Circular RNA marker for diagnosing coronary atherosclerotic heart disease, kit and application of circular RNA marker

Abstract

The invention belongs to the technical field of biology, and relates to a circular RNA (Ribonucleic Acid) marker for diagnosing coronary atherosclerotic heart disease, a kit and application of the circular RNA marker. The expression level of the circular RNA hsacirc0003141 disclosed by the invention is obviously up-regulated in blood of a research object of the coronary atherosclerotic heart disease, which indicates that the circular RNA hsacirc0003141 has the potential of becoming a biomarker of the coronary atherosclerotic heart disease.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a circular RNA marker, a kit and their applications for diagnosing coronary atherosclerotic heart disease. Background Art

[0002] Coronary heart disease, namely coronary atherosclerotic heart disease, is one of the cardiovascular diseases that pose a major threat to human health globally. This disease has been proven to be related to genetic susceptibility, and its development involves the interaction of multiple genes. Research shows that gene expression, transcriptional regulation, and chromatin structure stability are all affected by epigenetic modifications, which may affect the occurrence and development of diseases by altering gene activity.

[0003] The main pathological basis of coronary heart disease is atherosclerosis, which is a complex chronic inflammatory disease involving multiple cell types and molecular mechanisms. The pathological process of AS begins with vascular endothelial injury, followed by a series of reactions, including the release of inflammatory mediators, the recruitment of immune cells, lipid deposition, and the proliferation and migration of smooth muscle cells. These events together lead to the formation of plaques in the arterial wall, which may ultimately result in vascular stenosis or occlusion.

[0004] Remarkable progress has been made in the research on atherosclerosis, which not only deepens our understanding of this pathological process but also promotes the progress of diagnostic techniques and treatment methods for cardiovascular diseases. In the early stage of atherosclerosis, lipoproteins invade the arterial wall, inducing the adhesion of monocytes in the blood. Monocytes migrate into the intima and differentiate into macrophages, which phagocytize cholesterol to form foam cells, and then fuse and accumulate to form plaques. In the late stage of atherosclerosis, cells continuously release inflammatory mediators, leading to the necrosis of foam cells, increasing plaque instability, and even rupture and thrombosis, causing a series of acute cardiovascular events. Therefore, macrophage-derived foam cells are the key targets in the occurrence and development of atherosclerosis. However, there are still many unknown areas regarding foam cells and their specific mechanisms in the formation of advanced atherosclerotic lesions.

[0005] In the diagnosis of coronary atherosclerotic heart disease, common methods include but are not limited to: electrocardiogram (ECG): used to detect the electrical activity of the heart and can detect abnormalities caused by myocardial ischemia. Ambulatory electrocardiogram (Holter monitoring): records the electrocardiogram activity for a long time and is suitable for capturing intermittent symptoms. Coronary computed tomography angiography (CCTA): non-invasively evaluates the coronary artery anatomy and identifies plaques and stenoses. Coronary angiography: regarded as the "gold standard" for diagnosing coronary heart disease, it can provide the most direct vascular image, but due to its invasiveness and potential risks, it is not used as a routine screening tool. Summary of the Invention

[0006] The object of the present invention is to address the above problems existing in the prior art, and propose a circular RNA marker for diagnosing coronary atherosclerotic heart disease, to detect the expression level of circular RNA hsa_circ_0003141 in human blood so as to achieve early diagnosis of coronary atherosclerotic heart disease at the molecular level.

[0007] The object of the present invention can be achieved by the following technical solutions:

[0008] A circular RNA marker for diagnosing coronary atherosclerotic heart disease, wherein the circular RNA marker is RNA hsa_circ_0003141.

[0009] Application of a detection reagent for the expression level of RNA hsa_circ_0003141 in the preparation of an early diagnosis product for coronary atherosclerotic heart disease.

[0010] In the above application, the nucleotide sequence of RNA hsa_circ_0003141 is as shown in SEQ ID No. 1.

[0011] In the above application, the detection reagent for the expression level of the said RNA hsa_circ_0003141 includes primers that specifically recognize RNA hsa_circ_0003141.

