Primer-probe combination for detecting Klebsiella pneumoniae

Abstract

This invention provides a primer-probe combination for detecting Klebsiella acidogenic and / or Klebsiella gasogenic, comprising a combination of forward primers, reverse primers, and probes. A kit containing this primer-probe combination and its uses are also provided.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to primer-probe combinations for detecting Klebsiella pneumoniae. Background Technology

[0002] Klebsiella oxytoca is a Gram-negative coccus. It is commonly found in the intestines and respiratory tract of healthy individuals. Klebsiella oxytoca is an opportunistic pathogen, and infection symptoms are more likely to occur when the body's immune system is weakened, after surgery, or during various medical procedures. This bacterium is a common pathogen causing community-acquired and hospital-acquired pneumonia. When the body's resistance is lowered, healthy carriers can develop local or systemic infections. In addition, various exogenous infections can occur, primarily in hospitals, where the bacteria can spread through contact between patients, between staff and patients, and through various medical devices and equipment.

[0003] Klebsiella aerogenes is a member of the normal intestinal flora and an important opportunistic pathogen that can cause diseases such as urinary tract infections, respiratory tract infections, wound infections, and sepsis.

[0004] Establishing sensitive, specific, and rapid detection technologies to monitor Klebsiella pneumoniae and its precursors can play a positive guiding role in the early prevention of diseases.

[0005] The biochemical reactions of Klebsiella pneumoniae, Klebsiella pneumoniae, and Klebsiella acidogenic bacteria are quite similar. The difference in biochemical identification between Klebsiella pneumoniae and Klebsiella acidogenic bacteria is that Klebsiella pneumoniae is indole-negative. The indole test typically requires inoculating the test bacteria into a culture medium and incubating at 35°C for 1-2 days, a relatively time-consuming process.

[0006] Because *Klebsiella acidogenae* and *Klebsiella pneumoniae* have different serotypes, traditional methods for detecting bacterial morphology and physiological and biochemical characteristics are insufficient for disease prevention and control. Molecular detection methods can significantly reduce detection time, facilitating faster clinical diagnosis. Molecular biology techniques have begun to be applied in pathogen detection. With the development of genomics and proteomics, molecular biology techniques for detecting *Klebsiella acidogenae* and *Klebsiella pneumoniae* in clinical laboratories are increasingly being used, such as polymerase chain reaction (PCR), mass spectrometry, gene chips, and high-throughput sequencing.

[0007] The hydrolysis probe method in real-time quantitative PCR (RT-qPCR) is a polymerase chain reaction. Whether the hydrolysis probe method can achieve direct detection of Klebsiella acidogenic and Klebsiella pneumoniae pathogens in samples depends on designing a set of primers and probes with high sensitivity and specificity.

[0008] In addition, PCR detection requires the extraction of pathogen nucleic acid, selection of internal standard genes, design and synthesis of gene primers. The sample pretreatment is complex, the process control is strict, and the laboratory is highly dependent, which limits its practical application. Summary of the Invention

[0009] In view of the lack of detection methods for Klebsiella acidogenic and Klebsiella pneumoniae pathogens with improved sensitivity and detection efficiency in the art, the inventors provide a primer-probe combination for real-time quantitative PCR amplification. Compared with existing products, it has a lower Ct value, exhibiting higher efficiency and higher sensitivity.

[0010] In one aspect, the present invention provides a composition comprising a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella acidogenic bacteria, wherein the forward primer and the reverse primer are the forward primer shown in SEQ ID NO:1 and the reverse primer shown in SEQ ID NO:2.

[0011] In some implementations, the probe is the one shown in SEQ ID NO:3.

[0012] In some preferred embodiments, the combination of the forward primer, the reverse primer, and the probe is the forward primer shown in SEQ ID NO:1, the reverse primer shown in SEQ ID NO:2, and the probe shown in SEQ ID NO:3.

[0013] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quencher group. Preferably, the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0014] In some embodiments, the probe shown in SEQ ID NO:3 is labeled 6-FAM at the 5' end and BHQ1 at the 3' end.

[0015] In another aspect, the present invention provides a composition comprising a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella pneumoniae, wherein the forward primer and the reverse primer are the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5.

[0016] In some implementations, the probe is the one shown in SEQ ID NO:6.

