Application of circular RNA MYH9 as renal clear cell carcinoma biomarker

By using circular RNAMYH9 as a biomarker, the problem of early diagnosis of renal clear cell carcinoma in the prior art is solved, and a non-invasive detection method is provided, which realizes early diagnosis and detection of renal clear cell carcinoma.

CN120290725APending Publication Date: 2025-07-11ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510473271.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The prior art is difficult to diagnose renal clear cell carcinoma early, imaging examinations have limitations, pathological diagnosis depends on doctors' experience, and there is a lack of effective biomarkers for the detection of renal clear cell carcinoma.

Method used

Using cyclic RNAMYH9 as a biomarker, liquid or powder preparations and kits are developed for non-invasive detection by detecting the relative expression of cyclic RNAMYH9 in serum samples and cell lines of patients with renal clear cell carcinoma.

Benefits of technology

The early diagnosis of circular RNAMYH9 in renal clear cell carcinoma was achieved, providing significant clinical practical value, and its expression downregulation characteristics can be verified through small and large sample verification experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290725A_ABST
    Figure CN120290725A_ABST
Patent Text Reader

Abstract

The invention provides application of circular RNAMYH9 as a renal clear cell carcinoma biomarker, and belongs to the technical field of biological medicine. The nucleotide sequence of the circular RNAMYH9 is as shown in SEQ ID No.1 (sequence identifier number 1). Through small sample and large sample verification experiments, the conclusion that the relative expression level of MYH9 in a serum sample of a renal clear cell carcinoma patient is obviously reduced is obtained; and a cell strain verification experiment shows that the relative expression levels of the MYH9 in renal clear cell carcinoma cell strains 786-O and ACHN are obviously reduced. Therefore, the MYH9 can be used as a biomarker of the renal clear cell carcinoma and is used for detecting and diagnosing the renal clear cell carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and particularly to the application of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma. Background Art

[0002] Clear cell renal cell carcinoma is an adenocarcinoma derived from renal tubular epithelial cells, accounting for 70-80% of renal cancer cases and being the most common malignant tumor of the kidney. The occurrence of this disease is mostly attributed to factors such as family inheritance and external environmental factors such as smoking, obesity, and hypertension; it is not easily detected in the early stage, and in the middle and late stages, there will be low back pain, gross or microscopic hematuria, abdominal mass, and some will be accompanied by manifestations such as fever or weight loss.

[0003] Currently, the diagnosis of clear cell renal cell carcinoma mainly uses imaging examinations such as ultrasound, CT, and MRI as the main means, uses puncture biopsy or postoperative pathological examination as the core to determine the nature of the tumor, and uses laboratory examinations such as urine routine and blood routine as auxiliary diagnostic techniques. However, the above detection methods mostly have disadvantages such as difficulty in early diagnosis, limitations of imaging technology itself, and the need for doctors' experience in pathological diagnosis.

[0004] Biomarkers can be used for disease diagnosis, determining disease stages, or evaluating the safety and effectiveness of new drugs or new therapies in the target population. Research shows that examining a disease-specific biomarker may help in the identification, early diagnosis, and prevention of diseases, as well as in the monitoring during the treatment process.

[0005] Therefore, it is very necessary to provide a biomarker that can be used for the diagnosis and detection of clear cell renal cell carcinoma to improve the above-mentioned defects existing in the existing detection technology. Summary of the Invention

[0006] The object of the present invention is to provide the application of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma. The relative expression levels of the circular RNA MYH9 in serum samples of patients with clear cell renal cell carcinoma, the clear cell renal cell carcinoma cell lines 786-O and ACHN are significantly down-regulated, and it can be used for the detection and diagnosis of clear cell renal cell carcinoma.

[0007] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides the application of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma, and the nucleotide sequence of the circular RNA MYH9 is as shown in SEQ ID No.1.

[0009] The present invention also provides the application of circular RNA MYH9 in the preparation of a preparation for diagnosing clear cell renal cell carcinoma.

[0010] Preferably, the types of the preparation include liquid preparations and / or powder preparations.

[0011] The present invention also provides an application of circular RNA MYH9 in the preparation of a kit for detecting clear cell renal cell carcinoma.

[0012] The present invention also provides a primer set for detecting circular RNA MYH9, including a forward primer shown in SEQ ID No. 2 and a reverse primer shown in SEQ ID No. 3.

