GPNMB gene molecular marker related to pigeon chest breadth character and application of GPNMB gene molecular marker

The molecular markers of GPNMB gene were screened through whole-genome resequencing, combined with PCR and Sanger sequencing technology, early selection of pigeon breast wide traits was achieved, solving the problem of slow breeding progress in the existing technology, and improving breeding efficiency and accuracy.

CN120290750AActive Publication Date: 2025-07-11NANJING AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510781398.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-07-11
Estimated Expiration
2045-06-12

AI Technical Summary

Technical Problem

The existing technology is difficult to quickly and accurately select the breast wide traits of pigeons, resulting in slow breeding progress and difficult to meet the needs of modern intensive and standardized production.

Method used

Through whole-genome resequencing technology, GPNMB gene molecular markers related to pigeon breast wide traits were screened, and PCR amplification and Sanger sequencing were used for PCR amplification and Sanger sequencing were detected to detect pigeon SNP genotypes, achieving early selection of pigeon breast wide traits.

Benefits of technology

It improves the breeding efficiency and accuracy of pigeon breeding, accelerates the breeding progress, saves breeding costs, and meets the needs of modern production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290750A_ABST
    Figure CN120290750A_ABST
Patent Text Reader

Abstract

The invention relates to a GPNMB gene molecular marker related to pigeon chest breadth character and application of the GPNMB gene molecular marker, and belongs to the technical field of biology. According to the GPNMB gene molecular marker related to the pigeon chest width character, the nucleotide sequences of SNP primers corresponding to the molecular marker are shown as SEQ ID NO: 1 and SEQ ID NO: 2, the site of the molecular marker is located at the 129265233rd base of a chromosome 2 of a pigeon reference genome ClivNAU1.0 version, and the base is mutated into C or T. By eliminating C / C and C / T genotype individuals and retaining T / T genotype individuals, the molecular marker has the beneficial effects that the molecular marker is used as a genetic marker for breeding pigeons, and the pigeons with wide and uniform chest width are bred; the pigeon breast width character can be efficiently and rapidly identified, the uniformity of the pigeon breast width is improved, a scientific basis is provided for early breeding of pigeons, and pigeon breeding is better served.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a GPNMB gene molecular marker related to the chest width trait of pigeons and its application, belonging to the field of biotechnology. Background Art

[0002] Currently, the mainstream pigeon breeding varieties are all pure lines introduced from abroad in the early stage, such as White King Pigeon, Silver King Pigeon, European Meat Pigeon, etc. The level of improved varieties and the level of professional seed industry in the pigeon industry are relatively low, making it difficult to meet the needs of modern intensive and standardized production.

[0003] The chest width trait is very important in pigeon breeding and production. It is a major economic performance index and one of the main body measurement traits for pigeon variety improvement and the cultivation of new varieties (matching lines). Due to the long generation cycle and slow progress of conventional breeding, it is difficult to accurately select. With the rapid development of modern biotechnology, molecular marker-assisted breeding technology has been widely applied in the field of breeding new varieties of animals and plants. Combining with conventional breeding technology can improve the accuracy of selecting target traits, achieve early selection, greatly accelerate the breeding progress, save breeding costs, and improve breeding efficiency. However, there are relatively few molecular markers related to the chest width trait of pigeons. Summary of the Invention

[0004] The object of the present invention is to propose a GPNMB gene molecular marker related to the chest width trait of pigeons and its application to improve the breeding efficiency of pigeons in view of the defects existing in the prior art.

[0005] GPNMB (Glycoprotein Non-Metastatic Melanoma Protein B) is a transmembrane protein belonging to the melanoma-associated antigen family (MAMPs), and plays a key role in various physiological and pathological processes, including cell proliferation, differentiation, immune regulation, and metabolic regulation.

[0006] IGF2BP3 (Insulin-like growth factor 2 mRNA-binding protein 3) near the downstream of GPNMB is an RNA-binding protein belonging to the IGF2BP family members, and plays a key role in mRNA stability, localization, and translation regulation. IGF2BP3 and the IGF2 signaling pathway it regulates play key roles in the body weight development of mammals, birds, and fish.

[0007] The present invention records the chest width trait of pigeons, uses whole-genome resequencing technology for SNP genotyping, and screens out relevant GPNMB gene molecular markers through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of pigeon chest width traits.

[0008] The present invention solves the technical problems through the following technical solutions: First, it provides a GPNMB gene molecular marker related to pigeon chest width and its primers. The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO:1 and SEQ ID NO:2. The molecular marker is located at the 129,265,233rd base of chromosome 2 in the pigeon reference genome Cliv_NAU_1.0 version (National Genomics Data Center, https: / / ngdc.cncb.ac.cn / gwh, accession number GWHFCQQ00000000.1), and the base mutation is C or T. The molecular marker is located at the 313th base shown in SEQ ID NO:3 or SEQ ID NO:4.