[0012] In the above application, the primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0013] The present invention also provides an early diagnosis product for coronary atherosclerotic heart disease, including primers that specifically recognize RNA hsa_circ_0003141.

[0014] In the above early diagnosis product for coronary atherosclerotic heart disease, the primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0015] In the above early diagnosis product for coronary atherosclerotic heart disease, it also includes primers that specifically recognize the internal reference GAPDH.

[0016] In the above-mentioned early diagnosis product for coronary atherosclerotic heart disease, the specific recognition internal reference GAPDH primers include the upstream primer shown in SEQ ID No. 4 and the downstream primer shown in SEQ ID No. 5.

[0017] In the above-mentioned early diagnosis product for coronary atherosclerotic heart disease, it is a kit or a gene chip.

[0018] In the above-mentioned early diagnosis product for coronary atherosclerotic heart disease, it also includes pharmaceutically acceptable excipients.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The present invention discovers that the expression level of circular RNA hsa_circ_0003141 in the blood of patients with coronary atherosclerotic heart disease (CAD) is significantly up-regulated, indicating that it has great potential as a biomarker for CAD. This provides a new and possibly more accurate method for the early detection of CAD, which helps with timely intervention and treatment.

[0021] 2. By developing a gene detection product based on circular RNA hsa_circ_0003141, the present invention realizes the early diagnosis of CAD at the molecular level. This high-precision diagnostic tool can help doctors identify potential risk patients at the initial stage of the disease, thus providing more effective personalized medical treatment plans.

[0022] 3. The present invention not only verifies the expression difference of hsa_circ_0003141 in the THP-1 monocyte-macrophage-derived foam cell model, but also lays a solid foundation for the subsequent development of inhibitors targeting this circular RNA and the screening of targeted drugs for CAD. These studies are expected to drive new breakthroughs in the field of CAD treatment.

[0023] 4. Due to the unique properties of circular RNA hsa_circ_0003141 and its role in CAD, the present invention provides a new perspective for further exploring its functional mechanism and how to regulate this molecule to improve CAD treatment strategies. This in-depth understanding can promote the development of new treatment methods and improve the survival rate and quality of life of patients.

[0024] 5. The present invention uses circular RNA hsa_circ_0003141 as a biomarker for regular monitoring, which can not only help evaluate the progression of the disease or the treatment response, but also be used to adjust individualized treatment plans. This method improves the efficiency of disease management, enables a more reasonable allocation of medical resources, and at the same time reduces the cost of long-term treatment. Description of the Drawings

[0025] Figure 1 This is the structure and location region of circular RNA hsa_circ_0003141 in Example 1 of the present invention.

[0026] Figure 2 This is the expression analysis of circular RNA hsa_circ_0003141 in Example 1 of the present invention.

[0027] Figure 3 This is the expression analysis of circular RNA hsa_circ_0003141 in the THP-1 cell model of Example 1 of the present invention.

[0028] Figure 4 This is the process of establishing the cell model in Example 1 of the present invention; THP-1 cells were selected, and THP-1 cells were differentiated into macrophages by using PMA (a), macrophages were induced into foam cells by using ox-LDL, and the foam cells were stained with Oil Red O (b).

[0029] Figure 5 This is the ROC curve of circular RNA hsa_circ_0003141 in Example 1 of the present invention.

[0030] Figure 6 This is the heat map of circRNAs with differential expression in coronary heart disease in Example 1 of the present invention. Detailed implementation manners

[0031] The following are specific examples of the present invention, which further describe the technical solutions of the present invention, but the present invention is not limited to these examples. The following will cooperate with the drawings and examples to detail the implementation manners of the present application, so as to fully understand how the present application uses technical means to solve technical problems and achieve the implementation process of technical effects and implement accordingly.

[0032] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0033] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0034] The present invention relates to a specific circular RNA, namely hsa_circ_0003141, and its specific recognition primer pair and primer sequence of internal reference gene GAPDH.