[0013] The beneficial effects of the present invention compared with the prior art are as follows:

[0014] The present invention provides an application of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma. Through small-sample and large-sample verification experiments, the present invention obtains that the relative expression levels of circular RNA MYH9 in serum samples of patients with clear cell renal cell carcinoma are significantly down-regulated; the cell line verification experiment shows that the relative expression levels of circular RNA MYH9 in clear cell renal cell carcinoma cell lines 786-O and ACHN are significantly decreased. Therefore, circular RNA MYH9 can be used as a biomarker for clear cell renal cell carcinoma for detecting and diagnosing clear cell renal cell carcinoma. In addition, the preparation or kit for detection or diagnosis based on circular RNA MYH9 can achieve non-invasive detection and diagnosis of clear cell renal cell carcinoma, and has significant clinical practical value. Description of the Drawings

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0016] Figure 1 It is a volcano plot of circRNA expression in serum samples of patients with clear cell renal cell carcinoma;

[0017] Figure 2 It is a hierarchical clustering heat map of circRNA expression in serum samples of patients with clear cell renal cell carcinoma; wherein, ccRCC represents serum samples of patients with clear cell renal cell carcinoma, and Normal represents serum samples of healthy controls.

[0018] Figure 3 It is the result of detecting the circularization of circular RNA MYH9 by Sanger sequencing;

[0019] Figure 4 It is a bioinformatics schematic diagram of the exon circularization of circular RNA MYH9;

[0020] Figure 5 is the relative expression level of circular RNA MYH9 in 7 pairs of renal clear cell carcinoma tissues and their corresponding adjacent normal tissues;

[0021] Figure 6 is the relative expression level of circular RNA MYH9 in the sera of 6 healthy controls and the sera of 8 renal clear cell carcinoma patients;

[0022] Figure 7 is the result of the clinical large - sample verification experiment of circular RNA MYH9;

[0023] Figure 8 is the relative expression level of circular RNA MYH9 in different renal clear cell carcinoma cell lines. Detailed implementation manners

[0024] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0025] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0026] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0027] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0028] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open - ended terms, that is, they are meant to include but not be limited to.

[0029] The present invention provides the application of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma, and the nucleotide sequence of the circular RNA MYH9 is as shown in SEQ ID No.1.

[0030] In the present invention, the ID of the circular RNA MYH9 in circBASE is hsa_circ_0063152, which is a circRNA formed by circularization from exon 1 to exon 3, and the length of the spliced and mature sequence is 721 bp; the nucleotide sequence of the circular RNA MYH9 is: GCCAGCCTCAAGGAGGAGGTGGGCGAAGAGGCCATCGTGGAGCTGGTGGAGAATGGGAAGAAGGTGAAGGTGAACAAGGATGACATCCAGAAGATGAACCCGCCCAAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCCTCGGTGCTGCACAACCTCAAGGAGCGTTACTACTCAGGGCTCATCTACACCTATTCAGGCCTGTTCTGTGTGGTCATCAATCCTTACAAGAACCTGCCCATCTACTCTGAAGAGATTGTGGAAATGTACAAGGGCAAGAAGAGGCACGAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGGAGGGCGGGGCGGGAAGGCGGCGAGGAGCCGAGCTGGGTGCGGTGAGGCGCGCAGATCACCGCGGTTCCTGGGCAGGGCACGGAAGGCTAAGCAAGGCTGACCTGCTGCAGCTCCCGCCTCGTGCGCTCGCCCCACCCGGCCGCCGCCCGAGCGCTCGAGAAAGTCCTCTCGGGAGAAGCAGCGCCTGTTCCCGGGGCAGATCCAGGTTCAGGTCCTGGCTATAAGTCACCATGGCACAGCAAGCTGCCGATAAGTATCTCTATGTGGATAAAAACTTCATCAACAATCCGCTGGCCCAGGCCGACTGGGCTGCCAAGAAGCTGGTATGGGTGCCTTCCGACAAGAGTGGCTTTGAGCCA (SEQ ID No.1). The structural diagram is as Figure 4 shown.

[0031] The present invention also provides the application of circular RNA MYH9 in the preparation of a preparation for diagnosing renal clear cell carcinoma.

[0032] In the present invention, the type of the preparation preferably includes liquid agent and / or powder.

[0033] The present invention also provides the application of circular RNA MYH9 in the preparation of a kit for detecting renal clear cell carcinoma.

[0034] The present invention also provides a primer set for detecting circular RNA MYH9, including a forward primer as shown in SEQ ID No. 2 and a reverse primer as shown in SEQ ID No. 3.

[0035] In the present invention, the nucleotide sequence of the forward primer is: ACAAGGGCAAGAAGAGGCAC (SEQ ID No. 2); the nucleotide sequence of the reverse primer is: CCGCCCTCCTTGCATCATAC (SEQ ID No. 3).