[0017] In some preferred embodiments, the combination of the forward primer, the reverse primer, and the probe is the forward primer shown in SEQ ID NO:4, the reverse primer shown in SEQ ID NO:5, and the probe shown in SEQ ID NO:6.

[0018] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quencher group. Preferably, the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0019] In some implementations, SEQ ID NO:6 is labeled ROX at the 5' end and BHQ2 at the 3' end.

[0020] In another aspect, the present invention provides a composition comprising: a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella acidogenicus; and / or a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella gas-producingus.

[0021] In some implementations, the forward and reverse primers for detecting Klebsiella acidogenic bacteria are the forward primer shown in SEQ ID NO:1 and the reverse primer shown in SEQ ID NO:2.

[0022] In some implementations, the forward primer and reverse primer for detecting Klebsiella pneumoniae are the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5.

[0023] In some implementations, the probe for detecting Klebsiella acidogenic bacteria is the probe shown in SEQ ID NO:3.

[0024] In some implementations, the combination of the forward primer, reverse primer, and probe for detecting Klebsiella acidogenic bacteria is the forward primer shown in SEQ ID NO:1, the reverse primer shown in SEQ ID NO:2, and the probe shown in SEQ ID NO:3.

[0025] In some implementations, the probe for detecting Klebsiella pneumoniae is the probe shown in SEQ ID NO:6.

[0026] In some implementations, the combination of forward primer, reverse primer, and probe for detecting Klebsiella pneumoniae is the forward primer shown in SEQ ID NO:4, the reverse primer shown in SEQ ID NO:15, and the probe shown in SEQ ID NO:6.

[0027] In some implementations, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

[0028] In some embodiments, the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0029] In some embodiments, the probe shown in SEQ ID NO:3 is labeled 6-FAM at the 5' end and BHQ1 at the 3' end.

[0030] In some implementations, the probe shown in SEQ ID NO:6 is labeled ROX at the 5' end and BHQ2 at the 3' end.

[0031] In another aspect, the present invention provides a kit comprising the compositions disclosed in any aspect of the present invention.

[0032] In another aspect, the present invention provides the use of the compositions disclosed herein in the preparation of a kit for the detection of Klebsiella acidogenic and / or Klebsiella aerogenes.

[0033] In another aspect, the present invention provides the use of the compositions disclosed herein in the preparation of kits for the diagnosis and prevention of infections or diseases associated with Klebsiella pneumoniae and / or Klebsiella aerogenes. In some embodiments, the disease is selected from pneumonia, antibiotic-associated hemorrhagic colitis, sepsis, and meningitis.

[0034] In another aspect, the present invention provides a method for detecting acid-producing Klebsiella and / or gas-producing Klebsiella in a sample, comprising:

[0035] The sample is amplified using the combination of forward primers, reverse primers, and probes disclosed in this invention; and the presence or absence of Klebsiella acidogenic and / or Klebsiella gasogenic in the sample is determined based on the amplification results.

[0036] In some implementations, the method is used for non-diagnostic purposes.

[0037] In some embodiments, the sample is a human or animal sample, more preferably a human respiratory sample. In one specific embodiment, the sample is a human lung sample.

[0038] In some implementations, amplification is performed via real-time quantitative PCR. Attached Figure Description

[0039] Figure 1 The qPCR amplification curves of simulated human bronchoalveolar lavage fluid samples positive for Klebsiella pneumoniae and negative for Klebsiella aerogenes-1 are shown.

[0040] Figure 2 The qPCR amplification curves of simulated human bronchoalveolar lavage fluid samples positive for Klebsiella oxytoca-3 and Klebsiella aerogenes-1 are shown. Detailed Implementation

[0041] Unless otherwise specifically indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may be used in the practice of this disclosure. All publications cited herein are incorporated herein by reference in their entirety.

