FST gene SNP (Single Nucleotide Polymorphism) site molecular marker related to egg yield of chicken and application of FST gene SNP site molecular marker
By designing SNP molecular markers at locus 1493 of the chicken FST gene and screening out GG genotype chickens, the problem of difficulty in increasing the egg production in the existing technology is solved, and efficient breeding of high-yield laying hens is achieved.
Patent Information
- Application Number
- CN202510523946.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to effectively use the SNP site of the chicken FST gene for molecular marking assisted breeding, especially to improve the egg production traits of chickens, and there is a lack of relevant molecular marking methods.
SNP molecular markers related to chicken egg production traits were designed and applied, and a single mutation site (A1493G) was specifically located at the 1493rd site of the FST gene (A1493G). Chickens with GG genotype were screened for breeding of high-egg production varieties through PCR amplification and electrophoresis detection.
It has achieved simple and fast breeding of high-yield laying hens, significantly improving the number of eggs laid in 500-day-old chickens, and improving breeding efficiency and accuracy.
Smart Images

Figure CN120290744A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetics, and relates to a molecular marker method for a single mutation site at the 1493rd site (Intron 1) of the chicken FST gene and its application in chicken breeding, specifically an SNP molecular marker related to the egg production trait of chickens and its application. Background Art
[0002] Follistatin (FST) belongs to one of the members of the transforming growth factor-β superfamily. It can maintain the survival of animal ovarian germ cells, assist in early embryonic development, and play a key regulatory role in early ovarian differentiation. At the same time, it participates in the process of primordial follicle development and follicle selection, and is significantly related to the reproductive, growth and other traits of economic animals. Nicol etal. (2013) studies have shown that the FST gene is involved in early gonadal differentiation and plays a synergistic role with the aromatase CYP19A1A gene. Zhang Beibei et al. (2021) studies have shown that the mRNA level expression of the FST gene can be detected in follicles of Taihang chickens at all stages. As the follicles gradually mature, the mRNA expression level of the FST gene decreases significantly, and the FST gene plays a role in the process of follicle selection. Wang etal. (2023) studies have shown that the FST gene can affect oocyte maturation by regulating the mitochondrial integrity of oocytes, cumulus expansion, cumulus cell apoptosis, and the expression levels of genes related to the TGF-β / SMAD pathway. Chen etal. (2022) After immunizing against FST, the number of preovulatory follicles in geese increased significantly. At the same time, the mRNA levels of Lhr, Star, Vldlr, Smad3, and Smad4 genes in the granulosa layer of pre-stratified follicles were significantly upregulated. This indicates that FST plays a limiting role in the development of pre-stratified follicles to preovulatory follicles in the ovary of Yangzhou geese, and its mechanism of action may be by reducing the sensitivity of follicles to activin and regulating the SMAD3 signaling pathway, thereby affecting progesterone synthesis and yolk deposition in pre-stratified follicles. Dushyanth etal. (2022) Researchers successfully revealed 4 haplotype SNP sites in the coding region (exon 2 and exon 5 regions) of the FST gene in native American chickens (Aseel, Red Shir chicken) and White Leghorns, which are significantly related to chicken growth traits.
[0003] Molecular marker-assisted selection breeding, as a key technology in the field of modern animal husbandry genetics, refers to the means of assisting genetic research and breeding practices with the help of specific positions on the DNA sequence of an organism. At present, this technology has been widely used in the construction of genetic linkage maps, clarifying the linkage relationship between genes, and in-depth exploration of the correlation between economic traits and genes, providing a solid genetic basis for the selection and breeding of excellent livestock and poultry varieties, and greatly improving breeding efficiency and accuracy. Therefore, in-depth research on chicken FST gene SNPs will help to discover molecular markers of great value and is expected to open up new ideas for improving the reproductive rate of chickens. Summary of the invention
[0004] In view of the above-mentioned prior art, the object of the present invention is to provide a molecular marker method for a single mutation site in the Intron region of the chicken FST gene and its application in chicken breeding.
