good diagnostic value.
[0044] 2) Sources of clinical samples
[0045] Thirty clinical tissue samples were collected, including 10 normal samples and 20 NSCLC samples (including 10 LUAD samples and 10 LUSC samples). None of the tissue samples had been treated with radiotherapy, chemotherapy, etc. before surgery. Informed consent forms from the patients were obtained for all samples used in the study, and the study was approved by the ethics committee.
[0046] 3) qRT-PCR detection operation
[0047] mRNA extraction was performed using traditional Trizol (purchased from Invitrogen) reagent. RNA reverse transcription to synthesize cDNA was performed using the reverse transcription kit (GoScript TM Reverse Transcription System, A5001) from Promega Corporation. The specific operation is a commonly used technique in this field. The expression levels of SCGB3A1 in normal lung and lung cancer tissues were detected by qRT-PCR, using the qPCR Master Mix, the qRT-PCR reaction system is shown in Table 1, the PCR reaction program is shown in Table 2, and the primer sequences used in the reaction system are shown in Table 3.
[0048] Table 1 qRT-PCR reaction system
[0049] System materials Reagent volume Upstream primer / F 0.5 μL Downstream primer / R 0.5 μL cDNA template 1.0 μL qPCR Master Mix 10 μL, 2× <![CDATA[RNAase-free H2O]]> 8.0 μL
[0050] Table 2 RT-qPCR reaction program
[0051]
[0052] Table 3 Primers used in qRT-PCR analysis
[0053] Primer name Sequence (5’-3’) SCBA-F (SEQ ID NO.1) TGCTTTCTTAGTGGGCTCGG SCBA-R (SEQ ID NO.2) CTATGAGGTGGTTCACGGGG Actin-F (SEQ ID NO.3) CCACGAAACTACCTTCAACTCC Actin-R (SEQ ID NO.4) GTGATCTCCTTCTGCATCCTGT
[0054] 3) Result analysis
[0055] The mRNA expression levels of the SCGB3A1 gene in 14 normal tissues and 293 lung cancer tissues (including 124 LUAD, 59 large cell carcinomas, 61 LUSC, 21 small cell carcinomas, 24 carcinoids of the lung, and 4 other lung cancers) in GEO were analyzed, and then ROC curve analysis was performed. The LUAD and LUSC data in the TCGA database were combined and grouped into normal lung tissues (Normal) and tumor tissues (Tumor). Tumor tissues included LUSC and LUAD, collectively referred to as non-small cell lung cancer (NSCLC).
[0056] The analysis results of the GEO-derived dataset showed that the expression of the SCGB3A1 gene was significantly decreased in lung cancer and had very good diagnostic value (AUC = 0.9069, P < 0.0001, sensitivity was 90.10%, and specificity was 91.67%). The analysis of the TCGA-derived dataset indicated that the expression of the SCGB3A1 gene was significantly decreased in lung cancer and had diagnostic value (AUC = 0.6933, P < 0.001, sensitivity was 68.84%, and specificity was 69.44%). Among them, the expression of SCGB3A1 in the normal tissues adjacent to LUAD in the LUAD dataset and the normal tissues adjacent to LUSC in the LUSC dataset in the TCGA database was significantly different, and the normal tissues adjacent to LUAD and LUSC could be distinguished by the expression of SCGB3A1 ( Figure 3C ), suggesting that the expression of SCGB3A1 can be used as a diagnostic marker for pre-cancerous lesions of lung squamous cell carcinoma.
[0057] The expression of SCGB3A1 was significantly downregulated in lung cancer tissues, and further significantly downregulated in LUSC, but the expression change was not significant in LUAD. The above results indicate that the expression of SCGB3A1 can better distinguish lung squamous cell carcinoma tissues from normal lung tissues and has good diagnostic value.
[0058] The performance test results of the primers showed that (as Figure 2A and Figure 2B shown in the melting curve graph and melting peak graph), the primer amplification products provided by the present invention had good specificity.
[0059] Example 2 Early Lung Cancer Diagnosis
[0060] In this example, by analyzing the expression differences of SCGB3A1 in normal lung tissues and lung abnormal tissues at different stages, the value and application of SCGB3A1 in lung cancer screening and early diagnosis were evaluated.