[0042] This paper provides a rapid, accurate, reliable, specific, and sensitive method for diagnosing Gram-negative coccal infections (such as Klebsiella oxygenae and Klebsiella gasgenes) through nucleic acid amplification. This article describes a real-time PCR assay for the quantitative and / or qualitative detection of Klebsiella oxygenae and Klebsiella gasgene nucleic acids (including DNA and / or RNA) in non-biological or biological samples. Primers and probes for the detection and / or quantification of Klebsiella oxygenae and Klebsiella gasgenes, as well as products or kits containing such primers and probes, are provided. Compared with other methods, real-time PCR offers improved specificity and sensitivity for the detection of Klebsiella oxygenae and Klebsiella gasgenes, and real-time PCR features improved characteristics, including sample containment and real-time detection and quantification of amplification products, enabling this technology to be implemented in clinical laboratories for the routine diagnosis of Klebsiella oxygenae and Klebsiella gasgene infections. Furthermore, this technology can also be used for blood screening and prognosis. The detection assays for Klebsiella acidogenic and Klebsiella gasogenic can also be used in parallel with other assays to detect other nucleic acids, such as other bacteria and / or viruses.

[0043] This invention includes oligonucleotide primers and fluorescently labeled hydrolysis probes that bind to the genomes of Klebsiella acidogenetica and Klebsiella gasogenetica to specifically identify Klebsiella acidogenetica and Klebsiella gasogenetica using amplification and detection techniques.

[0044] As used herein, the term "amplification" refers to the process of synthesizing a nucleic acid molecule that is complementary to one or both strands of a template nucleic acid molecule (e.g., a nucleic acid molecule derived from the genome of Klebsiella acidogenic or Klebsiella aerogenes). Amplification of nucleic acid molecules typically involves denaturing the template nucleic acid at a temperature below the primer melting temperature, annealing the primers to the template nucleic acid, and enzymatically extending the primers to produce the amplification product. Amplification generally requires the presence of deoxyribonucleoside triphosphates, DNA polymerase (e.g., Taq), and appropriate buffers and / or cofactors for optimal polymerase activity (e.g., MgCl2 and / or KCl).

[0045] As used herein, the terms “primer,” “forward primer,” and “reverse primer” have meanings known to those skilled in the art, referring to oligomeric compounds capable of initiating DNA synthesis via template-dependent DNA polymerase, primarily oligonucleotides, but also modified oligonucleotides, such as primers with a free 3'-OH group at the 3' end. Additionally, “nucleotides” can be linked to template-dependent DNA polymerase via 3' to 5' phosphodiester bonds, thereby using deoxynucleoside triphosphates and releasing pyrophosphates.

[0046] In the context of primers and probes, the terms "binding" and "specific binding" refer to the annealing of one or more primers or probes with the amplification product.

[0047] In the context of nucleic acids, the term "extension" or "stretching" refers to the incorporation of additional nucleotides (or other similar molecules) into the nucleic acid. For example, nucleic acids may be extended by biocatalysts that incorporate nucleotides, such as polymerases that typically add nucleotides to the 3' end of nucleic acids.

[0048] As used herein, the terms sequence “identity” or “similarity” refer to the fact that, in the context of two or more nucleic acid sequences, when compared and aligned with maximum correspondence (e.g., by sequence comparison algorithms available to those skilled in the art or by visual inspection), two or more sequences or subsequences are identical or have a specific percentage of the same nucleotides. An exemplary algorithm suitable for determining percentage sequence identity and sequence similarity is the BLAST program, described, for example, in Altschul et al., (1990), “Basic local alignment search tool”, J. Mol. Biol. 215:403-410; Gish et al., (1993), “Identification of protein coding regions by database similarity search”, Nature Genet. 3:266-272; Madden et al., (1996) “Applications of network BLAST server”, Meth. Enzymol. 266:131-141; Altschul et al., (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402; and Zhang et al., (1997), “PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and The annotation "GenomeRes.7:649-656" is included in this paper by way of citation.

[0049] Primer-probe combinations for qualitative / quantitative detection

[0050] This disclosure provides a method for detecting Klebsiella acidogenic bacteria by amplifying a portion of its nucleic acid sequence. Specifically, this disclosure provides primers and probes for amplifying and qualitatively / or quantitatively detecting Klebsiella acidogenic nucleic acid molecular targets.

[0051] For the qualitative and / or quantitative detection of Klebsiella acidogenic bacteria, this disclosure provides primer-probe combinations for amplifying and detecting Klebsiella acidogenic bacteria.

[0052] This disclosure provides a method for detecting Klebsiella pneumoniae by amplifying a portion of its nucleic acid sequence. Specifically, this disclosure provides primers and probes for amplifying and qualitatively and / or quantitatively detecting Klebsiella pneumoniae nucleic acid molecular targets.