[0035] The sequences and primer compositions involved in the present invention:

[0036] Circular RNA hsa_circ_0003141 shown in SEQ ID NO.1: GATTTGGACGTGGCAGAGGGAGAGGGGCAGGAAGGTTCTCAACCCAAGGCATGGGGACATTTAATCCTGCAGACTATTCAGATTCTACATCTACAGATGTGTGTGGGACAAAGCTAGTAGTTTGGGAAGCTGCTCAGAATGGTGCAGATGAGGGAACTGAACTGGCATCAAATACTCACAACATAGCTCAGGATCTGTCAAACAAAAGTTCTTATGGACTCAAAGGGGCTTGGAAGAATTCTGTGGAAGAGTGGACAACAGAAGACTGGACTGAAGATCTTTCTGAAACAAAGGTCTTCACTGCCTCATCTGCTCCAGCAGAGAATCACATCTTACCTGGGCAAAGCATTGATCTGGTAGCCTTGCTCCAGAAGCCTGTTCCTCACAGTCAAGCCTCAGAAGCCAACTCCTTTGAAACTTCCCAACAGCAGGGCTTTGGCCAAGCCCTTGTCTTCACAAATTCGCAACACAACAATCAGATGGCACCAGGGACTGGCAGCTCCACTGCCGTCAACTCCTGTTCTCCTCAGAGCCTG;

[0037] In order to effectively detect and quantitatively analyze the presence and expression level of hsa_circ_0003141, the primer pair specifically recognizing RNA hsa_circ_0003141 provided by the present invention includes the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3: SEQ ID No.2: CCAAGCCCTTGTCTTCACAAA; SEQ ID No.3: GTCCAAATCCAGGCTCTGAGG;

[0038] These two short sequences are designed to be able to pair with the complementary sequences on hsa_circ_0003141, thereby allowing the amplification and detection of this circular RNA through molecular biology techniques such as PCR (Polymerase Chain Reaction). The design of the primers takes into account factors such as specificity, efficiency, and the length of the amplification product to ensure the best experimental results.

[0039] When performing gene expression analysis, a stable reference gene is usually required to normalize the data in order to eliminate errors caused by processing procedures or individual differences between samples. The upstream primer and downstream primer of the reference GAPDH provided by the present invention are shown as SEQ ID No. 4 for the upstream primer and SEQ ID No. 5 for the downstream primer: SEQ ID No. 4: TGTTGCCATCAATGACCCCTT; SEQ ID No. 5: CTCCAGGACGTACTCAGCG.

[0040] Using this pair of primers, GAPDH mRNA in the sample can be amplified, and then used to correct the relative expression level of the target RNA.

[0041] The following examples reveal that the expression level of circular RNA hsa_circ_0003141 is significantly up-regulated in the blood samples of patients with coronary atherosclerotic heart disease. In the blood samples of CAD patients, the expression level of hsa_circ_0003141 is significantly higher than that of the healthy control group. This differential expression suggests that hsa_circ_0003141 may be involved in the occurrence and development of CAD, or at least a reactive change under disease conditions. Given the specific up-regulation pattern of hsa_circ_0003141 in CAD patients, it has great potential to become a novel biomarker. Example 1:

[0042] Patients who underwent coronary angiography in the Department of Cardiology of the First Affiliated Hospital of Ningbo University from July 2022 to September 2022 were selected as the research subjects. The specific inclusion and exclusion criteria are as follows: The healthy control group was strictly screened to ensure no history of any vascular stenosis or cardiovascular disease; while the coronary heart disease group was diagnosed with CAD based on their clinical manifestations and coronary angiography results. Patients with heart failure, cardiomyopathy, cancer, acute myocardial injury, and liver function injury were excluded to eliminate possible interference of these factors on the research results. Using gender and age (±3 years) as matching conditions, 5 cases of coronary heart disease patients and 5 controls were selected, and 2 ml of their blood samples were placed in ethylene diaminetetraacetic acid (EDTA) vacuum anticoagulation tubes. The samples were transported to Shanghai Kangcheng Bioengineering Co., Ltd. on dry ice and entrusted to perform circRNA chip experiments. The chip used was the Humancircular RNA Array V2.0 of Arraystar company, with a specification of 8×15K. The circRNA chip expression profile was analyzed, and a heat map was drawn to visualize the results of the differential expression analysis.Figure 6 As shown (N: represents the healthy control group, G represents the coronary heart disease group). hsa_circRNA_104762 was selected for subsequent analysis. The location of this circRNA on the chromosome is: chr9:33953282-33973235-. According to its location on the chromosome, circPrimer software was used for analysis. On this software, hsa_circRNA_104762 has its exclusive name, which is: hsa_circ_0003141.

