Indel molecular marker for identifying peach pulp color (yellow / non-yellow) character and application of Indel molecular marker

By developing Indel molecular markers and KASP marker primers at specific locations in the peach genome, the problem of difficulty in quickly identifying peach pulp color in the prior art is solved, efficient and accurate flesh color identification is achieved, and breeding efficiency and accuracy are improved.

CN120290784APending Publication Date: 2025-07-11ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510718900.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify the color (yellow/non-yellow) traits of peach pulp, resulting in low breeding efficiency and increased cost.

Method used

An Indel molecular marker located at 28580182bp of the first chromosome of the peach genome and its corresponding KASP marker primers were developed to determine the color of the flesh through fluorescence signals and to combine KASP technology for high-throughput typing.

Benefits of technology

The accuracy of peach pulp color (yellow/non-yellow) traits is achieved by more than 85%, which significantly improves breeding efficiency and accuracy and reduces selection costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290784A_ABST
    Figure CN120290784A_ABST
Patent Text Reader

Abstract

The invention discloses an Indel molecular marker for identifying the color (yellow / non-yellow) character of peach pulp and application of the Indel molecular marker, the Indel molecular marker is located at the 28580182bp position (TGTAG / T) of a first chromosome of a peach genome, and the nucleotide sequences of front and back 200bp of the position are shown as SEQ ID NO.1 or SEQ ID NO.2. The invention further discloses a method for identifying the color (yellow / non-yellow) character of the peach pulp. The genotyping result of the marker is sorted in combination with phenotypes, 0 / 0 (TGTAG / TGTAG) represents no deletion at the site, 0 / 1 (TGTAG / T) represents heterozygous deletion at the site, and the two types correspond to non-yellow peach fruits; 1 / 1 (T / T) represents homozygous deletion at the site and corresponds to a yellow peach fruit. The accuracy of the Indel molecular marker is verified, and the result shows that the overall accuracy of identifying the peach pulp color (yellow / non-yellow) character by using the Indel molecular marker can reach 85% or above, so that the selection cost is greatly reduced, and the quality improvement efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an Indel molecular marker for identifying the trait of peach pulp color (yellow / non-yellow) and its application, belonging to the field of biotechnology. Background Art

[0002] Peach is a horticultural product mainly for fresh consumption. Its pulp color not only affects consumers' preferences, but also can characterize its partial nutritional value, flavor, etc. It is one of the most important quality traits of peach fruits. Peach pulp color is divided into yellow, red and white. Among them, yellow-fleshed peaches are rich in carotenoids (such as β-carotene, lutein) and phenolic compounds, and their antioxidant activity is higher than that of non-yellow-fleshed peach varieties. Therefore, due to its unique color and rich nutritional value, yellow-fleshed peaches are loved by more and more consumers and valued by breeders, making them a new development hotspot. However, since the pulp color of peaches can only be observed after fruiting, and its cycle from planting to fruiting is long, with a long growing season, the breeding efficiency is reduced, and the breeding cost is greatly increased. Although genomics technology has accelerated the cloning and mapping of genes in the pigment metabolism pathway (such as carotenoid synthase), practical applications still face multiple challenges: the genetic background is highly heterozygous, and the genetic mapping accuracy of peach flesh color is insufficient; the development of molecular markers lags behind, the existing marker density is low, and the generality is poor, making it difficult to guide efficient assisted breeding, and most of the markers have not been truly applied to breeding practice. How to more precisely map related genes and at the same time screen molecular markers with higher generality still needs further research. The juvenile period of peach trees is long, and it takes a long time to construct a genetic population. Currently, the obtained molecular markers are still few. With the rapid development of genomic research, developing more molecular markers for early identification of pulp types can accelerate the research process of pulp color. Summary of the Invention

[0003] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide an Indel molecular marker for identifying the trait of peach pulp color (yellow / non-yellow) and its application, and this marker has a high accuracy rate in identifying the trait of peach pulp (yellow / non-yellow).

[0004] To achieve the above purpose, the technical solution of the present invention is to provide an Indel molecular marker for identifying the trait of peach pulp color (yellow / non-yellow). The Indel molecular marker is located at the 28,580,182 bp of chromosome 1 of the peach genome, and the nucleotide sequences of 200 bp before and after this site are shown in SEQ ID NO.1 or SEQ ID NO.2.

[0005] Furthermore, the polymorphism of the Indel mutation site is TGTAG / T; when the Indel mutation site is TGTAG / TGTAG or TGTAG / T, it corresponds to non-yellow peach fruit; when the Indel mutation site is T / T, it corresponds to yellow peach fruit.