[0036] Example 1

[0037] In the early morning of April - May 2018, at the First Affiliated Hospital of Zhejiang University, after obtaining the informed consent of the patients, 6 ml of fasting venous blood was collected from 4 patients with renal clear cell carcinoma and 4 healthy controls with definite pathological diagnosis (among them, all 4 patients with renal clear cell carcinoma were newly diagnosed patients and had not undergone surgery, radiotherapy or chemotherapy before blood collection. The 4 healthy controls were healthy people without malignant tumors and other diseases and with ages matched to those of the 4 patients with renal clear cell carcinoma). The collected blood was placed in a tube without anticoagulant, allowed to stand for 30 min, centrifuged at 4°C and 3000 g for 15 min, and the supernatant was aliquoted into RNase-free EP tubes at a volume of 500 μl / tube to obtain serum samples, which were stored frozen at -80°C.

[0038] The obtained serum samples were respectively screened by circular RNA chip technology (entrusted to CapitalBio Corporation for screening). According to the different expression levels of the screened circular RNAs, bioinformatics analysis was performed on the detected differential circular RNAs, and volcano plots and hierarchical clustering heat maps were drawn according to the chip results for bioinformatics analysis. The results are as Figure 1 and Figure 2 shown.

[0039] The results showed that in renal clear cell tumors, there were 51 circular RNAs with up-regulated expression and 79 circular RNAs with down-regulated expression (p≤0.05, fc≥2). After analysis, MYH9 showed significant differential expression characteristics.

[0040] Example 2

[0041] To further verify that circular RNA MYH9 is a circularized RNA, first, the full-length circular RNA MYH9 was obtained by PCR amplification. Specific primers covering the full-length coding region were designed based on the known circular RNA MYH9 gene sequence. The forward primer sequence was: 5'-GCCAGCCTCAAGGAGGAGGTGGGCG-3' (SEQ ID No.4), and the reverse primer sequence was: 5'-TGGCTCAAAGCCACTCTTGTCGG-3' (SEQ ID No.5). A 20 μL PCR reaction system was prepared by conventional methods: containing 1 μL of template DNA, 10 μL of KOD One PCR Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 7 μL of double-distilled water. The reaction program was set as follows: pre-denaturation at 95°C for 5 minutes, followed by 35 cycles (denaturation at 95°C for 5 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 10 seconds), and finally extension at 72°C for 10 minutes. Meanwhile, a 1% agarose gel was prepared, and after adding a nucleic acid dye, it was poured into an agarose gel plate to solidify. The PCR product was mixed with a loading buffer and then loaded, and a DNA molecular weight Marker was added. Electrophoresis was carried out at 100 V for 30 min, and observed in a gel imaging system. If there was a single clear band at the expected position, the amplification was successful. The PCR product was further purified using a gel recovery kit. The gel containing the target band was cut under ultraviolet light and dissolved in a solubilization buffer in a 65°C water bath. The dissolved solution was transferred to an adsorption column, and a purified product was obtained through steps such as centrifugation, washing, and elution, and its concentration and purity were detected. Finally, it was sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing analysis, and the sequence was read from the sequencing peak map. The results are as Figure 3 shown.

[0042] As Figure 3 can be seen, the sequencing sequence contains splicing sites, proving the circularization characteristics of circular RNA MYH9.

[0043] Example 3

[0044] From April to May 2018, after obtaining the informed consent of the patients, postoperative specimens of 7 pairs of patients with clear cell renal cell carcinoma who had not received radiotherapy and chemotherapy before surgery and were pathologically confirmed were selected at the First Affiliated Hospital of Zhejiang University. The specimens (including cancer tissue specimens and paired adjacent tissues more than 3 cm away from the cancer tissue) were placed in RNase-free EP tubes and stored frozen at -80°C.