[0053] For the qualitative and / or quantitative detection of Klebsiella pneumoniae, this disclosure provides primer-probe combinations for amplifying and detecting Klebsiella pneumoniae.

[0054] In one embodiment, the Klebsiella primer and probe combinations shown in Tables 2 and / or 3 herein are used to provide a method for detecting Klebsiella in biological samples suspected of containing Klebsiella. The primer and probe combinations may comprise or consist of primers and probes specific to the nucleic acid sequences of Klebsiella.

[0055] In one embodiment, the probe disclosed herein can be a Taqman probe, which is an oligonucleotide labeled with a fluorescent dye reporter group (Reporter, R) at its 5' end and a quencher group (Quencher, Q) at its 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. As the reaction proceeds, the probe is cleaved by Taq enzyme, the 5' reporter group is released, and fluorescence is detected.

[0056] In one embodiment, the quenching group may be selected from the BHQ series (Black Hole Quencher), MGB probe (Minor Groove Binder), Eclipse probe, and Super Quencher (SQ).

[0057] In one implementation, the reporter group may be selected from the following table:

[0058] Table 1. Fluorescent reporter groups labeled with Taqman probes

[0059]

[0060] Polymerase chain reaction (PCR)

[0061] U.S. Patent Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188 disclose conventional PCR techniques. PCR typically employs two oligonucleotide primers that bind to a selected nucleic acid template (e.g., DNA or RNA). Primers used in some embodiments include oligonucleotides capable of serving as the starting point for nucleic acid synthesis within the described acid-producing and / or gas-producing Klebsiella nucleic acid sequence. For maximum efficiency in amplification, primers are preferably single-stranded, but primers can also be double-stranded. Double-stranded primers are first denatured to separate the strands. One method of denaturing double-stranded nucleic acids is by heating.

[0062] If the template nucleic acid is double-stranded, both strands must be separated before it can be used as a template in PCR. Strand separation can be accomplished by any suitable denaturation method, including physical, chemical, or enzymatic methods. One method for separating nucleic acid strands involves heating the nucleic acid until most of it is denatured (e.g., greater than 50%, 60%, 70%, 80%, 90%, or 95%). The heating conditions necessary to denature the template nucleic acid will depend on, for example, the buffer salt concentration and the length and nucleotide composition of the denatured nucleic acid, but are generally in the range of about 90°C to about 105°C for a period of time, depending on reaction characteristics such as temperature and nucleic acid length. Denaturation typically takes about 30 seconds to 4 minutes (e.g., 1 minute to 2.5 minutes, such as 1.5 minutes, 2 minutes).

[0063] If the double-stranded template nucleic acid is denatured by heating, the reaction mixture is allowed to cool to a temperature that promotes the annealing of each primer to its target sequence. Annealing temperatures are typically from about 35°C to about 65°C (e.g., about 40°C to about 60°C; about 45°C to about 50°C). Annealing times can be from about 10 seconds to about 1 minute (e.g., about 20 seconds to about 50 seconds; about 30 seconds to about 40 seconds). The reaction mixture is then adjusted to a temperature at which polymerase activity is promoted or optimized, i.e., a temperature sufficient to allow extension to occur from the annealed primers to generate a product complementary to the template nucleic acid. The temperature should be sufficient to synthesize the extension product from each primer annealed to the nucleic acid template, but should not be high enough to denature the extension product from its complementary template (e.g., temperatures used for extension typically range from about 40°C to about 80°C (e.g., about 50°C to about 70°C; about 60°C). Extension times can be from about 10 seconds to about 5 minutes (e.g., about 30 seconds to about 4 minutes; about 1 minute to about 3 minutes; about 1 minute 30 seconds to about 2 minutes).

[0064] PCR assays can utilize primers / probes for amplifying and / or detecting acid-producing and / or gas-producing Klebsiella nucleic acids. The template nucleic acid does not need to be purified; it can be a small fraction of a complex mixture, such as the Klebsiella nucleic acid found in human cells. Klebsiella nucleic acid molecules and / or primers / probes for amplifying and / or detecting Klebsiella can be extracted from biological samples using conventional techniques, such as those described in Diagnostic Molecular Microbiology: Principles and Applications (Persing et al., eds., 1993, American Society for Microbiology, Washington DC). Nucleic acids can be obtained from many sources, such as plasmids, or from natural sources, including bacteria, yeast, viruses, organelles, or higher organisms such as plants or animals.