[0061] 1) Sources of Clinical Samples
[0062] A total of 40 clinical lung tissue samples at different stages were independently collected, including 3 normal lung tissue samples (Normal), 5 atypical hyperplasia lung tissue samples, 7 carcinoma in situ tissue samples, 10 early stage lung cancer tissue samples, and 20 advanced stage lung cancer tissue samples. All tissue samples had not received radiotherapy, chemotherapy, etc. before surgery. The selected samples had detailed clinical characteristics and pathological diagnosis data, which were determined by at least 2 pathologists. This study passed the review and approval of the medical ethics committee and obtained the informed consent forms signed by the patients.
[0063] 2) Materials and Methods
[0064] Total RNA was extracted from the samples at each stage of collection, reverse transcribed into cDNA, and the expression level of the SCGB3A1 gene was detected by qRT-PCR. The operation method was the same as that in Example 1. For the tissue data obtained from the GEO database, the samples were grouped according to the tumor TNM stage, and the expression differences of SCGB3A1 in patients with different clinical stages were analyzed. Among them, the T stage represents the size of the primary tumor, including four grades from T1 to T4. The larger the number, the larger the volume of the tumor. The N stage represents lymph node metastasis, including four grades from N0 to N3. Among them, N0 represents no lymph node metastasis, and the larger the number from N1 to 3, the more local lymph node metastasis. The M stage represents distant metastasis, including M0 and M1. Among them, M0 represents no metastasis, and M1 represents metastasis. Clinically, lung cancer is divided into different clinical stages by combining the three TNM indicators. The expression of SCGB3A1 in LUAD and LUSC tissues and corresponding adjacent normal tissues from TCGA was analyzed.
[0065] 3) Result analysis
[0066] The expression of SCGB3A1 was significantly down-regulated in carcinoma in situ, early-stage lung cancer, and late-stage lung cancer tissues ( Figure 3A ). Although there was no statistical significance in the expression in atypical hyperplasia lung tissues, there was a downward trend, which might be related to the small sample size (only 5 cases, and it was extremely difficult to collect tissues at this stage). These results suggest that the expression of SCGB3A1 has changed significantly in the early stage of lung cancer development, and it can clearly distinguish normal lung tissues from early-stage lung cancer and even precancerous lesion tissues.
[0067] The SCGB3A1 expression matrix was extracted from 307 tissues in the GEO-GSE30219 dataset according to the T, N, and M stages, and the differential analysis of SCGB3A1 expression was performed. The analysis results showed that the expression of SCGB3A1 decreased with the increase of TNM stage ( Figure 3B ); indicating that the expression level of the SCGB3A1 gene decreased significantly with the increase of the malignancy degree of lung cancer, suggesting that SCGB3A is a significant tumor suppressor molecule.
[0068] The analysis of the expression of SCGB3A1 in adjacent normal tissues of LUAD and LUSC from the TCGA database showed that its expression level in LUSC was significantly lower than that in LUAD, and it had good diagnostic value ( Figure 3C ). The detection results suggest that SCGB3A1 has changed significantly at the precancerous stage of lung squamous cell carcinoma and is very likely to be used as a screening marker for precancerous lesions of lung squamous cell carcinoma.
[0069] Example 3 Subtype differentiation and diagnosis of lung cancer
[0070] In this embodiment, by detecting the expression of SCGB3A1 in clinically matched lung tissues, bronchoalveolar lavage fluids, and whole blood samples and performing ROC curve analysis, combined with the verification of database data, the value and application of SCGB3A1 in differentiating and diagnosing lung cancer subtypes LUAD and LUSC were evaluated.
[0071] 1) Sources of clinical samples
[0072] Thirty-five normal individuals or adjacent normal tissues, and lung tissues, bronchoalveolar lavage fluids, and whole blood samples corresponding to 40 lung cancer patients were collected. The tissue samples and the corresponding bronchoalveolar lavage fluids and whole blood had detailed pathological and clinical data information. The tissue samples were diagnosed by at least two pathologists. All samples had not undergone radiotherapy, chemotherapy, or other treatments before sampling. Informed consent was obtained from the patients, and the sampling was approved by the ethics committee.
[0073] 2) Materials and methods
[0074] The method described in Example 1 was used for tissue RNA extraction.
[0075] For the RNA extraction of bronchoalveolar lavage fluids and whole blood samples, the VAMNE Magnetic Pathogen DNA / RNA kit from Vazyme was used. The operation steps were carried out according to the instructions. After centrifuging the whole blood samples (containing anticoagulants) and bronchoalveolar lavage fluids, they were transferred to tubes containing lysis buffer for pretreatment and lysis. The specific operation steps for RNA extraction were carried out according to the instructions. The extracted RNA was reverse-transcribed using the method described in Example 1. qRT-PCR was used to detect the expression of SCGB3A1 in lung tissues and the corresponding bronchoalveolar lavage fluids and whole blood samples. ROC curve analysis was performed to evaluate the diagnostic value of SCGB3A1 expression in lung cancer tissues (NSCLC), LUAD, and LUSC.
