QRT-PCR (quantitative reverse transcription-polymerase chain reaction) detection kit for rapid diagnosis of main subtypes of lung cancer, application and detection method
The cleavage expression of the SOX30 gene was detected through the qRT-PCR detection kit, which solved the problem of rapid identification of lung adenocarcinoma and lung squamous cell carcinoma, achieved rapid and accurate diagnosis of lung cancer subtypes, and improved the targeted and early detection ability of treatment.
Patent Information
- Application Number
- CN202510465943.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art lacks rapid and accurate methods to distinguish between lung adenocarcinoma and lung squamous cell carcinoma, resulting in delays in clinical diagnosis and effective treatment.
Using the qRT-PCR detection kit, the different expression levels of the SOX30 gene were detected by detecting the different shear body expression levels of the SOX30 gene, and specific primers were used to quickly identify lung adenocarcinoma and lung squamous cell carcinoma, including reverse transcription reagents and PCR reaction reagents. The shear body of the SOX30 gene was PCR amplified using specific upstream and downstream primers.
It has achieved rapid and accurate distinction between lung adenocarcinoma and lung squamous cell carcinoma within 4 hours, shortened diagnosis time, helped to formulate accurate treatment plans, and improved early diagnosis and treatment efficiency.
Smart Images
Figure CN120290724A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to a qRT-PCR detection kit for rapid diagnosis of main subtypes of lung cancer, its uses and detection methods. Background Art
[0003] Clinically, lung cancer is divided into non-small cell lung cancer and small cell lung cancer. Non-small cell lung cancer accounts for 85% - 90% of the total number of lung cancer patients. Therefore, due to the wide coverage of non-small cell lung cancer, it is the main focus of lung cancer treatment now and in the future. Among non-small cell lung cancer, lung adenocarcinoma and lung squamous cell carcinoma are common histological subtypes, accounting for approximately 90%. There are obvious differences in tissue location, pathological characteristics, treatment regimens, and prognosis among different pathological classifications. At present, the main molecular characteristics and mechanisms of lung adenocarcinoma and lung squamous cell carcinoma are still unclear, and there is no rapid and accurate diagnostic method. Currently, the diagnosis of clinical lung cancer subtypes still mainly relies on the judgment of pathological characteristics, which is time-consuming and requires high professionalism, seriously delaying the implementation of effective treatment measures.
[0004] Therefore, there is an urgent need to find new reliable, rapid, and accurate differentiating markers for more effective precision diagnosis and treatment of lung cancer. Summary of the Invention
[0005] Technical Problem
[0006] The present invention provides a kit for rapid and accurate detection of lung adenocarcinoma and lung squamous cell carcinoma, which can help clinicians quickly identify the subtypes of lung cancer in patients, thereby formulating precise treatment plans, avoiding blindness, improving the efficiency of early diagnosis and treatment, and improving the prognosis of patients.
[0007] Technical Solution
[0008] In the first aspect of the present invention, a qRT-PCR detection kit for rapid diagnosis of major subtypes of lung cancer is provided. The kit includes reverse transcription reagents and PCR reaction reagents. The PCR reaction reagents include upstream and downstream primers for three splice variants of lung cancer-related genes and upstream and downstream primers for an internal reference gene. Among them, the major subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma. The upstream and downstream primers for the three splice variants include the following primer pairs: Isform-1-F 3’-CCTCAGATGCAGGCATACCA-5’; Isform-1-R 3’-GGTGAGGTTTCACCAACTGGA-5’; Isform-2-F 3’-TCCAGGGAAGCGAAAACGAT-5’; Isform-2-R 3’-AGGGCATGTACAACTGGATGA-5’; Isform-3-F 3’-TGTTGGACATGCGTGCAGAG-5’; Isform-3-R 3’-ATTTCTCCATGACCGCACCC-5’. The upstream and downstream primers for the internal reference gene include the following primer pair: β-actin-F 5’-GAAGAGCTACGAGCTGCCTGA-3’; β-actin-R 5’-CAGACAGCACTGTGTTGGCG-3’.