[0006] On the other hand, the technical solution of the present invention is to provide a primer for detecting the Indel molecular marker. There are three KASP marker primers corresponding to the Indel molecular marker, including F1, F2 and R, and the nucleotide sequences are shown in SEQ ID NO.3-5 respectively.

[0007] Furthermore, the 5' end of the F1 primer is connected to a FAM fluorescent label, and the 5' end of the F2 primer is connected to a VIC fluorescent label.

[0008] On the other hand, the technical solution of the present invention is to provide a kit for identifying the color (yellow / non-yellow) trait of peach flesh, comprising the primers (F1, F2 and R).

[0009] On the other hand, the technical solution of the present invention is to provide a method for identifying the peach flesh color (yellow / non-yellow) trait using the Indel molecular marker, comprising the following steps:

[0010] (1) extracting DNA from peach tissue samples to be tested as a template;

[0011] (2) Using the primers, the samples were typed using KASP technology to predict the peach flesh color (yellow / non-yellow) trait to be tested.

[0012] Furthermore, the typing method is: judging the typing of the sample according to the detected fluorescence signal; when the fluorescence signal is aggregated near the X-axis (FAM signal), the corresponding genotype is the allele type of the F1 sequence (0 / 0); when the fluorescence signal is aggregated near the Y-axis (VIC signal), the corresponding genotype is the allele type of the F2 sequence (1 / 1); when the fluorescence signal is aggregated in the middle, the corresponding genotype is the heterozygous type of two alleles (0 / 1).

[0013] On the other hand, the technical solution of the present invention is to provide an application of the Indel molecular marker, the primer, and the kit in identifying the color (yellow / non-yellow) trait of peach flesh.

[0014] On the other hand, the technical solution of the present invention is to provide an application of the InDel molecular marker, the primer, and the kit in molecular marker-assisted selection breeding of peach fruit color traits.

[0015] On the other hand, the technical solution of the present invention is to provide an application of the Indel molecular marker and the primer in the preparation of products for identifying the trait of peach pulp color (yellow / non-yellow).

[0016] Beneficial effects:

[0017] The present invention has identified an Indel molecular marker significantly associated with peach pulp color (yellow / non-yellow), which is located at 28,580,182 bp on chromosome 1 of the peach genome (TGTAG / T). At the same time, the genotyping results of this marker were sorted out in combination with the phenotypes. Among them, 0 / 0 (TGTAG / TGTAG) indicates no deletion at this locus, 0 / 1 (TGTAG / T) indicates heterozygous deletion at this locus, and both genotypings correspond to non-yellow peach fruits; 1 / 1 (T / T) indicates homozygous deletion at this locus, corresponding to yellow peach fruits. The present invention verified the accuracy of this Indel molecular marker. The results showed that the overall accuracy of using this Indel molecular marker to identify the trait of peach pulp color (yellow / non-yellow) can reach more than 85%, greatly reducing the selection cost and improving the efficiency of quality improvement. Through the whole-genome resequencing technology, the present invention screened InDel markers significantly linked to the target trait and designed molecular marker primers, which can be simply, quickly and high-throughput applied to the breeding practice of peach pulp color and can be used for molecular marker-assisted selection breeding. Description of the drawings

[0018] Figure 1 It is a Manhattan plot and a QQ plot of the GWAS analysis results.

[0019] Figure 2 It is the genotyping results related to the genotype of different pulp colors in the hybrid population. Specific embodiments

[0020] The following further details the specific embodiments of the present invention in conjunction with the examples.

[0021] Example 1

[0022] This invention refers to the "Descriptive Specification and Data Standard for Peach Germplasm Resources". When the peach fruits reached the mature stage, the colors of the flesh of 595 germplasms were observed, including 236 yellow-fleshed peaches and 359 non-yellow-fleshed peaches. For each sample, 2g of fresh and tender leaves were collected, and DNA was extracted using the traditional CTAB method. The sequencing platform was illumina GAII or Hiseq 2500, the inserted library size was 300 or 500bp, and paired-end sequencing was performed. Data quality control was carried out using FastQC (v0.11.6), http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / . Using the "LoveII" peach genome (genome version number: Prunus persica Genome v2.0.a1;

