MiR-108 and miR-049 and uses thereof
By regulating the pancreatic cancer-related KRAS gene through miR-108 and miR-049, and utilizing RNAi technology and a lipid nanoparticle delivery system, the problems of chemotherapy drug side effects and drug resistance have been solved, achieving precision treatment of pancreatic cancer.
Patent Information
- Application Number
- CN202510811992.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-06-18
AI Technical Summary
Existing chemotherapy drugs for treating pancreatic cancer have significant side effects and drug resistance problems, making it urgent to develop new treatment options.
Using miR-108 and miR-049 as small RNA molecules, we directly regulated the pancreatic cancer-related KRAS gene through RNA interference (RNAi), and used a lipid nanoparticle delivery system to increase tumor tissue enrichment and significantly reduce non-specific killing of normal cells.
miR-108 and miR-049 can precisely inhibit the proliferation and metastasis of pancreatic cancer, significantly reduce off-target effects, and provide a safer and more effective treatment option.
Smart Images

Figure CN120310801B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, more particularly to miR-108 and miR-049 and application. BACKGROUND
[0002] At present, pancreatic cancer is still one of the most deadly cancers. And the existing chemotherapy drugs for treating pancreatic cancer will produce obvious side effects, such as gemcitabine often causes bone marrow suppression, gastrointestinal reactions and other systemic toxicities, and pancreatic cancer is easy to produce drug resistance to these chemotherapy drugs. Therefore, it is urgent to develop new drugs to provide more treatment options for patients with pancreatic cancer. Compared with traditional protein targeting and DNA-based drugs, RNA-based drugs have received extensive attention in recent years due to their unique physical and chemical and physiological characteristics.
[0003] Therefore, it is an urgent problem for those skilled in the art to provide a new miRNA for treating pancreatic cancer. SUMMARY
[0004] Therefore, the present application provides miR-108 and miR-049 and application.
[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0006] miRNA, the miRNA is miR-108 or miR-049;
[0007] The nucleotide sequence of the miR-108 is shown as SEQ ID No. 1;
[0008] The nucleotide sequence of the miR-049 is shown as SEQ ID No. 2.
[0009] A recombinant vector containing a coding gene of the miRNA, the miRNA is miR-108 or miR-049.
[0010] The miRNA or the recombinant vector is used for preparing a drug for treating human pancreatic cancer.
[0011] Through the above technical solutions, compared with the prior art, the present application has the following beneficial effects:
[0012] The miR-108 and miR-049 of the present application are small molecule RNAs (miRNAs), which can precisely regulate the KRAS gene related to pancreatic cancer through RNA interference (RNAi), directly inhibit the tumor proliferation or metastasis pathway, and avoid the non-specific killing of normal cells by traditional chemotherapy drugs. The RNA drug can improve the enrichment of tumor tissue through a delivery system (such as a lipid nanoparticle), and significantly reduce the off-target effect. Attached Figure Description
[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0014] Figure 1 The approach to constructing shRNA vectors; Figure 1 a is the HindIII restriction site; Figure 1 b represents the BamHI restriction site; Figure 1 c represents the target miRNA fragment linked to the vector; Figure 1 d represents the target shRNA expressed within the cell;
[0015] Figure 2 qRT-PCR experiments were performed in PANC-1 cells after transfection with different miRNAs. Figure 2 a and Figure 2 b represents the results of the same experimental group;
[0016] Figure 3 The absorbance of PANC-1 cells at 450 nm before and after transfection; Figure 3 a is the standard curve of absorbance at 450 nm for different concentrations of PANC-1 cells; Figure 3 b shows the cell proliferation of PANC-1 cells after transfection with mimics0000, mimics0001, and mimics0002;
[0017] Figure 4 The changes in tumor volume and tumor inhibition rate in each group of nude mice were analyzed. Figure 4 a represents the change in tumor volume in each group of nude mice over two weeks; Figure 4 b represents the tumor inhibition rate of each group of nude mice. Detailed Implementation
[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0019] Example 1
[0020] In the previous study, the present application identified 168 milRNAs existing in Ganoderma lucidum by high-throughput sequencing. The present application uses the existing four prediction websites (MiRanda, RNAhybrid, PITA and Targetscan) to make preliminary prediction analysis on the 168 miRNAs. After collecting the intersection of the results of the above four websites, 48 miRNAs are preliminarily screened out.
[0021] Subsequently, the present application selects 25 miRNAs with the highest credibility in the prediction results for experimental screening, and further verifies the activity of targeting KRAS gene through qRT-PCR experiment.
[0022] Vector construction
[0023] Design of PCR primers
[0024] Short hairpin RNA (shRNA) is a short double-stranded RNA structure generated by relying on stem loop sequence, which is actually a way to obtain siRNA in vivo through vector construction, and can also regulate target genes through RNAi pathway. According to the basic sequence design requirements and principles of shRNA technology, the sequence of miRNA fragment connected to the vector is designed. When constructing the vector, the original vector is double digested from the two endonuclease sites of BamHI and HindIII. Taking the sequence of miR007 as an example, the vector construction idea is shown in Figure 1 Figure 1 a is the HindIII enzyme digestion site; Figure 1 b is the BamHI enzyme digestion site; Figure 1 c is the target miRNA fragment connected to the vector. When designing PCR primers, corresponding enzyme digestion sites are designed at both ends of the target sequence, which is convenient for the subsequent connection of target fragment and vector; Figure 1 d is the target shRNA expressed in cells, in which CTCGAG forms a stem loop structure, and the complementary two miRNA sequences form a double strand, which is further processed into siRNA in cells to play a role).