[0009] In some embodiments, the lung cancer-related gene is SOX30. The SOX gene is a class of nuclear transcription factors and a gene superfamily composed of SRY (Sex determination region of Y chromosome)-related genes. All SOX members contain an SRY-related HMG box DNA-binding domain, which is widely involved in the regulation of embryonic development and cell fate determination and plays an important role in the formation of multiple organs and tumorigenesis. The transcription factor SOX30 (SRY box containing gene 30) is the only member of the H subgroup of the SOX gene family. It contains a conserved HMG box DNA domain and has been proven to be an essential gene for spermatogenesis, is involved in gonadal development, and functions as a tumor suppressor gene in the progression and prognosis of ovarian cancer, lung cancer, and acute myeloid leukemia.
[0010] In some embodiments, the reverse transcription reagents include oligothymidine primers, random primers, reverse transcription buffer solution, nuclease-free deionized water, magnesium chloride (MgCl2), PCR nucleotide mixture, ribonuclease inhibitor, and reverse transcriptase.
[0011] In some embodiments, the reverse transcription reaction system includes: 3 μL of total RNA at 1 mg / mL, 1 μL of oligo thymidine primer, 1 μL of random primer, 6.5 μL of nuclease-free deionized water, 4 μL of 5× reverse transcription buffer solution, 2 μL of magnesium chloride (MgCl₂), 1 μL of PCR nucleotide mixture, 0.5 μL of ribonuclease inhibitor, and 1 μL of reverse transcriptase.
[0012] In some embodiments, the PCR reaction reagent further includes: qPCR Master Mix.
[0013] In some embodiments, the reaction system for PCR amplification includes: 0.5 μL each of the upstream and downstream primers of any one splice variant, 1 μL of cDNA template, 10 μL of 2× qPCR Master Mix, and 8 μL of deionized ultrapure water.
[0014] The second aspect of the present invention provides the use of the qRT-PCR detection kit described in any one of the above in identifying the main subtypes of lung cancer for non-disease diagnosis and treatment purposes, and the main subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma.
[0015] The third aspect of the present invention provides a method for qualitatively detecting the main subtypes of lung cancer, the method is for non-disease diagnosis and treatment purposes; the main subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma; the method includes the following steps: (1) extracting total RNA from the sample; (2) reverse transcribing the extracted RNA to generate cDNA; (3) using the upstream and downstream primers of the three splice variants described in claim 1 as templates for PCR amplification with cDNA; (4) analyzing the amplification results of PCR and making a judgment.
[0016] In some embodiments, the reaction program of PCR in step (3) is: pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 1 min, for a total of 45 cycles.
[0017] In some embodiments, the judgment rule in step (4) is: when specifically highly expressing the splice variant Isform-2 of the SOX30 gene, it is judged that the sample is lung adenocarcinoma tissue; when specifically highly expressing the splice variant isform-3 of the SOX30 gene, it is judged that the sample is lung squamous cell carcinoma tissue.
[0018] Technical effects
[0019] Our research has for the first time found that SOX30 forms different alternative splice variants in lung adenocarcinoma and lung squamous cell carcinoma, resulting in significantly different expressions in lung adenocarcinoma and lung squamous cell carcinoma, thus leading to significantly different roles, mechanisms, clinical and prognostic significances of SOX30 in lung adenocarcinoma and lung squamous cell carcinoma. Different alternative splice variants have important indicative effects on the rapid diagnosis and effective clinical intervention of lung cancer subtypes. By detecting the expression levels of different splice variants of SOX30 mRNA in lung adenocarcinoma and lung squamous cell carcinoma tissues, the present invention can quickly identify lung adenocarcinoma and lung squamous cell carcinoma subtypes, providing new methods and approaches for the early screening and diagnosis of lung cancer, helping to detect lesions at an early stage of the disease, facilitating the formulation of precise treatment plans, improving the survival rate of patients, and avoiding blindness in treatment.