[0043] S1. Determination of research subjects:

[0044] 1. From September 2022 to December 2023, the Department of Cardiology of the First Affiliated Hospital of Ningbo University conducted an important study on coronary atherosclerotic heart disease (CAD). This study used age and gender as matching variables and carefully selected 182 inpatients to participate. These participants were evenly divided into the healthy control group (n = 91) and the coronary heart disease group (n = 91). All research subjects underwent coronary angiography, which is the gold standard for evaluating the degree of coronary artery stenosis. Before inclusion in the study, patients with heart failure, cardiomyopathy, cancer, acute myocardial injury, and liver function injury were excluded to eliminate the possible interference of these factors on the research results. This not only ensured the purity of the data but also helped improve the reliability and scientificity of the research conclusions. Each participant fully understood the purpose, process, and potential risks of the study and provided a written informed consent form, which reflects the ethical principles in medical research and respects the patient's right to autonomous choice. To ensure the accuracy and consistency of the diagnostic results, each angiography image was independently reviewed and judged by two experienced cardiologists. The healthy control group was strictly screened to ensure no history of any vascular stenosis or cardiovascular disease; while the coronary heart disease group was diagnosed with CAD based on their clinical manifestations and coronary angiography results.

[0045] 2. Collection of blood samples Professional-trained technicians were responsible for collecting 5 ml of venous blood from each participant. The blood samples were collected using vacuum blood collection tubes containing ethylenediaminetetraacetic acid (EDTA) as an anticoagulant. Subsequently, these samples were quickly transferred to an ultra-low temperature freezer at -80°C for storage. This treatment method can effectively prevent the degradation of biological macromolecules such as RNA and proteins, laying a foundation for subsequent in-depth analysis.

[0046] S2. Extraction of total blood RNA:

[0047] The BioTeke Total Blood RNA Rapid Extraction Kit (spin column type, BioTeke, Beijing) was used to extract total RNA from the collected blood samples. The specific operation steps are as follows:

[0048] (1) Take out the blood sample from the ultra-low temperature freezer and place it on an ice box to thaw slowly.

[0049] (2) After the sample is completely melted, invert it 3 - 5 times to mix well, and pipette 250 μl of the sample into a 1.5 ml centrifuge tube (nuclease-free).

[0050] (3) Pipette 750 μl of lysis buffer into the centrifuge tube and pipette up and down 3 - 5 times to fully lyse the blood cells in the sample.

[0051] (4) Vortex the above mixture vigorously for at least 1 min to ensure there is no precipitate at the bottom of the tube, and incubate at room temperature for 5 min.

[0052] (5) Pipette 150 μl of chloroform into the mixture, tighten the centrifuge tube cap, shake vigorously for 15 s, and incubate at room temperature for 3 min.

[0053] (6) Place the incubated mixture in a centrifuge and centrifuge at 4°C and 12000 rpm for 10 min. After centrifugation, the mixture is divided into a colorless aqueous phase layer, an intermediate layer, and an organic phase layer from top to bottom. Pipette the colorless aqueous phase layer (about 600 μl) containing RNA into a new centrifuge tube, taking care not to aspirate the intermediate layer.

[0054] (7) Add 600 μl of 70% ethanol solution to the above aqueous phase, invert to mix well (precipitation may occur), and transfer both the mixed solution and the precipitate to the adsorption column in the collection tube.

[0055] (8) Place the collection tube in a low-temperature centrifuge, centrifuge at 10000 rpm for 45 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0056] (9) Add 500 μl of wash buffer, centrifuge at 12000 rpm for 1 min, discard the waste liquid, put the adsorption column back into the collection tube, and continue to centrifuge for 2 min to remove as much wash buffer as possible.