[0045] Add a specimen with a mass of 0.4 g ± 0.1 g to 1 ml of AG RNAex Pro Reagent lysis solution (purchased from Aikrui Bioengineering Co., Ltd.), add magnetic beads, and use a tissue homogenizer for fragmentation treatment until the tissue specimen particles are no longer visible to the naked eye. Invert the mixture up and down and let it stand at room temperature for 5 min. Add chloroform at a volume of 0.2 ml / tube, shake vigorously for 15 s, and let it stand for 5 min; centrifuge at 12,000 g at 4 °C for 15 min, transfer the supernatant to an RNA-free EP tube, record the volume of the supernatant, and then add an equal volume of isopropanol. Invert the mixture up and down to mix well and place it on ice for 15 min; centrifuge at 12,000 g at 4 °C for 15 min, discard the supernatant, and at the same time prevent the precipitate from being discarded with the supernatant. Add 1 ml of 80% ethanol prepared with DEPC water to wash the RNA precipitate, centrifuge at 12,000 g at 4 °C for 5 min, and discard the supernatant; centrifuge at 12,000 g at 4 °C for 1 min, and use a pipette tip to aspirate the remaining supernatant. Open the EP tube in a laminar flow hood and let it air dry for 4 min; dissolve the RNA with RNase-free water, add RNase-free water at a volume of 15 μl / tube, pipette to mix well and place it on ice to obtain the total RNA of the specimen; use a NanoDrop 2000 ultra-micro spectrophotometer to detect the RNA concentration of the sample.

[0046] Use The IIQ RT SuperMix for qPCR (+gDNAwiper) reverse transcription kit (purchased from Novoprotein Biotechnology Co., Ltd.) is used for the RNA reverse transcription reaction. The total reaction system is set to 20 μl, and the specific steps are as follows:

[0047] Take 1 μg of template RNA and 4 μL of 4×gDNAwiperMix, add them to an RNase-free centrifuge tube, and then add RNase-free ddH2O to adjust the volume of the solution to 16 μL. Pipette to mix well, incubate in a water bath at 42 °C for 2 min, then add 4 μL of 5×HiScriptII qRT SuperMix II, pipette to mix well, centrifuge, react at 37 °C for 15 min, and incubate at 85 °C for 5 s to inactivate the enzyme to obtain the reverse transcription reaction solution. Take 3 μL of the reverse transcription reaction solution and add it to 50 μL of ddH2O to obtain the diluted reverse transcription reaction solution.

[0048] Prepare 10 μL of the reaction solution for real-time fluorescence quantitative PCR: sequentially add 7.5 μL of 2× ChamQ Universal SYBR qPCR Master Mix, 0.3 μL of the forward primer with the sequence 5'-ACAAGGGCAAGAAGAGGCAC-3' (SEQ ID No.2), 0.3 μL of the reverse primer with the sequence 5'-CCGCCCTCCTTGCATCATAC-3' (SEQ ID No.3), and 1.9 μL of ddH2O.

[0049] Add the above-prepared 10 μL of the reaction solution into a 96-well plate, and then add 5 μL of the diluted reverse transcription reaction solution cDNA, with a total volume of 15 μL. Use the β-actin gene as an internal reference, set 3 replicates for each specimen, seal with a sealing film, and centrifuge at low speed. Set the reaction conditions as follows: pre-denaturation reaction at 95°C for 10 sec; reaction at 95°C for 5 sec and 60°C for 20 sec, for 40 cycles; melting curve: reaction at 95°C for 60 sec, 55°C for 30 sec, and 95°C for 30 sec. Use a fluorescence quantitative PCR detector for detection.

[0050] Through the accumulation of fluorescence signals generated by the fluorescent group, monitor the entire PCR process in real time. The Ct value refers to the number of cycles experienced by the fluorescence signal in each reaction tube to reach the set threshold; the more starting copies of the target circRNA, the smaller the Ct value, and vice versa. When the amplification efficiency of the target circRNA and the internal reference is the same, the quantitative △Ct of the target circRNA relative to the internal reference can be directly obtained as △Ct = Ct(target) - Ct(internal reference), and △△Ct = △Ct(adjacent cancer tissue) - △Ct(renal clear cell carcinoma tissue). Calculate the 2 -△△Ct value, use graphpad prism 6 to plot a graph to analyze and compare the relative expression levels of circRNAs in renal clear cell carcinoma tissues and their adjacent cancer tissues. The results are as Figure 5 shown.

[0051] It can be Figure 5 seen that the expression of circular RNA MYH9 in renal clear cell carcinoma tissues is significantly lower than that in adjacent normal tissues, and is consistent with the circRNA microarray results in Example 1.