[0020] The present invention can distinguish normal tissues and lung cancer tissues by detecting different splice variants of the SOX30 gene. Further, it can distinguish different subtypes of lung cancer tissues. The detection results show that the alternative splice variant Isform-2 of the SOX30 gene is highly specifically expressed in lung adenocarcinoma, while Isform-3 is highly specifically expressed in lung squamous cell carcinoma. By detecting the expression levels of different splice variants of the SOX30 gene, the lung adenocarcinoma and lung squamous cell carcinoma subtypes can be rapidly diagnosed within 4 hours (from obtaining tissues to obtaining judgment results), greatly shortening the diagnosis time and meeting the requirements of rapid clinical diagnosis. Brief Description of the Drawings
[0021] Figure 1 Positions for designing specific primers for different SOX30 alternative splice subtypes; arrows indicate the positions of specific forward and reverse primers (across introns) for different alternative splice subtypes;
[0022] Figure 2 Specific primers designed according to different splicing forms of SOX30, and real-time quantitative PCR was used to analyze the main splicing forms of SOX30 expressed in lung adenocarcinoma (ADC, Adenocarcinnma) and lung squamous cell carcinoma (SCC, Squamous cell carcionma);
[0023] Figure 3 Melting curve and melting peak diagrams during the primer quantitative PCR amplification process. Detailed Embodiments
[0024] For the convenience of describing the technical solutions of the application, the following first gives a general description and definition of the terms and expressions involved in the present invention.
[0025] The term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or apparatus. Without further limitation, an element qualified by the statement "comprising an..." does not exclude the presence of additional identical elements in the process, method, article or apparatus comprising said element.
[0026] All lung cancer tissue samples had not received treatments such as radiotherapy and chemotherapy before surgery, and the tissue specimens were diagnosed and identified by at least 2 pathological experts. Informed consent forms from the patients were obtained for all samples used in the study, and the study was approved by the ethics committee of the relevant institution.
[0027] The homogenization treatment of tissues in the present invention is a laboratory technique. By mixing tissue samples with a solution, uniform dispersion of tissue cells can be achieved, enabling subsequent analysis and experiments.
[0028] In each group of comparative experiments provided by the present invention, unless otherwise specified, except for the differences pointed out in each group, other experimental conditions, materials, etc. are kept consistent for comparability.
[0029] The reagents, instruments and equipment used in the embodiments of the present invention can be purchased from the market without detailed description.
[0030] The following further describes a qRT-PCR detection kit, its use and detection method for rapid diagnosis of the main subtypes of lung cancer provided by the present invention.
[0031] Example 1 Extraction of Tissue RNA
[0032] RNA was extracted using Trizol reagent (purchased from Invitrogen): 1 mL of Trizol reagent was added to the tissue and homogenized. After thorough mixing, it was incubated at room temperature for 5 min. 200 μL of chloroform was added and shaken vigorously, then left at room temperature for 5 min. Centrifuged at 13,000 g for 10 min at 4 °C. After centrifugation, the supernatant was transferred to a new 1.5 mL EP tube, and an equal volume of pre-cooled isopropanol was added and shaken well, then left at room temperature for 15 min. Centrifuged at 13,000 g for 5 min at 4 °C. After removing the supernatant, 1 mL of 80% ethanol prepared with nuclease-free deionized water was added for washing, centrifuged at 13,000 g for 5 min at 4 °C, and the supernatant was removed as cleanly as possible. The lid of the EP tube was opened and air-dried, then incubated at 45 °C for 5 min. 50 μL of nuclease-free deionized water was added to dissolve the RNA precipitate for 2 min, and the concentration and purity of the RNA dissolved sample were measured.
[0033] Example 2: Reverse transcription of tissue RNA to synthesize cDNA
[0034] Use the reverse transcription kit (GoScriptTM Reverse Transcription System, A5001) from Promega Corporation. The reaction system is shown in Table 1.