[0005] The technical solution adopted to achieve the purpose is: a SNP molecular marker related to the egg production trait of chickens, the SNP site is from the FST gene, the nucleotide sequence is shown in SEQ ID NO.1, and the 1493rd base A at the 5' end of the sequence is mutated to G; Among them, individuals with a G base at the 1493rd site Intron 1 of the FST gene showed high-yield traits at 500 days of age.
[0006] Application of SNP molecular markers related to chicken egg production traits in chicken genetics and breeding.
[0007] As a preferred technical solution: the PCR primers for detecting SNP molecular markers use the marker primer P-FST-1, including: P-FST-1F: 5'TCTTGGCTTGACTCCACGAAT 3'; P-FST-1R: 5' CCCGCTTAGGTGAAAATAACAGT 3'.
[0008] As a preferred technical solution: the primer is used to assist in the breeding of high-yield laying hen varieties.
[0009] A kit for detecting SNP molecular markers associated with the high egg production trait of chickens, the kit comprising the above primers.
[0010] The kit is used in assisting the breeding of high-yield laying hen breeds.
[0011] A marking method for SNP molecular markers associated with high egg production traits in chickens, (1) Genomic DNA extraction: Blood was collected from the wing vein, and genomic DNA was extracted and stored at -20°C; (2)Primer design: The labeled primer P-FST-1 was used, including: P-FST-1F: 5' TCTTGGCTTGACTCCACGAAT 3'; P-FST-1R: 5' CCCGCTTAGGTGAAATAACAGT 3'.
[0012] (3)PCR amplification: 0.5 μL of 50 - 100 ng / μL genomic DNA template, 10 μL of 2×Taq Master Mix, 0.5 μL each of P-FST-1F and P-FST-1R primers (10 μM), 8.5 μL of dd H2O; PCR amplification program: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 61°C for 30 s, extension at 72°C for 1 min, for 31 cycles; incubation at 72°C for 5 min after the cycles; (4)Electrophoresis detection: The amplified products were detected by gel electrophoresis to obtain the genotypes corresponding to the samples. One mutation site was detected at the 1493rd site of the FST gene. Individuals with the base G are related to the high-yield trait at 500 days of age.
[0013] The method for selecting and breeding high-egg-yield varieties assisted by the SNP molecular marker includes the following steps: In the chicken population, homozygous roosters with the genotype GG and homozygous hens with the genotype GG are mated with each other. The egg production of the resulting offspring hens is significantly higher than that of the AA genotype. The GG genotype is a mutation from base A to G at the 1493rd position from the 5' end of the sequence shown in SEQ ID NO.1.
[0014] The beneficial effects of the present invention are: The present invention first discovered that there is one mutation site (i.e., A1493G) in the chicken FST gene (Intron 1). The egg production of the GG genotype at 500 days of age is earlier than that of other genotypes. It can be seen that detecting this molecular marker associated with egg production traits is not only simple and fast, but also beneficial for breeding high-egg-yield chicken varieties and accelerating the breeding process.
[0015] Using the SNP molecular marker of the present invention to assist in chicken selection and breeding, the GG genotype chickens obtained have high-egg-yield traits; therefore, different chicken varieties can be selected according to needs using the SNP molecular marker of the present invention. Description of the drawings
[0016] Figure 1 It is the electrophoresis diagram of the fragment amplified by the P-FST-1F / R primers.
[0017] Figure 2Polymorphism sequencing map of the mutation site at the 1493rd locus (Intron 1) of the chicken FST gene.
[0018] Figure 3 Electrophoresis map of amplifying the FST gene of Taihang chickens. Specific implementation manners
[0019] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.
[0020] SNPs occurring in intron regions are called intronic SNPs (iSNPs). Such mutations are located in the intron regions of genes. Although this region is not directly involved in the protein-coding sequence, iSNPs are of great significance to the genetic traits of organisms, including splicing regulation: they may affect exon-intron boundary recognition (such as splicing donor / acceptor sites), resulting in abnormal splicing (such as exon skipping, activation of cryptic splicing sites). Regulatory elements: Introns may contain binding sites for enhancers, silencers, or non-coding RNAs (such as lncRNAs, miRNAs), and iSNPs may change the activities of these regulatory elements. Epigenetics: It may affect DNA methylation or histone modification patterns, indirectly regulating gene expression.