[0057] (10) Add 500 μl of deproteinization solution, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 45 s, discard the waste liquid, and put the adsorption column back into the collection tube.

[0058] (11) Add 500 μl of wash buffer, centrifuge at 12000 rpm for 1 min, discard the waste liquid, put the adsorption column back into the collection tube.

[0059] (12) Repeat step (11) and continue to centrifuge for 2 min to remove as much wash buffer as possible.

[0060] (13) Discard the collection tube, place the adsorption column into a new centrifuge tube, add 30 μl of enzyme-free water (previously heated to 65 °C in a water bath) to the white film in the middle of the adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min.

[0061] (14) Aspirate the solution obtained in the centrifuge tube into the adsorption column again, and centrifuge at 12,000 rpm for 1 min. Discard the adsorption column, retain the solution (total RNA) in the centrifuge tube, and place it on ice for standby.

[0062] S3. Reverse transcription of total RNA into cDNA:

[0063] Use the Promega GoScriptTM Reverse Transcription System kit (Promega, USA) to reverse transcribe the extracted total RNA into cDNA. The specific operation steps are as follows:

[0064] (1) Prepare the RT-Mix mixture according to the following table (12 μl per portion, and multiple portions can be prepared proportionally), shake well and then centrifuge.

[0065] Table 1: RT-Mix mixture

[0066] (2) Add the total RNA at a dose of 400 ng / concentration of total RNA to solution (1), and add (8x) μl of enzyme-free water. The total volume of the entire reverse transcription system is 20 μl to form a solution.

[0067] (3) Place the reaction system described in (2) into an Eppendorf gradient PCR instrument for reverse transcription.

[0068] The reaction program is: 25 °C, 5 min; 42 °C, 60 min; 70 °C, 15 min; cool to 4 °C.

[0069] S4. Determination of the expression level of circular RNA by PCR technology:

[0070] Use the Promega GoTaq Master Mix fluorescence quantitative kit (Promega, USA) to prepare the reaction system for PCR detection. The specific operation steps are as follows:

[0071] (1) Prepare the PCR mixture according to the following table, shake well, and centrifuge after shaking:

[0072] Table 2: PCR mixture

[0073] (2)Add 16 μl of the mixed solution to each well of the eight-strip tube or 96-well plate, and then add 4 μl of cDNA. After tightly attaching the sealing film, centrifuge for several minutes.

[0074] (3)Perform the amplification reaction using a Roche Light Cycler 480 PCR instrument. The reaction program is as follows: pre-denaturation at 95 °C for 2 min; 45 cycles of amplification, where denaturation is at 95 °C for 5 s; annealing at 58 °C for 30 s, extension at 72 °C for 30 s; and then analyze the melting curve.

[0075] S5. Establishment of the cell model:

[0076] (1)Aspirate the THP-1 cell suspension into a 15-ml centrifuge tube, centrifuge at 1000 rpm for 3 min, and discard the supernatant.

[0077] (2)Add 2 ml of RPMI 1640 medium (Gibco, USA) containing 5% fetal bovine serum (VivaCell, Uruguay), gently pipette to resuspend the cells. After counting, transfer the cells to a 6-well plate at a density of 1 million cells per well, and make up the medium in each well to 2 ml.

[0078] (3)Add an appropriate amount of PMA (Sigma, USA) to make its final concentration 100 ng / ml, and culture for 24 h to induce the differentiation of mononuclear THP-1 cells into macrophages.