[0065] The newly synthesized strands form double-stranded molecules that can be used in subsequent steps of the reaction. The strand separation, annealing, and extension steps can be repeated multiple times as needed to produce the desired amount of amplified product corresponding to the target nucleic acid molecule of Klebsiella pneumoniae. Limiting factors in the reaction are the amounts of primers, thermostable enzymes, and nucleoside triphosphates present. The cycling steps (i.e., denaturation, annealing, and extension) are preferably repeated at least once. For use in detection, the number of cycling steps will depend on, for example, the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify a sufficient number of target sequences for detection. Typically, the cycling steps are repeated at least about 20 times, but can be repeated up to 40, 60, or even 100 times.

[0066] Products / Reagent Kits

[0067] The embodiments disclosed herein further provide articles or kits for detecting Klebsiella acidogenic and / or Klebsiella gas-producing bacteria. Articles may include primers and probes for detecting Klebsiella acidogenic and / or Klebsiella gas-producing genetic targets, as well as suitable packaging materials. Representative primers and probes for detecting Klebsiella acidogenic and / or Klebsiella gas-producing bacteria are capable of specifically binding to Klebsiella acidogenic and / or Klebsiella gas-producing target nucleic acid molecules. Furthermore, kits may include appropriately packaged reagents and materials required for DNA immobilization, binding, and detection, such as solid supports, buffers, enzymes, and DNA standards. Representative examples of primers and probes for amplifying and hybridizing with Klebsiella acidogenic and / or Klebsiella gas-producing target nucleic acid molecules are provided herein.

[0068] The disclosed product or kit can be used in the Flash10 fully automated nucleic acid detection and analysis system, which features independent components for nucleic acid extraction, reagent mixing, temperature control, and fluorescence detection. Researchers simply place the sample to be tested into the sample chamber of the test kit, tighten the cap, place the test kit in the loading tray, and click to start the instrument to begin the experiment, protecting medical personnel from infection. After the experiment, the system can automatically determine positive or negative results, addressing issues such as a lack of testing personnel and insufficient experience.

[0069] An integrated rapid nucleic acid detection platform for Klebsiella acidogenic and / or Klebsiella gasogenic bacteria allows nucleic acid testing to move beyond the limitations of standard PCR laboratories. It can be widely applied in primary healthcare settings or in scenarios with limited testing resources, enabling rapid diagnosis of suspected patients and on-site screening of close contacts. This provides a rapid on-site testing method for patient confirmation, thereby making infectious disease risk control more precise and intelligent, protecting healthcare workers from infectious diseases, and promoting the modernization of in-hospital management and the scientification of disease prevention and control decision-making in primary healthcare institutions.

[0070] Example

[0071] The embodiments of this application will be described in detail below with reference to examples. Those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of this application. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Unless otherwise specified, all listed quantities are based on total weight and described in parts by weight. This application should not be construed as being limited to the specific embodiments described.

[0072] 1. Sample

[0073] Standard samples: Klebsiella acidogenic (CCUG 59412) and Klebsiella gas-producing (ATCC 13048) were serially diluted to weakly positive samples, and the sample concentrations were prepared according to the following examples.

[0074] Clinical sample: Negative sample of human bronchoalveolar lavage fluid.

[0075] Simulated bronchoalveolar lavage fluid sample: A simulated sample of human bronchoalveolar lavage fluid with added quantitative standard positive bacterial solution to simulate different bacterial concentrations in the human alveolar environment.

[0076] 2. Primer and probe sequences

[0077] The sequences of the primer-probe combinations used in this embodiment are shown in the table below.

[0078] Table 2. Oligonucleotides (primers and probes) used for detecting Klebsiella acidogenic bacteria:

[0079]

[0080] Table 3. Oligonucleotides (primers and probes) used for detecting Klebsiella pneumoniae:

[0081]

[0082] In the table above, "F" represents the forward primer; "R" represents the reverse primer; and "P" represents the probe. The 5' and 3' ends of the probe are modified with a fluorescent group and a quencher group, respectively.