[0025] Annealing to form double-stranded
[0026] The single-stranded shRNA oligonucleotide designed and synthesized is annealed to form a double strand, which is carried out according to the following system.
[0027] Table 1: PCR system
[0028]
[0029] Annealing conditions: water bath at 98℃ for 15min, natural cooling at room temperature, and storage at 4℃.
[0030] Obtaining linearized vector
[0031] The vector pSilencer-U6-Puro is double-enzymatically cut by two enzymes of BamHI and HindIII to obtain a linearized vector. The enzyme cutting reaction system is as follows.
[0032] Table 2: Enzyme cutting system
[0033]
[0034] 37℃, 4h, 1% Agrose electrophoresis to recover the target vector.
[0035] Ligation
[0036] The linearized vector in 3.3.1.3 and the annealing product (target fragment) obtained in 3.3.1.2 are ligated by T4 ligase, and the ligation system is as follows.
[0037] Table 3: Ligation system
[0038]
[0039] After the above system is mixed uniformly on ice, ligation is carried out at 37℃ for 1.5h.
[0040] Transformation
[0041] The E. coli DH5α competent cells are thawed on ice, 10μL of the enzyme cutting and ligation product is added to 100μL of the competent cells, the tube is shaken several times to mix uniformly, and is placed on ice for 30min. 42℃ heat shock for 90s, ice bath for 3min. About 500μL of LB culture medium without antibiotics is added, and is cultured at 37℃, 200 rpm, and shaken for 30min. After short centrifugation, the supernatant is discarded, and the bacterial body is resuspended with 500μL of fresh LB culture medium, then 100μL of the bacterial solution is taken and uniformly coated on an antibiotic plate, and is inverted and cultured at 37℃ overnight. Five single colonies are picked and subjected to colony PCR verification, and a positive clone is selected to extract a plasmid for sequencing.
[0042] The present application successfully constructs 25 miRNA vector plasmids, which are extracted after plasmid amplification and endotoxin removal, and then are transfected into PANC-1 human pancreatic cancer cells. After 36h of incubation, total RNA of the cells is extracted, reverse transcribed into cDNA, and finally subjected to qRT-PCR experiment. The results show that the expression of KRAS gene can be down-regulated after miR-108 and miR-049 are transfected into PANC-1 cells, and the remaining 23 miRNAs all show up-regulation (see Figure 2 , Figure 2 The upper and lower are the same set of data.
[0043] The nucleotide sequence (24bp) of the miR-108 is shown as SEQ ID No. 1:
[0044] gaaggacgcgaagauggaggcgca;
[0045] The nucleotide sequence (22bp) of the miR-049 is shown as SEQ ID No. 2:
[0046] ucaggacccucaggacccucag.
[0047] The present application performs pharmacodynamic verification on the screened miR-108 and miR-049.
[0048] CCK-8 cell proliferation experiment
[0049] Prepare a standard curve of the absorbance at 450nm with different cell numbers
[0050] Using PANC-1 cell line, after stable passage, cell counting is performed. Cell plating is performed using a 96-well plate, and 6 concentrations are set, which are 3*10 3 , 5*10 3 , 1*10 4 , 4*10 4 , 6*10 4 , and 8*10 4 cells per well. After preparing the cell suspension of each concentration, 100 μL per well is inoculated in the 96-well plate, and 6 wells in parallel for each concentration. After inoculating the cells, place them in a cell culture incubator, and after 4h (in order to allow the cells to adhere), take them out. 10 μL of CCK-8 is needed per well, in order to ensure the uniformity of the addition of CCK-8, first mix the culture medium, and then add it uniformly. First, discard the cell culture medium in the 96-well plate, then wash it with PBS, and then discard it. Then, add 5 mL of DMEM basic culture medium + 500 μL of CCK-8, mix well, and then add 110 μL per well, and then place it in a cell culture incubator for 45 min, and then take it out and measure the absorbance at 450 nm using a microplate reader.
[0051] First, cell plating is performed, and the initial cell plating concentration is about 8000 cells per well. Five 96-well plates are plated in parallel. After plating, place them in a culture incubator overnight to allow the cells to adhere fully. Grouping: group a is transfected with mimics0001, group b is transfected with mimics0002, and group c is transfected with mimics0000.
[0052] Prepare the transfection complex:
[0053] 1) Place the transfection reagent GP at room temperature, and gently shake it before use;
[0054] 2) 2 mL base medium + 200 μL GP, mix, stand for 5 min;
[0055] 3) 350 μL base medium + 35 μL mimics (20 uM), mix, stand for 5 min;
[0056] 4) Take 385 μL of 2) and add to 3), mix, stand for 20 min.