[0079] (4)Replace the medium, add an appropriate amount of ox-LDL (Yiyuan Biotech, Guangzhou) to make its final concentration 100 μg / mL, and culture for 72 h to stimulate the formation of foam cells;

[0080] (5)Use an Oil Red O staining kit (Solarbio, Beijing) to stain the foam cells to verify the cell model. The staining steps include: 1. Mix Oil Red O staining solution A and B in a ratio of 3:2 to form an Oil Red O staining solution. Let it stand at room temperature for 10 min, filter it through a cell sieve, and place it in a 37 °C water bath for standby; 2. Take the cells out of the incubator, discard the medium, wash twice with PBS, add 2 ml of Oil Red O fixing solution, and let it stand at room temperature for 30 min; 3. Discard the fixing solution, wash twice with distilled water, add 2 ml of 60% isopropanol, and let it stand at room temperature for 10 min; 4. Discard the 60% isopropanol, add 1 ml of Oil Red O staining solution, shake the plate to spread evenly, and incubate at 37 °C for 20 min; 5. Discard the staining solution, wash with 60% isopropanol for 30 s, wash several times with distilled water until there is no excess dye, add distilled water to cover the cells, and observe under a microscope asFigure 4 The above shows that the cell model was successfully established.

[0081] S6. Extraction of cell RNA:

[0082] The TransZol Up Plus RNA Kit (TransGen, Beijing) was used to extract cell RNA, and the operation steps are as follows:

[0083] (1) Take out the cells from the incubator, discard the culture medium, wash once with PBS, add 1 ml of TransZol Up, evenly distribute it on the cell surface, incubate at room temperature for a moment, and then pipette to blow the cells to make them detached.

[0084] (2) Pipette 0.2 ml of RNA Extraction Agent into a centrifuge tube, and pipette until there is no obvious precipitate in the tube, then vortex vigorously for 5 min.

[0085] (3) Place the above mixture in a low-temperature centrifuge and centrifuge at 4°C and 12,000 rpm for 15 min. After centrifugation, the mixture is divided into a colorless aqueous phase layer, an intermediate layer, and a pink organic phase layer from top to bottom. Pipette the aqueous phase layer containing RNA into a new centrifuge tube.

[0086] (4) Add an equal volume of absolute ethanol to the aqueous phase in step (3) containing RNA, gently invert and mix well, and transfer the mixed solution to a centrifugal column.

[0087] (5) Place the centrifugal column in a low-temperature centrifuge and centrifuge at 12,000 rpm for 30 s, then discard the effluent.

[0088] (6) Add 500 μl of Clean Buffer, centrifuge at 12,000 rpm for 30 s, and discard the effluent.

[0089] (7) Add 500 μl of Wash Buffer, centrifuge at 12,000 rpm for 30 s, and discard the effluent.

[0090] (8) Place the centrifugal column in a new centrifuge tube, add 30 μl of enzyme-free water to the middle white film, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min. A solution containing RNA is obtained in the centrifuge tube.

[0091] S7. Reverse transcription of cell RNA and determination of circular RNA expression level are the same as steps S3 and S4 above.

[0092] S8. Data analysis:

[0093] This study used 2-△△CT Indicates the relative expression level of circRNA. -△CT = mean CT value of the internal reference gene (GAPDH) - mean CT value of the target gene (hsa_circ_0003141), 2 -△△CT =2 -△CT冠心病组均值 / 2 -△CT对照组均值 , this result indicates how many times the relative expression level of circRNA in this sample is that of the control group mean.

[0094] Figure 1 There were differences in the expression level of the circular RNA hsa_circRNA_0003141 shown between the control group and the coronary heart disease group in human blood and the in vitro constructed cell model (P<0.05, statistically significant).

[0095] Figure 2 This is the expression analysis of the circular RNA hsa_circ_0003141 in the present invention. It can be seen from the figure that there were differences in the expression level of hsa_circ_0003141 between the control group and the coronary heart disease group, P<0.05, statistically significant. Note: When P<0.05, it indicates statistical significance, the same below.

[0096] Figure 3 This is the expression analysis of the circular RNA hsa_circ_0003141 in the THP-1 cell model of the present invention. It can be seen from the figure that there were differences in the expression level of hsa_circ_0003141 between the macrophage group and the foam cell group formed after being treated with ox-LDL for 72 hours, P<0.05, statistically significant.