[0083] 3. Detection Method

[0084] The samples were detected using real-time quantitative PCR using the primer and probe combinations listed in Tables 2 and 3 above. The detection could be performed using standard amplification procedures and reaction systems. In this example, the following amplification procedure was used: 96℃ for 2 min; 96℃ for 1 s, 58℃ for 1 s (fluorescence collection), 72℃ for 1 s x 45 cycles.

[0085] The following reagents were used in the qPCR reaction system of this example:

[0086] Table 4. Reagent system for simultaneous detection of Klebsiella acidogenic and Klebsiella gasogenic bacteria

[0087]

[0088]

[0089] RNaseP-F, RNaseP-R, and RNP-P-CY5 are the forward primer, reverse primer, and probe for detecting RNase, respectively, and are added to the system as internal controls.

[0090] The internal reference primer-probe sequences used in this application are as follows.

[0091] RNaseP-F: TTTGCCAATTGTACAGGGAA (SEQ ID NO:7)

[0092] RNaseP-R: GCCCTTGAAGAAGTGCCTCT (SEQ ID NO:8)

[0093] RNP-P: TTGTCTCGGATCCATCTCACTGCAA (SEQ ID NO:9) (5' end modified with CY5 fluorescent group; 3' end modified with BHQ2 quencher group).

[0094] qPCR was performed using the Flash10 fully automated nucleic acid detection and analysis system.

[0095] 4. Test Results

[0096] (1) Detection of standard samples

[0097] The standard samples were tested using the K. oxytoca-3 primer combination from Table 2 and the K. aerogenes-1 primer and probe combination from Table 3. The qPCR amplification results are shown in Tables 5 and 6.

[0098] Table 5. Ct values ​​for the detection of Klebsiella acidogenic standard samples

[0099]

[0100]

[0101] NA indicates not detected.

[0102] Table 6. Ct values ​​for the detection of Klebsiella pneumoniae standard samples

[0103] Standard Sample Sample concentration K. aerogenes-1 primers and probes Control primer probe Sample 1 4500 copies / mL 34.74 37.72 Sample 2 4500 copies / mL 35.39 NA Sample 3 1500 copies / mL 37.73 NA Sample 4 500 copies / mL 38.94 NA Sample 5 500 copies / mL 41.79 NA

[0104] NA indicates not detected.

[0105] The control primers and probes in Tables 5 and 6 are existing detection primers for *Klebsiella pneumoniae* and *Klebsiella acidogenic*. The sequences of the control primers and probes are as follows:

[0106] F:CGGTGAATACGTTCYCGG(SEQ ID NO:10)

[0107] R:GGWTACCTTGTTACGACTT(SEQ ID NO:11)

[0108] P:FAM-CTTGTACACACCGCCCGTC-TAM(SEQ ID NO:12)

[0109] (2) Detection of simulated bronchoalveolar lavage fluid samples

[0110] The K. oxytoca-3 primer and probe combination from Table 2 and the K. aerogenes-1 primer and probe combination from Table 3 were used to detect simulated human bronchoalveolar lavage fluid samples. Multiple tests were performed under the same conditions, and the average value was obtained. The qPCR amplification results are shown in Tables 7 and 8.

[0111] Table 7. Amplification results of Klebsiella acidogenic bacteria in simulated bronchoalveolar lavage fluid samples

[0112]

[0113]

[0114] Table 8. Amplification results of Klebsiella pneumoniae in simulated bronchoalveolar lavage fluid samples

[0115]

[0116] NA indicates not detected.

[0117] The results in Tables 5-8 show that the primer-probe combination for *Klebsiella pneumoniae* or *Klebsiella oxygenae* provided in this application exhibits lower detection Ct values ​​for different samples compared to the control primer-probe combination. This indicates that, compared to existing technologies, the primer-probe combination provided in this application can reach the fluorescence threshold with fewer cycles. Furthermore, the results also show that the detection limit of the primer-probe combination in this application is below 55.5 copies / mL for *Klebsiella pneumoniae* and below 500 copies / mL for *Klebsiella pneumoniae*, demonstrating lower detection limits than the control primer-probe combination. The primer-probe combination provided in this application achieves more efficient and sensitive detection of pathogens.