[0021] The transcriptional activity of genes is regulated by intron regions, and changes in transcriptional activity in turn cause changes in gene functions. Some studies have found that there are 2 iSNPs on the FST gene that are significantly correlated with the growth and reproductive traits of sows, and its functional domain is also significantly correlated with the growth traits of chickens, but it is not clear whether there is a correlation with egg-laying traits. Therefore, the present invention studies the SNPs in the Intron region of the chicken FST gene, aiming to find molecular marker sites related to chicken egg-laying traits and provide an effective theoretical basis for molecular marker-assisted selection breeding of chickens.
[0022] The number of SNP sites in genes is extremely large, with an average of one SNP occurring every 300 base pairs. This makes the study of SNPs both highly significant and challenging. The biggest problem is how to accurately screen out SNPs that are significantly associated with specific biological traits from a vast amount of SNPs. To identify the SNPs in the Intron region of the chicken FST gene, the present invention obtained the chicken FST gene sequence (ENSGALG00010012441) from Ensembl, that is, 1493 (A>G) on the chicken FST: ENSGALG00010012441 gene sequence in the Ensembl database. Primer P-FST-1 was designed to amplify the genomic DNA of chicken breeding materials. The PCR amplification product was subjected to agarose gel electrophoresis and recovered. The sequenced sequence is shown in SEQ ID NO.1. As a result, 1 mutation site, namely the A1493G site, was detected in Intron 1 of the FST gene.
[0023] Linkage disequilibrium analysis was performed using an EXCEL spreadsheet. The results showed that site 1493 presented a state of linkage disequilibrium. Therefore, this site was selected for single-site marker analysis, and the results showed that it was related to the number of eggs produced at 500 days of age.
[0024] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.
[0025] The test materials used in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. Those not described in detail in the methods adopted by the present invention are all prior art in the art.
[0026] Example 1: PCR amplification, sequence alignment and mutation site analysis of the Intron 1 sequence of the chicken FST gene 1. Test materials 500-day-old hemp-feathered Taihang hens raised individually in cages under the same feeding level and breeding conditions were selected. The chickens were selected from the Taihang chicken conservation base of Hebei Jiqin Animal Husbandry Technology Co., Ltd. Random samples were taken, blood was collected from the wing vein, genomic DNA of the blood was extracted and stored at -20°C.
[0027] 2. Test methods 2.1 Primer design According to the chicken FST gene sequence (ENSGALG00010012441) in Ensembl, the primer P-FST-1 used in this test was designed (see Table 1 for details). This primer was specifically designed according to the chicken sequence in the database to study the mutations in the Intron 1 region of the chicken FST gene.
[0028] 2.2PCR amplification Randomly select the genome of Taihang chickens with known egg production levels as a template. Perform PCR amplification using primer P-FST-1. Using the Taihang chicken genome as a template, perform PCR amplification with primer P-FST-1. The primers are shown in Table 1: PCR reaction system: 20 μL, including 0.5 μL of genomic DNA template (50 - 100 ng / μL), 10 μL of 2×Taq MasterMix, 0.5 μL each of P-FST-1F and P-FST-1R primers (10 μM), and 8.5 μL of dd H2O.
[0029] PCR amplification program: Pre-denature at 95°C for 5 min; denature at 95°C for 30 s, anneal at 61°C for 30 s, extend at 72°C for 1 min, and perform 31 cycles; after the cycles end, incubate at 72°C for 5 min. After the PCR amplification products are detected by 1.0% agarose gel electrophoresis without problems, send them to the company for sequencing by the direct sequencing method.
[0030] Table 1
[0031] 3. Enzyme digestion identification Select Afl II restriction endonuclease for single enzyme digestion. Perform single enzyme digestion according to the reaction system in Table 2 at 37°C for 6 h.
[0032] Table 2
[0033] Gel electrophoresis detection The electrophoresis of the PCR products is shown in Figure 1 , the length of the target fragment is 644 bp (SEQ ID NO.1), DL2000 DNA marker.
[0034] Analyze the sequencing results using Snap Gene software and find that there is a SNP at the 1493 site (Intron1) of the amplified FST gene of Taihang chickens (see Figure 3 , AA genotype: 644 bp; AG genotype: 644\475\169 bp; GG genotype: 475\169 bp; DL2000 DNA marker).