[0076] For the data from TCGA and GEO, the expression matrix of SCGB3A1 in LUAD and LUSC was extracted, the expression changes of SCGB3A1 in LUAD and LUSC were analyzed, and ROC curve analysis was performed.
[0077] 3) Result analysis
[0078] A) The analysis of the expression of SCGB3A1 in clinical tissue samples showed that the expression of SCGB3A1 was significantly downregulated in NSCLC and had good diagnostic value ( Figure 5A , AUC = 0.865). The expression of SCGB3A1 was also significantly downregulated in LUAD and had good diagnostic value ( Figure 5A , AUC = 0.765); the expression of SCGB3A1 was significantly downregulated in LUSC and also had good diagnostic value ( Figure 5A, AUC = 0.928). The expression of SCGB3A1 in bronchoalveolar lavage fluid and whole blood samples can diagnose LUAD, with AUC values of 0.615 and 0.598 respectively( Figure 5B - Figure 5C ); and can diagnose LUSC well( Figure 5B - Figure 5C , with AUC values of 0.861 and 0.792 in bronchoalveolar lavage fluid and whole blood samples respectively). The expression of SCGB3A1 in lung tissue samples( Figure 5A , AUC = 0.965) and bronchoalveolar lavage fluid( Figure 5B , AUC = 0.913) can well distinguish LUSC from LUAD, with good diagnostic value. The expression of SCGB3A1 in whole blood samples can also well distinguish LUSC from LUAD( Figure 5C , AUC = 0.897).
[0079] B) Data analysis and verification from GEO showed that the expression of SCGB3A1 was significantly down-regulated in both LUAD and LUSC, and the expression of SCGB3A1 could diagnose LUAD well( Figure 4B , AUC = 0.8295, P < 0.0001), and diagnose LUSC well( Figure 4B , AUC = 0.9532, P < 0.0001). The expression level of SCGB3A1 in LUSC tissues was lower than that in LUAD tissues, and it could diagnose LUSC from LUAD( Figure 4B , AUC = 0.6121, P = 0.0133). Data analysis from TCGA also showed that the expression of SCGB3A1 was significantly down-regulated in both LUAD and LUSC, and its expression could diagnose LUAD well( Figure 4A , AUC = 0.7852, P < 0.0001), and diagnose LUSC well( Figure 4A , AUC = 0.9333, P < 0.0001). Similarly, the expression of SCGB3A1 in LUSC was significantly lower than that in LUAD, and it could well diagnose LUSC from LUAD( Figure 4A , AUC = 0.9981, P < 0.0001).
[0080] The above results analysis showed that the expression of SCGB3A1 was significantly different in LUAD and LUSC, and the LUAD subtype and LUSC subtype could be well distinguished by the expression of SCGB3A1 in lung tissue, bronchoalveolar lavage fluid and whole blood. In particular, by detecting the expression level of SCGB3A1 in bronchoalveolar lavage fluid and whole blood, rapid, minimally invasive and low-cost accurate diagnosis of lung cancer and its lung squamous cell carcinoma subtype can be achieved, thus helping clinical patients formulate reasonable and effective diagnosis and treatment plans.