[0035] Table 1 Reverse transcription reaction system
[0036] System materials Reagent volume Oligothymine primer 1 μL Random primer 1 μL Total RNA 3 μg Nuclease-free deionized water 5 μL
[0037] Operation steps: Thoroughly mix the components of the above reaction system, pre-denature at 70°C for 5 min in a PCR instrument, and immediately place on ice bath after completion. Then add the reaction system shown in Table 2 to the system in Table 1.
[0038] Table 2 Reverse transcription reaction system
[0039] System materials Reagent volume 5× Reverse transcription buffer solution 4 μL <![CDATA[MgCl2]]> 2 μL PCR nucleotide mixture 1 μL Ribonuclease inhibitor 0.5 μL Nuclease-free deionized water 1.5 μL Reverse transcriptase 1 μL
[0040] After mixing the systems in Table 1 and Table 2 evenly, place them in a PCR instrument for reverse transcription. Reverse transcription program: Anneal at 25°C for 5 min, extend at 42°C for 35 min, and inactivate at 70°C for 15 min.
[0041] Example 3: Perform real-time quantitative-PCR (RT-PCR)
[0042] The reaction system is shown in Table 2. Among them, qPCR Master Mix is purchased from Promega Corporation qPCR Master Mix; The design positions of specific primers for different SOX30 alternative splicing subtypes are as Figure 1 shown; The primer sequences used for qRT-PCR analysis are shown in Table 3.
[0043] Table 3 RT-PCR reaction system
[0044] System materials Reagent volume Forward primer / F 0.5 μL Reverse primer / R 0.5 μL cDNA template 1.0 μL qPCR Master Mix 10 μL, 2× Deionized water 8.0 μL
[0045] Table 4 Primers used for qRT-PCR analysis
[0046] Primer name Sequence (5’-3’) Isform-1-F (SEQ ID NO.1) CCTCAGATGCAGGCATACCA Isform-1-R (SEQ ID NO.2) GGTGAGGTTTCACCAACTGGA Isform-2-F (SEQ ID NO.3) TCCAGGGAAGCGAAAACGAT Isform-2-R (SEQ ID NO.4) AGGGCATGTACAACTGGATGA Isform-3-F (SEQ ID NO.5) TGTTGGACATGCGTGCAGAG Isform-3-R (SEQ ID NO.6) ATTTCTCCATGACCGCACCC β-actin-F (SEQ ID NO.7) GAAGAGCTACGAGCTGCCTGA β-actin-R (SEQ ID NO.8) CAGACAGCACTGTGTTGGCG
[0047] PCR operation steps: Pre-denature at 95°C for 2 min, (denature at 95°C for 15 s, anneal and extend at 60°C for 45 s) × 45.
[0048] Quantitative PCR result analysis: The expression levels of SOX30 Isform-1 (whose CDS sequence is shown in SEQ ID NO.9), Isform-2 (whose CDS sequence is shown in SEQ ID NO.10), and Isform-3 (whose CDS sequence is shown in SEQ ID NO.11) in normal tissues are not higher than 15, 35, and 8 respectively; the expression level of SOX30 Isform-2 mRNA is highly and specifically expressed in ADC (expression level > 99, as Figure 2 shown), while the level of SOX30 Isform-3 mRNA is highly and specifically expressed in SCC (expression level > 35, as Figure 2 shown). These results indicate that ADC and SCC can be rapidly diagnosed by detecting the expression of different splice variants of SOX30.
[0049] Example 4 Primer Performance Test
[0050] The primers in Table 4 (SEQ ID NO.1 to SEQ ID NO.6) were respectively melted at 60 - 95 °C (2 min).
[0051] As Figure 3 shown in the melting curve graph and melting peak graph, the primer amplification products provided by the present invention have good specificity.
[0052] The above specific embodiments have further detailed the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made on the basis of the technical solution of the present invention shall be included within the protection scope of the present invention.