[0023] https: / / www.rosaceae.org / species / prunus_persica / genome_v2.0.a1) as the reference genome, the reads were aligned to the reference genome using BWA (v0.7.12), with the parameters: bwa mem -t 4 -M -R, and the resulting alignment file was a SAM file. Picard (version: 1.136) was used to sort the aligned reads, remove PCR duplicates, and convert the SAM file to a BAM file. The final alignment depth and coverage were calculated using Depth Of Coverage in the GATK (version: 3.4 - 46) software and genomecov in the BEDtools (version: 2.24.0) software respectively. SNP and Indel detection were performed using the GATK software. To reduce the impact of sequencing errors in gene identification and improve the statistical power of GWAS, SNPs and Indels were filtered to remove low-frequency variations (MAF < 0.05), and the final number of markers obtained was 504,875. For GWAS, the mixed linear model MLM (Mixed linear model) was selected, and the software was EMMAX (Version: beta). Using the Bonferroni test with 5% as the threshold, an Indel molecular marker significantly associated with peach flesh color (yellow / non-yellow) was identified, located at position 28580182bp on chromosome 1 of the peach genome (TGTAG / T)( Figure 1)。Meanwhile, the genotyping results of this marker were sorted out in combination with the phenotypes, where 0 / 0 (TGTAG / TGTAG) indicates no deletion at this locus, 0 / 1 (TGTAG / T) indicates heterozygous deletion at this locus, and both genotypings correspond to non-yellow peach fruits; 1 / 1 (T / T) indicates homozygous deletion at this locus, corresponding to yellow peach fruits. The sequences of 200bp before and after the Indel variant site are as follows (the Indel variant site is in brackets):

[0024] AAATTGGTTGTGCTGTTGGGAGACGACTGCTTGAGGCAACAAGCCACCATGAGCTGCTGCCTGCTGCCTAGCTTTATCTGTGCCCTTTAATTCTTGTCTAGGTGCTTGGGGCCTTGCCCAATATCACTTCAATCTCAAACCCTTCATCACTAGTTTATTAAAGAGATCTTCTGCAACCTTCTCTGCACCTTCTCTTGTTG[TGTAG]GTTACAAAAGCACATCTTCGTTCG AGCAGCAGCATCCGAATGGGTTCGATTTCACCATGAGCATACTTTCTTCCGTGAAAAATTATCATAAGTTTTGGATAACCATATGTAAGCACAATTCTGAGAGACGAATTCTACCAAGCAAAGCATATACATATTCGATACTTTGTTGCATCATCTTGGAAGGTGATGCCTAATCA(SEQ ID NO.1)

[0025] AAATTGGTTGTGCTGTTGGGAGACGACTGCTTGAGGCAACAAGCCACCATGAGCTGCTGCCTGCTGCCTAGCTTTATCTGTGCCCTTTAATTCTTGTCTAGGTGCTTGGGGCCTTGCCCAATATCACTTCAATCTCAAACCCTTCATCACTAGTTTATTAAAGAGATCTTCTGCAACCTTCTCTGCACCTTCTCTTGTTG[T]GTTACAAAAGCACATCTTCGTTCG AGCAGCAGCATCCGAATGGGTTCGATTTCACCATGAGCATACTTTCTTCCGTGAAAAATTATCATAAGTTTTGGATAACCATATGTAAGCACAATTCTGAGAGACGAATTCTACCAAGCAAAGCATATACATATTCGATACTTTGTTGCATCATCTTGGAAGGTGATGCCTAATCA(SEQ ID NO.2)

[0026] Example 2

[0027] Sixty-three peach trees with determined flesh color were randomly selected from the peach germplasm resource nursery of Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences. The DNA of the above peach tree samples (leaves) was extracted using the modified CTAB method and used as a template. According to the above insertion-deletion sites, KASP marker primers were designed with reference to the upstream and downstream sequences, a total of 3 (sequences are as follows), among which the 5' end of the F1 primer was linked with the FAM fluorescent label, and the 5' end of the F2 primer was linked with the VIC fluorescent label.

[0028] F1: 5’-GAAGGTGACCAAGTTCATGCTTCTCTGCACCTTCTCTTGTTGTGTA-3’(SEQ ID NO.3)

[0029] F2: 5’-GAAGGTCGGAGTCAACGGATTTCTCTGCACCTTCTCTTGTTGTGTT-3’(SEQ ID NO.4)

[0030] R: 5’-GGATGCTGCTGCTCGAACGAAGATGTGCT-3’(SEQ ID NO.5)

[0031] The KASP reaction system and procedure are as follows (Tables 1 and 2). After the reaction, the genotyping of the samples is determined based on the two detected fluorescence signals. When the fluorescence signals aggregate near the X-axis (FAM signal), the corresponding genotype is the allelic genotype of the F1 sequence (0 / 0). When the fluorescence signals aggregate near the Y-axis (VIC signal), the corresponding genotype is the allelic genotype of the F2 sequence (1 / 1). When the fluorescence signals aggregate in the middle, it indicates the heterozygous type of the two alleles (0 / 1). The results show (Table 3) that the accuracy rate corresponding to the yellow flesh trait and the genotype (1 / 1) is 68.75%, the accuracy rate corresponding to the non-yellow flesh trait and the genotypes (0 / 0 and 0 / 1) is 93.62%, and the overall accuracy rate is 87.30%.