[0081] In summary, in the present invention, a) the expression of SCGB3A1 in normal lung and lung cancer tissues was detected, and it was found that its expression level was significantly decreased in lung cancer, indicating that the expression of SCGB3A1 could significantly distinguish normal tissues from lung cancer tissues. b) Further analysis revealed that the expression of SCGB3A1 was significantly different in different disease stages. The expression of SCGB3A1 was significantly downregulated in carcinoma in situ, early-stage lung cancer, and advanced-stage lung cancer, and there was already a downward trend in its expression in atypical hyperplasia tissues. Data analysis from GEO showed that the expression of SCGB3A1 decreased with the increase in the tumor TNM stage grade, indicating that the expression of SCGB3A1 was negatively correlated with the malignancy of lung cancer. These results suggest that the expression of SCGB3A1 has changed significantly in the early stage of lung cancer development and can be used as a molecular marker for early diagnosis of lung cancer and even screening for precancerous lesions. Secondly, the expression of SCGB3A1 was significantly correlated with the clinical stage of lung cancer, indicating the potential value of SCGB3A1 in the clinical staging of lung cancer. c) Detection of lung tissues, pulmonary lavage fluid, and whole blood samples showed that the expression of SCGB3A1 was significantly different in the lung cancer subtypes LUAD and LUSC, and it had good diagnostic value in NSCLC subtypes. Public data verification also showed that the expression of SCGB3A1 decreased in both LUAD and LUSC, and compared with LUAD, SCGB3A1 had a lower expression level in LUSC. The expression of SCGB3A1 could diagnose LUAD and LUSC well and could also diagnose LUSC well from LUAD. Based on the above detection results, the present invention provides the application of SCGB3A1 in the diagnosis of early-stage lung cancer and the diagnosis of the lung cancer subtype LUSC. According to the significant downregulation of SCGB3A1 expression at the early stage of lung cancer development, the expression of SCGB3A1 can be used as a molecular marker for early diagnosis of lung cancer and even screening for precancerous lesions. The expression of SCGB3A1 in the normal tissue adjacent to LUSC was significantly lower than that in the normal tissue adjacent to LUAD, and its expression level in LUSC was also significantly lower than that in LUAD. Therefore, its expression level can also be used as a diagnostic and screening marker for the lung cancer subtype LUSC and even precancerous lesions of LUSC.
[0082] The above specific embodiments have further elaborated on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made on the basis of the technical solutions of the present invention should be included in the protection scope of the present invention.
Claims
1. A qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer, characterized in that, The kit includes reverse transcription reagents, PCR reaction reagents and a control. The PCR reaction reagents include upstream and downstream primers of lung cancer-related genes and upstream and downstream primers of reference genes. The upstream and downstream primers of the lung cancer-related genes include the following primer pairs: SCBA-F: 3’-TGCTTTCTTAGTGGGCTCGG-5’; SCBA-R: 3’-CTATGAGGTGGTTCACGGGG-5’; The upstream and downstream primers of the reference genes include the following primer pairs: Actin-F: 3’-CCACGAAACTACCTTCAACTCC-5’; Actin-R: 3’-GTGATCTCCTTCTGCATCCTGT-5’.
2. The qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early-stage lung cancer according to claim 1, wherein The lung cancer-related gene is SCGB3A1; the reference gene is β-actin.
3. The qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer according to claim 1, wherein The control is RNA extracted from normal lung tissue.
4. The qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early-stage lung cancer according to claim 1, characterized in that, The reverse transcription reagents include oligo thymidine primers, random primers, nuclease-free deionized water, magnesium chloride, PCR nucleotide mixture, ribonuclease inhibitor and reverse transcriptase; the reverse transcription reaction system includes: 3 μL of total RNA at 1 mg / mL, 1 μL of oligo thymidine primers, 1 μL of random primers, 5 μL of nuclease-free deionized water, 4 μL of 5× reverse transcription buffer solution, 2 μL of magnesium chloride, 1 μL of PCR nucleotide mixture, 0.5 μL of ribonuclease inhibitor, 1.5 μL of nuclease-free deionized water and 1 μL of reverse transcriptase.
5. The qRT-PCR kit for rapid detection of lung squamous cell carcinoma or early lung cancer according to claim 1, wherein The PCR reaction reagents also include qPCR Master Mix; the PCR reaction system includes: 0.5 μL of each pair of upstream and downstream primers, 1 μL of cDNA template, 10 μL of 2× qPCR Master Mix and 8 μL of ultrapure water.
6. Use of the qRT-PCR kit according to any one of claims 1-5 for the identification of early lung cancer for non-disease diagnosis and treatment purposes.
7. Use of the qRT-PCR kit according to any one of claims 1-5 for the identification of lung squamous cell carcinoma for non-disease diagnosis and treatment purposes.
8. A detection method for squamous cell lung cancer or early lung cancer, characterized in that, The method is for non-disease diagnosis and treatment purposes; The detection method includes the following steps: (1) Extract total RNA from the sample; (2) Reverse transcribe the extracted RNA to generate cDNA; (3) Using the cDNA as a template, perform quantitative PCR amplification respectively with the upstream and downstream primers of the lung cancer-related genes and the upstream and downstream primers of the reference genes as claimed in claim 1; (4) Analyze the amplification results of the quantitative PCR and make a judgment.
9. The detection method according to claim 8, wherein The reaction program of the PCR amplification in step (3) is: pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 1 min, for a total of 45 cycles.
10. The detection method according to claim 8, characterized in that, The sample is bronchoalveolar lavage fluid, whole blood or lung tissue.