Claims
1. A qRT-PCR detection kit for rapid diagnosis of the main subtypes of lung cancer, characterized in that, The kit includes reverse transcription reagents and PCR reaction reagents. The PCR reaction reagents include upstream and downstream primers for three splice variants of lung cancer-related genes and upstream and downstream primers for a reference gene. Among them, the main subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma. The upstream and downstream primers for the three splice variants include the following primer pairs: Isform-1-F: 3’-CCTCAGATGCAGGCATACCA-5’; Isform-1-R: 3’-GGTGAGGTTTCACCAACTGGA-5’; Isform-2-F: 3’-TCCAGGGAAGCGAAAACGAT-5’; Isform-2-R: 3’-AGGGCATGTACAACTGGATGA-5’; Isform-3-F: 3’-TGTTGGACATGCGTGCAGAG-5’; Isform-3-R: 3’-ATTTCTCCATGACCGCACCC-5’; The upstream and downstream primers for the reference gene include the following primer pairs: β-actin-F: 5’-GAAGAGCTACGAGCTGCCTGA-3’; β-actin-R: 5’-CAGACAGCACTGTGTTGGCG-3’.
2. The qRT-PCR detection kit for rapid diagnosis of the main subtypes of lung cancer according to claim 1, wherein, The lung cancer-related gene is SOX30.
3. The qRT-PCR detection kit for rapid diagnosis of major subtypes of lung cancer according to claim 1, wherein The reverse transcription reagents include oligothymidine primers, random primers, reverse transcription buffer solution, nuclease-free deionized water, magnesium chloride, PCR nucleotide mixture, ribonuclease inhibitor, and reverse transcriptase.
4. The qRT-PCR detection kit for rapid diagnosis of major subtypes of lung cancer according to claim 3, wherein The reverse transcription reaction system includes: 3 μL of total RNA at 1 mg / mL, 1 μL of oligothymidine primers, 1 μL of random primers, 6.5 μL of nuclease-free deionized water, 4 μL of 5× reverse transcription buffer solution, 2 μL of magnesium chloride, 1 μL of PCR nucleotide mixture, 0.5 μL of ribonuclease inhibitor, and 1 μL of reverse transcriptase.
5. The qRT-PCR detection kit for rapid diagnosis of the main subtypes of lung cancer according to claim 1, wherein The PCR reaction reagents further include: qPCRMaster Mix.
6. The qRT-PCR detection kit for rapid diagnosis of major subtypes of lung cancer according to claim 5, wherein The reaction system for PCR amplification includes: 0.5 μL each of the upstream and downstream primers for any one of the splice variants, 1 μL of cDNA template, 10 μL of 2× qPCRMaster Mix, and 8 μL of deionized water.
7. Use of the qRT-PCR detection kit according to any one of claims 1-6 for identifying the main subtypes of lung cancer for non-diagnostic and non-therapeutic purposes, characterized in that, The main subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma.
8. A method for qualitatively detecting the main subtypes of lung cancer, characterized in that, The method is for non-disease diagnosis and treatment purposes; The main subtypes of lung cancer are lung adenocarcinoma and lung squamous cell carcinoma; The method includes the following steps: (1) Extract total RNA from the sample; (2) Reverse transcribe the extracted RNA to generate cDNA; (3) Using the cDNA as a template, perform PCR amplification respectively with the upstream and downstream primers for the three splice variants described in claim 1; (4) Analyze the amplification results of PCR and make a judgment.
9. The method according to claim 8, wherein The reaction program for PCR in step (3) is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing and extension at 60°C for 1 min, for a total of 45 cycles.
10. The method according to claim 8, characterized in that, The judgment rule in the step (4) is as follows: when the splice variant Isform-2 of the SOX30 gene with high specificity expression is detected, the sample is determined to be lung adenocarcinoma tissue; when the splice variant isform-3 of the SOX30 gene with high specificity expression is detected, the sample is determined to be lung squamous cell carcinoma tissue.