[0009] The present invention further provides the application of the above molecular marker primers for the detection of SNP genotypes related to pigeon chest width traits. The detection method includes the following steps. First step: Provide a DNA sample of the pigeon to be tested, perform PCR amplification with the molecular marker primers to obtain an amplification product. The length of the amplification product is 425bp and contains the 129,265,233rd base of pigeon chromosome 2. Second step: Perform Sanger sequencing on the PCR product. Third step: Judge the SNP molecular marker genotype of the 129,265,233rd base of chromosome 2 according to the sequencing peak map.

[0010] The deoxyribonucleotide sequence of the pigeon DNA specific primer pair in the first step is: Forward primer: 5’-GCAGCTCCAGTTGTGTCTTC-3’ (SEQ ID NO:1) Reverse primer: 5’-CAGACTCCCACTGCTCTAGG-3’ (SEQ ID NO:2) The reaction system is calculated based on 50 μl, and the system is as follows: DNA of the pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer containing Mg2+ 5μl 10mM dNTPs 1μl 10μM forward primer F 1μl 10μM reverse primer R 1μl Make up to 50 μl with sterile water; The reaction conditions for the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; preservation at 4°C; the nucleotide sequence of the amplification product is as shown in SEQ ID NO:3 or SEQ ID NO:4, the length of the amplification product is 425 bp, and it contains the base at position 129265233 on chromosome 2 of pigeons.

[0011] In the third step described above, the judgment criterion is that the chest width of pigeons with the T / T genotype at the SNP locus is higher than that of pigeons with the C / T genotype, and the chest width of individuals with the C / T genotype is higher than that of individuals with the C / C genotype.

[0012] The present invention detects the chest width trait of pigeons through the genotype of the GPNMB gene molecular marker, and obtains that the chest width of pigeons with the T / T genotype is higher than that of individuals with the C / T genotype and the C / C genotype, and the chest width of pigeons with the C / T genotype is higher than that of individuals with the C / C genotype. By using the genomic DNA of the pigeon to be tested as a template, specific primer pairs are used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP genotyping. Based on the genotype of this SNP molecular marker, the selection of the chest width trait of pigeons can be realized. For example, in breeding, if it is necessary to breed pigeon varieties with a higher chest width, individuals with the C / C and C / T genotypes can be eliminated, and individuals with the T / T genotype can be retained. The beneficial effect is that early selection of the chest width trait of pigeons can be realized, the accuracy of breeding selection can be improved, the breeding progress can be accelerated, the breeding cost can be saved, the breeding efficiency can be improved, and it can better serve the breeding of pigeons, with high economic application and scientific research value. Description of the Drawings

[0013] Figure 1 It is the result of the genome-wide association analysis of the chest width trait of pigeons.

[0014] Figure 2 It is the Sanger sequencing result of the PCR amplification products of three genotypes. Detailed Embodiments

[0015] In the following examples, the pigeon varieties used are all commercially available and will not be elaborated.

[0016] Example 1 In this example, the chest widths of 150-week-old pigeons of 3 varieties, namely Danish Silver King Pigeons, Taishen Pigeons, and American Silver King Pigeons, were measured. The second-generation sequencing technology was used for genome-wide SNP genotyping, and the relevant GPNMB gene molecular markers were screened through genome-wide association analysis. The results are as Figure 1 shown.

[0017] In this example, the GPNMB gene molecular markers related to the pigeon chest width trait were identified and applied through the following experiments.

[0018] 1. Phenotype determination and genotype detection (1)Experimental materials and chest width phenotype determination Select 389 pairs of breeding pigeons, with the breeds being Danish Silver King Pigeons, Taishen Pigeons, and American Silver King Pigeons. The numbers of the three breeds are close. They are raised under the same feeding conditions, with free access to food and water throughout the process. When they reach 150 weeks of age, after the breeding pigeons have laid eggs, fast for 12 h and then record the body measurements of each pigeon as the phenotypic data of the pigeon chest width.

[0019] (2)Genomic DNA extraction Collect blood from the wing vein of the above pigeons, store it in EDTA anticoagulant, and extract genomic DNA using an Omiga brand blood extraction kit.

[0020] (3)PCR amplification Using the extracted genomic DNA as a template, amplify the fragment containing the base site at position 129265233 on chromosome 2.