[0097] From Figure 5 it can be seen that 60 blood samples of coronary heart disease patients and 60 healthy control patients were recollected to verify the diagnostic effect of the circular RNA hsa_circ_0003141. Taking the expression level of hsa_circ_0003141 as the detection variable to judge the diagnostic effect, ROC was plotted using SPSS software and the results were analyzed. The ROC curve results showed that: AUC = 0.752 (0.670 - 0.835), the sensitivity was 68%, the specificity was 74%, the P value < 0.0001, showing significant diagnostic value for coronary heart disease, indicating that it showed good performance in distinguishing coronary heart disease patients from healthy individuals, proving the great potential of hsa_circ_0003141 as a potential biomarker, which can be used for assisting early diagnosis, disease monitoring and formulation of personalized medical plans.

[0098] Table 3: Demographics and clinical data of the subjects

[0099] From the above results, it can be seen that the expression level of circular RNA hsa_circ_0003141 in the present invention is significantly up-regulated in the blood of subjects with coronary atherosclerotic heart disease, indicating that circular RNA hsa_circ_0003141 has the potential to become a biomarker for coronary atherosclerotic heart disease. The present invention detects the expression level of circular RNA hsa_circ_0003141 in human blood by preparing a gene detection product for circular RNA hsa_circ_0003141, so as to achieve early diagnosis of coronary atherosclerotic heart disease at the molecular level. In addition, the content provided by the present invention also lays a foundation for the subsequent development of inhibitors of circular RNA hsa_circ_0003141 and the screening of targeted drugs for coronary atherosclerotic heart disease, and verifies the expression differences of RNA in the THP-1 monocyte-macrophage-derived foam cell model.

[0100] In the embodiments herein, the points not exhausted in the technical scope claimed by the present invention and the new technical solutions formed by the equivalent replacement of single or multiple technical features in the technical solutions of the embodiments are also within the scope claimed by the present invention; at the same time, in all the exemplified or unexemplified embodiments of the present invention, the various parameters in the same embodiment only represent an example (i.e., a feasible solution) of its technical solution, and there is no strict cooperation and limitation relationship between the various parameters. Among them, the parameters can be replaced with each other without violating the axiom and the requirements of the present invention, unless otherwise specifically stated.

[0101] The technical means disclosed in the present invention is not limited to the technical means disclosed in the above technical means, but also includes the technical solutions formed by any combination of the above technical features. The above is the specific implementation manner of the present invention. It should be noted that for those of ordinary skill in the art in this technical field, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements are also regarded as the protection scope of the present invention.

[0102] The specific embodiments described herein are only illustrative of the spirit of the present invention. Those skilled in the art to which the present invention pertains can make various modifications or supplements to the described specific embodiments or use similar methods for substitution, but will not deviate from the spirit of the present invention or exceed the scope defined by the appended claims.

Claims

1. A circular RNA marker for diagnosing coronary atherosclerotic heart disease, characterized in that, The circular RNA marker is RNA hsa_circ_0003141.

2. Use of a reagent for detecting the expression level of RNA hsa_circ_0003141 in the preparation of an early diagnosis product for coronary atherosclerotic heart disease.

3. The application according to claim 2, wherein The reagent for detecting the expression level of the said RNA hsa_circ_0003141 includes primers that specifically recognize RNA hsa_circ_0003141.

4. The application according to claim 3, wherein The primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

5. An early diagnosis product for coronary atherosclerotic heart disease, characterized in that, Includes primers that specifically recognize RNA hsa_circ_0003141.

6. The early diagnosis product for coronary atherosclerotic heart disease according to claim 5, wherein, The primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

7. The early diagnosis product for coronary atherosclerotic heart disease according to claim 5, wherein Also includes primers that specifically recognize the internal reference GAPDH.

8. The early diagnosis product for coronary atherosclerotic heart disease according to claim 7, characterized in that, The primers that specifically recognize the internal reference GAPDH include the upstream primer shown in SEQ ID No. 4 and the downstream primer shown in SEQ ID No.

5.

9. The early diagnosis product for coronary atherosclerotic heart disease according to claim 5, wherein, It is a kit or a gene chip.

10. The early diagnosis product for coronary atherosclerotic heart disease according to claim 5, wherein Also includes pharmaceutically acceptable excipients.

Images