[0052] Example 4 Small sample verification experiment

[0053] Collect serum samples according to the method in Example 1; the difference is that the number of patients is 6 healthy controls and 8 patients with clear cell renal cell carcinoma respectively. Add 500 μL of serum samples to 2500 μL of AG RNAex Pro Reagent lysis reagent, mix well by inverting up and down, and let stand at room temperature for 5 min; add chloroform at a volume of 0.2 ml / tube, shake vigorously for 15 s, and let stand for 5 min; centrifuge at 12000 g at 4 °C for 15 min, take the supernatant to an RNA-free EP tube, record the volume of the supernatant, add an equal volume of isopropanol, mix well by inverting up and down, and place at -20 °C for 1 h; centrifuge at 12000 g at 4 °C for 15 min, discard the supernatant, and at the same time prevent the precipitate from being discarded with the supernatant; add 1 mL of 80% ethanol by volume prepared with DEPC water to wash the RNA precipitate; centrifuge at 12000 g at 4 °C for 5 min, discard the supernatant; centrifuge at 12000 g at 4 °C for 1 min, and aspirate the residual supernatant with a pipette tip; open the EP in a laminar flow hood and air dry for 4 min; dissolve the RNA with RNase-free water, add RNase-free water at a volume of 15 μL / tube, pipette tip to mix evenly and place on ice to obtain the total RNA of the serum samples; use a NanoDrop 2000 ultra-micro spectrophotometer to detect the RNA concentration of the samples.

[0054] Then perform RNA reverse transcription and real-time fluorescence quantitative PCR reactions according to the method in Example 3. The results are as Figure 6 shown.

[0055] As Figure 6 can be seen, the relative expression level of circular RNA MYH9 in the sera of 8 patients with clear cell renal cell carcinoma was significantly down-regulated.

[0056] Example 5 Large sample verification experiment

[0057] Collect serum samples from 50 patients with clear cell renal cell carcinoma and 30 healthy controls according to the method in Example 1. The basic conditions of the 50 patients with clear cell renal cell carcinoma and 30 healthy controls are the same as those in Example 1. Extract the total RNA of the serum samples, perform RNA reverse transcription and real-time fluorescence quantitative PCR reactions according to the method in Example 4. The results are as Figure 7 shown.

[0058] As Figure 7 can be seen, the expression level of circular RNA MYH9 in the serum samples of patients with clear cell renal cell carcinoma was significantly down-regulated. Therefore, circular RNA MYH9 has the potential to be used as a molecular marker for clear cell renal cell carcinoma.

[0059] Example 6 Verification experiment

[0060] Using 293T (Catalog No. SCSP-502, purchased from the Cell Bank of the Chinese Academy of Sciences), human renal clear cell carcinoma cell line 786-O (Catalog No. SCSP-5059, purchased from the Cell Bank of the Chinese Academy of Sciences), and ACHN (Catalog No. SCSP-5063, purchased from the Cell Bank of the Chinese Academy of Sciences) as cell models. Total RNA was treated with RNase R, and the relative expression level of MYH9 after RNase R treatment was detected by qPCR-PCR. The results are as Figure 8 shown.

[0061] Among them, RNase R (Ribonuclease R) is a 3'-5' ribonuclease exonuclease derived from the Escherichia coli RNR superfamily, which can gradually cleave RNA into dinucleotides and trinucleotides from the 3'-5' direction; RNase R can digest almost all linear RNA molecules, but is not easily digested by circular RNA.

[0062] It can be Figure 8 seen that the relative expression level of circular RNA MYH9 in renal clear cell carcinoma cell lines was significantly decreased.

[0063] As can be seen from the above examples, the present invention provides the application of circular RNA MYH9 as a biomarker for renal clear cell carcinoma. The expression of circular RNA MYH9 in renal clear cell carcinoma tissues is significantly lower than that in adjacent normal tissues, and both large-sample and small-sample validation experiments show that the relative expression level of circular RNA MYH9 in serum samples of patients with renal clear cell carcinoma is significantly down-regulated; and the relative expression level of circular RNA MYH9 in renal clear cell carcinoma cell lines 786-O and ACHN is significantly decreased.

[0064] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of circular RNA MYH9 as a biomarker for clear cell renal cell carcinoma, characterized in that, The nucleotide sequence of the circular RNA MYH9 is shown in SEQ ID No.

1.

2. Use of circular RNA MYH9 in the preparation of a preparation for diagnosing clear cell renal carcinoma.

3. The application according to claim 2, wherein The types of the preparation include liquid agents and / or powders.

4. Use of circular RNA MYH9 in the preparation of a kit for detecting clear cell renal carcinoma.

5. A primer set for detecting circular RNA MYH9, characterized in that, It includes a forward primer shown in SEQ ID No. 2 and a reverse primer shown in SEQ ID No. 3.

Citation Information

Patent Citations

  • Renal clear cell carcinoma circRNA biomarker, screening method and diagnostic kit

    CN112980953A

  • Compositions and methods for diagnosis and therapy of disorders related to alterations of MYH9

    US20150148411A1