[0021] Forward primer: 5’-GCAGCTCCAGTTGTGTCTTC-3’ (SEQ ID NO:1) Reverse primer: 5’-CAGACTCCCACTGCTCTAGG-3’ (SEQ ID NO:2) The reaction system is 50 μl, and the system is as follows DNA of the pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer (containing Mg2+) 5 μl 10 mM dNTPs 1 μl 10 μM forward primer F 1 μl 10 μM reverse primer R 1 μl Sterile water Make up to 50 μl; The reaction conditions for the PCR amplification are pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 sec, annealing at 60 °C for 30 sec, extension at 72 °C for 60 sec, for a total of 27 cycles; extension at 72 °C for 5 min; store at 4 °C. The amplified product sequence is as SEQ ID NO:3 GCAGCTCCAGTTGTGTCTTCTTGGGGTAGATACTGTTTTGGTCAGCAATTAGGCAACTCGTCATGTTGCTTATCTGAGAGTAGCTTTTTCTGAGACAAAGGAAGTGTACTCTTTAAAATCTTTAGGTGGTTTATTTGTCAATGCAGCAGTTAGATTCCATTGTATAAAACTAAAGATGGGTGAAATGGAAGTTACAGCTGAAAATGCAAAATCAAATTATAAAAATTTAATATTCTGACATGATATTTAAAGGAAGATAGTGCAAGCCATTCTGTGTACTTAGGTTAAAGGATAAAGAAAGTTCTTAAAATACACCCAAAATTTGGTTTCTATGCAAAAGCCTAAGATGTCTCTGAGTTCCTAACATGCAGCGTTTTACTGAAACAAGATGCTTTCTGCATATAACCTAGAGCAGTGGGAGTCTG or SEQ ID NO:4 GCAGCTCCAGTTGTGTCTTCTTGGGGTAGATACTGTTTTGGTCAGCAATTAGGCAACTCGTCATGTTGCTTATCTGAGAGTAGCTTTTTCTGAGACAAAGGAAGTGTACTCTTTAAAATCTTTAGGTGGTTTATTTGTCAATGCAGCAGTTAGATTCCATTGTATAAAACTAAAGATGGGTGAAATGGAAGTTACAGCTGAAAATGCAAAATCAAATTATAAAAATTTAATATTCTGACATGATATTTAAAGGAAGATAGTGCAAGCCATTCTGTGTACTTAGGTTAAAGGATAAAGAAAGTTCTTAAAATATACCCAAAATTTGGTTTCTATGCAAAAGCCTAAGATGTCTCTGAGTTCCTAACATGCAGCGTTTTACTGAAACAAGATGCTTTCTGCATATAACCTAGAGCAGTGGGAGTCTG as shown

[0022] (4)Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagrams were as Figure 2As shown, the genotyping data of the SNP molecular marker at the 129265233rd base on chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 version was obtained.

[0023] 2. Correlation analysis A total of 389 pairs of pigeons with clear body size phenotype records at 150 weeks of age were selected for correlation analysis. The ANOVA test function of the GraphPad Prism 9 statistical software was used for statistical testing. The average value comparison mode between pairs was selected to statistically analyze the genotypes and traits of the experimental pigeon population. P<0.05 indicates a significant difference. The results showed that there was a significant difference in chest width among the three genotypes of pigeons (P<0.05). The average chest width of T / T genotype pigeons was 7.27 cm, which was significantly higher than that of C / T genotype pigeons (6.95 cm) and C / C genotype pigeons (6.66 cm) (P<0.05). The chest width of C / T genotype pigeons was higher than that of C / C genotype pigeons (P<0.05). The results indicated that the locus at the 129265233rd base on chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 version was significantly associated with the chest width trait phenotype of pigeons. Individuals with T / T genotype can be selected according to the actual breeding goal to breed pigeons with larger chest widths, improve the overall chest width and uniformity, and improve the breeding efficiency.

[0024] The data are shown in Tables 1 and 2.

[0025] Genotype Number of individuals Chest width at 150 weeks of age / cm CV / % C / C 697 <![CDATA[6.66±0.40 a > 6.0 C / T 68 <![CDATA[6.95±0.45 b > 6.5 T / T 13 <![CDATA[7.27±0.44 c > 6.1 Note: The same letter superscript for the data in the same column indicates no significant difference, and different letter superscripts indicate a significant difference (P<0.05).

[0026] Genotype Male / per Chest width at 150 weeks of age / cm Female / per Chest width at 150 weeks of age / cm C / C 357 <![CDATA[6.71±0.42 a > 340 <![CDATA[6.61±0.37 b > C / T 32 <![CDATA[7.01±0.40 b > 36 <![CDATA[6.89±0.49 ac > T / T 6 <![CDATA[7.48±0.53 c > 7 <![CDATA[7.09±0.28 a > Note: The same letter superscript for the data in the same column indicates no significant difference, and different letter superscripts indicate a significant difference (P<0.05).