[0032] Table 1 Reaction System

[0033] Reagent Volume DNA template 2 μL (25 ng - 150 ng) FLu-Arms 2× for KASP PCR Mix 5 μL F1 0.1 μL (10 μM) F2 0.1 μL (10 μM) R 0.3 μL (10 μM) <![CDATA[ddH2O]]> 2.5 μL Total volume 10 μL

[0034] Table 2 Reaction Steps

[0035]

[0036] Table 3 Genotyping Results of the Pulp Colors of 63 Peach Trees

[0037]

[0038] Example 3

[0039] Using the conventional peach varieties planted in the resource nursery of the Zhengzhou Fruit Research Institute as experimental materials, a total of 606 individual plants from 13 hybrid populations with investigated phenotypic traits (yellow / non-yellow pulp color) and completed resequencing were selected (see Table 4 for details). The genotypes and phenotypes were analyzed, and the results showed (Tables 5 and Figure 2 ) that the accuracy rate corresponding to the yellow flesh trait and the genotype (1 / 1) is 91.21%, the accuracy rate corresponding to the non-yellow flesh trait and the genotypes (0 / 0 and 0 / 1) is 94.01%, and the overall accuracy rate is 92.90%.

[0040] Table 4 Names and Sizes of the Tested Hybrid Populations

[0041]

[0042]

[0043] Table 5 Genotyping Results Related to Genotypes for Different Colors in the Above Hybrid Populations

[0044]

[0045] Note: 0 / 0: No deletion; 0 / 1: Heterozygous deletion; 1 / 1: Homozygous deletion.

Claims

1. An Indel molecular marker for identifying the trait of peach pulp color (yellow / non-yellow), characterized in that, The Indel molecular marker is located at 28,580,182 bp on chromosome 1 of the peach genome, and the nucleotide sequences of 200 bp before and after this locus are shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The Indel molecular marker according to claim 1, characterized in that, The polymorphism of the Indel variation site is TGTAG / T; when the Indel variation site is TGTAG / TGTAG or TGTAG / T, it corresponds to non-yellow peach fruits; when the Indel variation site is T / T, it corresponds to yellow peach fruits.

3. A primer for detecting the Indel molecular marker according to claim 1 or 2, characterized in that, There are 3 KASP marker primers corresponding to the Indel molecular marker, including F1, F2 and R, and the nucleotide sequences are shown in SEQ ID NO.3-5 respectively.

4. The primer according to claim 3, characterized in that, The 5' end of the F1 primer is linked with a FAM fluorescent label, and the 5' end of the F2 primer is linked with a VIC fluorescent label.

5. A kit for identifying the trait of peach pulp color (yellow / non-yellow), characterized in that, Comprising the primer according to claim 3 or 4.

6. A method for identifying the trait of peach pulp color (yellow / non-yellow) using the Indel molecular marker described in claim 1 or 2, characterized in that, Comprising the following steps: (1) Extracting the DNA of the peach tissue sample to be tested as a template; (2) Using the primer according to claim 3 or 4 and typing the sample by KASP technology to predict the trait of the color of the pulp of the peach to be tested (yellow / non-yellow).

7. The method according to claim 6, wherein The typing method is: judging the typing situation of the sample according to the detected fluorescent signal; when the fluorescent signal aggregates near the X-axis (FAM signal), the corresponding genotype is the allelic genotype (0 / 0) of the F1 sequence; when the fluorescent signal aggregates near the Y-axis (VIC signal), the corresponding genotype is the allelic genotype (1 / 1) of the F2 sequence; when the fluorescent signal aggregates in the middle, the corresponding genotype is the heterozygous type of the two alleles (0 / 1).

8. Use of the Indel molecular marker according to claim 1 or 2, the primer according to claim 3 or 4, and the kit according to claim 5 in identifying the trait of the color of the pulp of the peach (yellow / non-yellow).

9. Use of the InDel molecular marker according to claim 1 or 2, the primer according to claim 3 or 4, and the kit according to claim 5 in molecular marker-assisted selection breeding for the color trait of peach fruits.

10. Use of the Indel molecular marker according to claim 1 or 2 and the primer according to claim 3 or 4 in the preparation of a product for identifying the trait of the color of the pulp of the peach (yellow / non-yellow).