[0057] While standing, change the medium of the cells, first wash with PBS, then add 80 μL base medium. After standing, perform transfection, add the transfection complex to the 96-well plate, 22 μL per well, 6 wells in parallel for each group. After transfection, put into the incubator, and after 6 h, change to serum-containing medium. Then, at 0 h, 24 h, 48 h, 72 h, 96 h after transfection, measure CCK-8 at each time point according to 4.3.1.1.
[0058] The results show that in the CCK-8 cell proliferation experiment, the cells were transfected with mimics 108, mimics 049 and mimics NC respectively. The results show that mimics 108 and mimics 049 have the effect of inhibiting the proliferation of PANC-1 cells (see Figure 3 , Figure 3 a indicates that the absorbance at 450 nm increases with the increase of the number of cells, the linear regression equation is y=0.03539x+0.1183, r 2 =0.9992, indicating that the number of cells has a good linear relationship in the range of 3*10 3 -8*10 4 ; Figure 3 b is the cell proliferation after transfection of PANC-1 cells with mimics0000, mimics0001 and mimics0002.
[0059] Subcutaneous tumor experiment in nude mice
[0060] The principle of the subcutaneous tumor experiment in nude mice is based on the malignant proliferation characteristics of tumor cells. By injecting tumor cell suspension subcutaneously in nude mice, the growth process of tumor in human body can be simulated. First, healthy, disease-free nude mice aged 6 weeks and weighing between 20-25 grams are selected and adapted to the SPF environment for 1 week in advance. First, PANC-1 human pancreatic cancer cells in logarithmic growth phase with a cell density of about 80-90% are prepared, and fresh culture medium is replaced the night before the cells are collected. The cells are trypsinized, complete culture medium is added to terminate digestion, then centrifuged, and then resuspended in PBS to prepare a cell suspension. The cells are resuspended in PBS to a final concentration of 3.2×10^7 cells / mL. The cells are placed on ice for use. Then add high-concentration Matrigel at a volume ratio of 1:1, mix well, and keep the whole process on ice. Finally, each nude mouse is injected subcutaneously in the abdomen, 200 μL per nude mouse, and a total of 60 nude mice are modeled. Observe the tumor formation of nude mice, and when the tumor volume of most nude mice grows to 60-100 mm 3 , start dosing.
[0061] The results show that in the in vivo nude mouse tumor experiment, after 14 days of dosing, the tumor volume of the mimics 108 group, the mimics 049 group and the gemcitabine group is significantly smaller than that of the mimics NC group and the normal saline group (see Figure 4 a).
[0062] Inhibition of pancreatic cancer tumor by mimics 0001 and mimics 0002
[0063] After the nude mice are tumor-formed, they are first grouped. Select the nude mice with uniform tumor formation for random grouping and dosing. Here, it is divided into 5 groups, namely mimics 0001, mimics 0002, mimics 0000, gemcitabine group and normal saline group. Each group has 6 nude mice. The mimics 0001, mimics 0002 and mimics 0000 groups are injected intratumorally, 1 OD per nude mouse per injection, configured into 50 μL, and injected every 3 days. The gemcitabine group is injected intraperitoneally, dosed at 50 mg / kg, and dosed twice a week. The normal saline group of nude mice is given normal saline according to the dosing method and frequency of mimics, for a total of two weeks. Body weight and tumor volume data of nude mice are collected every day within two weeks. After two weeks, the nude mice are dissected, and the organs are weighed. The subsequent statistics of organ index are performed, and finally all the nude mice are sacrificed. The formula for calculating the tumor volume is (a*b 2 ) / 2, where a represents the length of the tumor and b represents the width of the tumor. The formula for calculating the organ index is organ weight / corresponding nude mouse body weight. Finally, the tumor inhibition rate is calculated, and the formula is (average tumor volume of the normal saline group on the 14th day - tumor volume of the experimental group on the 14th day) / average tumor volume of the normal saline group on the 14th day.
[0064] The results showed that the tumor inhibition rate of mimics NC group was 29.94%, while the tumor inhibition rates of mimics 108 group, mimics 049 group and gemcitabine group were 87.90%, 81.69% and 80.99%, respectively, and there were statistical differences between mimics NC group and mimics 108 group, mimics 049 group and gemcitabine group (P<0.01). It was indicated that mimics 108 and mimics 049 played a significant role in inhibiting pancreatic cancer tumor (see Figure 4 b}.
[0065] The above description of disclosed embodiments enables one skilled in the art to make or use the application. Numerous modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Therefore, the application is not to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. miRNA, characterized by, The miRNA is miR-108 derived from Ganoderma lucidum; The nucleotide sequence of miR-108 is shown in SEQ ID No.
1.
2. A recombinant vector containing the encoding gene of the miRNA of claim 1.
3. The use of the miRNA of claim 1 or the recombinant vector of claim 2 in the preparation of a drug for treating human pancreatic cancer.
Citation Information
Patent Citations
Regulation of oncogenes by microRNAs
US20060189557A1