[0027] Example 2 Genotype frequencies of different breeds 1. Blood sample collection Blood samples of 13 breeds of pigeons were collected using the wing vein blood collection method, including 6 commercial pigeon breeds such as Danish Silver King, American Silver King, Taishen Pigeon, White King Pigeon, Yellow Carneau Pigeon, and Grey King Pigeon, 2 domestic local breeds such as Tarim Pigeon and Shiqi Pigeon, and 5 ornamental pigeon breeds with relatively light body weights such as Lady Pigeon, Angel Pigeon, Taihu Spotted Pigeon, Furong Pigeon, and Fantail Pigeon, and stored at -20°C for later use.

[0028] 2. Genomic DNA extraction Taking the tissue samples obtained in the first step, genomic DNA was extracted using the Omega brand tissue genomic DNA extraction kit, and the specific method was referred to the standard operation procedure of the Omega brand.

[0029] 3. Detection of genotypes Using the genomic DNA obtained in the second step as a template, PCR amplification and Sanger sequencing were performed with a primer pair consisting of the F nucleotide sequence (SEQ ID NO:1) and the R nucleotide sequence (SEQ ID NO:2) to obtain the C / C genotype, C / T genotype, and T / T genotype of the individual.

[0030] 4. Result analysis Danish Silver King, American Silver King, Taishen Pigeon, White King Pigeon, etc. are all relatively popular meat pigeon breeding varieties in the market. After certain breeding for the chest width trait, the frequency of the T allele occupies a certain proportion in the population. However, for ornamental pigeon varieties such as Lady Pigeon, Angel Pigeon, Furong Pigeon, and Taihu Dotted Pigeon, which have not undergone breeding for the chest width trait, the frequency of the T allele in the population is lower than that of the above-mentioned meat pigeon varieties. These results can all confirm that this SNP locus can be used as a molecular marker for the chest width trait of pigeons.

[0031] Variety C allele frequency T allele frequency Number of individuals Danish Silver King Pigeon 0.87 0.13 50 Taishen Pigeon 0.99 0.01 50 American Silver King Pigeon 0.97 0.03 50 Yellow Carneau Pigeon 0.92 0.08 23 Grey Feather King Pigeon 0.90 0.10 18 White Feather King Pigeon 0.85 0.15 9 Shiqi Pigeon 0.99 0.01 36 Tarim Pigeon 0.98 0.02 28 Taihu Spotted Pigeon 1.00 0.00 15 Furong Pigeon 1.00 0.00 15 Lady Pigeon 1.00 0.00 16 Fantail Pigeon 1.00 0.00 10 Angel Pigeon 1.00 0.00 18 。

[0032] In addition to the above embodiments, the present invention may also have other embodiments. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope required by the present invention.

Claims

1. A GPNMB gene molecular marker related to the pigeon chest width trait, characterized in that: The nucleotide sequences of the SNP primers corresponding to the molecular marker are shown in SEQ ID NO:1 and SEQ ID NO:

2. The molecular marker locus is located at the 129265233rd base of chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 version, and the base mutation is C or T.

2. Use of the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 1, characterized in that: The SNP primers are used for detecting the chest width trait of pigeons. The detection method includes the following steps. First step: PCR amplify the DNA sample of the pigeon to be tested with the SNP primers shown in SEQ ID NO:1-2 to obtain an amplification product. The length of the amplification product is 425bp and contains the 129265233rd base of pigeon chromosome 2. Second step: Perform Sanger sequencing on the PCR product. Third step: Determine the SNP molecular marker genotype of the 129265233rd base of pigeon chromosome 2 according to the sequencing result of the second step.

3. The application of the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 2, wherein: The reaction system is calculated based on 50 μl, and the system is DNA of pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer containing Mg2+ 5 μl 10 mM dNTPs 1 μl 10 μM upstream primer F 1 μl 10 μM downstream primer R 1 μl Sterile water Make up to 50 μl.

4. Use of the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 3, characterized in that: The reaction conditions for the PCR amplification are pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; store at 4°C.

5. Use of the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 3, characterized in that: The nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:

4.

6. The application of the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 2, wherein: The judgment criterion in the third step is that the chest width of pigeons with the T / T genotype at the SNP locus is higher than that of individuals with the C / T genotype and the C / C genotype, and the chest width of individuals with the C / T genotype is higher than that of individuals with the C / C genotype.

Citation Information

Patent Citations

  • MSTN gene and meat pigeon growth and slaughter trait related SNP molecular marker and application thereof

    CN115948572A

  • Indel molecular marker related to growth and slaughter traits in meat pigeon IGF2BP3 gene and application of Indel molecular marker

    CN116904614A

  • Application and method of reagent for detecting SNP (Single Nucleotide Polymorphism) molecular marker related to pigeon breast muscle weight

    CN117363746A

  • IGF2BP3 gene molecular marker primer related to pigeon body weight character and application of IGF2BP3 gene molecular marker primer

    CN120174116A