[0035] Association analysis of the polymorphism of chicken FST gene Intron 1 with egg production Analyze the mutation sites using an EXCEL spreadsheet. Use the χ2 goodness-of-fit test to determine whether the population is in Hardy-Weinberg equilibrium. Perform an association analysis of genotypes and traits (egg production) using the software SPSS 27.0, and set the significant difference level for multiple comparison analysis between different genotypes P <0.05.
[0036] Results and Analysis Linkage disequilibrium analysis was performed using EXCEL, and it was found that locus 1493 showed linkage disequilibrium. Therefore, this locus was selected for single-locus marker analysis, and it was found to be related to the egg production at 500 days of age.
[0037] Table 3 Genotype and Allele Frequency Distributions of SNPs in the Intron 1 Region of the Chicken FST Gene
[0038] Table 4 Association Analysis of the Polymorphism at Locus 1493 (Intron 1) of the Chicken FST Gene and Egg Production Performance Note: AFE refers to the age at first egg, E300 refers to the egg production at 300 days, and E500 refers to the egg production at 500 days.
[0039] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.
Claims
1. SNP molecular markers related to chicken egg production traits, characterized in that, The SNP locus is from the FST gene, and its nucleotide sequence is as shown in SEQ ID NO.
1. At the 1493rd base from the 5'-end of the shown sequence, base A has mutated to G. Among them, individuals with base G at the 1493rd locus of Intron 1 of the FST gene exhibit high-yield traits at 500 days of age.
2. Use of the SNP molecular marker related to chicken egg production traits as described in claim 1 in chicken genetic breeding.
3. The SNP molecular marker related to the chicken egg production trait according to claim 1, characterized in that, PCR primers for detecting the SNP molecular marker, using the labeled primer P-FST-1, including: P-FST-1F: 5' TCTTGGCTTGACTCCACGAAT 3'; P-FST-1R: 5' CCCGCTTAGGTGAAATAACAGT 3'.
4. The application according to claim 3, characterized in that, Use of the primers in the breeding for assisting in selecting high-yield laying hen breeds.
5. A kit for detecting the SNP molecular marker related to the high egg production trait of chickens as described in claim 3, characterized in that, The kit contains the primers as described in claim 4.
6. Use of the kit as described in claim 5 in the breeding for assisting in selecting high-yield laying hen breeds.
7. A method for marking the SNP molecular marker related to chicken high egg production traits as described in claim 1, characterized in that: (1) Genomic DNA extraction: Collect blood from the wing vein, extract genomic DNA, and store it at -20°C; (2) Primer design: Use the labeled primer P-FST-1, including: P-FST-1F: 5' TCTTGGCTTGACTCCACGAAT 3'; P-FST-1R: 5' CCCGCTTAGGTGAAATAACAGT 3'; (3) PCR amplification: 0.5 μL of 50 - 100 ng / μL genomic DNA template, 10 μL of 2×Taq Master Mix, 0.5 μL each of P-FST-1F and P-FST-1R primers (10 μM), 8.5 μL of dd H2O; PCR amplification program: Pre-denature at 95°C for 5 min; Denature at 95°C for 30 s, anneal at 61°C for 30 s, extend at 72°C for 1 min, and perform 31 cycles; After the cycle ends, incubate at 72°C for 5 min; (4) Electrophoresis detection: Detect the amplified product by gel electrophoresis to obtain the genotype corresponding to the sample. One mutation site is detected at the 1493rd locus of the FST gene, and individuals with base G are related to high-yield traits at 500 days of age.
8. The method for breeding high egg production varieties assisted by the SNP molecular marker according to claim 1 or 7, characterized in that Including the following steps: In a chicken population, select homozygous genotype roosters with genotype GG and homozygous genotype hens with genotype GG to mate with each other. The egg production of the resulting female offspring is significantly higher than that of the AA genotype. The GG genotype is that at the 1493rd base from the 5'-end of the sequence shown in SEQ ID NO.1, base A has mutated to G.
Citation Information
Cited By
Application of mitochondrial molecular marker in improvement of genetic breeding of chicken first-laying day age
CN120485389A