[0118] (3) Detection of simulated bronchoalveolar lavage fluid samples

[0119] The simulated human bronchoalveolar lavage fluid samples were amplified using the systems shown in Table 4, namely the K. oxytoca-3 combination in Table 2, the K. aerogenes-1 combination in Table 3, and the internal control combination, all for the same sample. The samples were set as a) simulated human bronchoalveolar lavage fluid samples that were Klebsiella pneumoniae positive and Klebsiella oxygenase negative; and b) simulated human bronchoalveolar lavage fluid samples that were Klebsiella oxygenase positive and Klebsiella pneumoniae negative, with a concentration of 4500 copies / mL for both samples.

[0120] The detection results for sample a) are as follows Figure 1 As shown, the detection results for sample b) are as follows: Figure 2 As shown. Figure 1 and Figure 2 The results for each fluorescence channel are shown in Table 9 below.

[0121]

[0122] NA indicates not detected.

[0123] The results above show that the primers in the K. aerogenes-1 combination of this application only amplify Klebsiella aerogenes in the sample and not Klebsiella oxytoca; the primers in the K. oxytoca-3 combination only amplify Klebsiella oxytoca in the sample and not Klebsiella aerogenes, indicating that the primers provided in this application have high specificity.

[0124] The invention described and claimed herein is not limited to the specific aspects disclosed herein, as these aspects are intended to illustrate various aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. In fact, various modifications to the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the disclosure including the definition shall prevail.

Claims

1. A composition comprising: a forward primer, a reverse primer, and a probe for detecting K. oxytoca, wherein, The forward primer and reverse primer for detecting K. oxytoca are a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and the probe for detecting K. oxytoca is a probe of SEQ ID NO:

3.

2. The composition of claim 1, wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quencher group.

3. The composition of claim 2, wherein the fluorescent reporter group is selected from the group consisting of 6-FAM, HEX, and ROX, and the fluorescent quencher group is selected from the group consisting of BHQl and BHQ2.

4. The composition of any one of claims 1-3, wherein the probe of SEQ ID NO: 3 is labeled with 6-FAM at the 5' end and BHQl at the 3' end.

5. A composition comprising: a forward primer, a reverse primer, and a probe for detecting K. aeruginogensis, wherein, The forward primer and reverse primer for detecting K. oxytoca are a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and the probe for detecting K. oxytoca is a probe of SEQ ID NO:

3.

6. The composition of claim 5, wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quencher group.

7. The composition of claim 6, wherein the fluorescent reporter group is selected from the group consisting of 6-FAM, HEX, and ROX, and the fluorescent quencher group is selected from the group consisting of BHQl and BHQ2.

8. The composition of any one of claims 5-7, wherein the probe of SEQ ID NO: 6 is labeled with ROX at the 5' end and BHQ2 at the 3' end.

9. A composition comprising: a combination of a forward primer, a reverse primer, and a probe for detecting K. oxytoca; and a combination of a forward primer, a reverse primer, and a probe for detecting K. pneumoniae, wherein The forward primer and reverse primer for detecting K. oxytoca are a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and the probe for detecting K. oxytoca is a probe of SEQ ID NO: 3; and the forward primer and reverse primer for detecting K. pneumoniae are a forward primer of SEQ ID NO: 4 and a reverse primer of SEQ ID NO: 5, and the probe for detecting K. pneumoniae is a probe of SEQ ID NO:

6.

10. The composition of claim 9, wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quencher group.

11. The composition of claim 10, wherein the fluorescent reporter group is selected from the group consisting of 6-FAM, HEX, and ROX, and the fluorescent quencher group is selected from the group consisting of BHQl and BHQ2.

12. The composition of any one of claims 9-11, wherein the probe of SEQ ID NO: 3 is labeled with 6-FAM at the 5' end and BHQl at the 3' end, and the probe of SEQ ID NO: 6 is labeled with ROX at the 5' end and BHQ2 at the 3' end.

13. A kit comprising the composition of any one of claims 1-12.

14. Use of a composition according to any one of claims 1 to 4 for the manufacture of a kit for the diagnosis of an infection or disease caused by K. oxytoca.

15. Use of a composition according to any one of claims 5 to 8 for the manufacture of a kit for the diagnosis of an infection or disease caused by K. pneumoniae.

16. Use of a composition according to any one of claims 9 to 12 for the manufacture of a kit for the diagnosis of an infection or disease caused by K. oxytoca and / or K. pneumoniae.

17. Use according to any one of claims 14 to 16, wherein the disease is selected from the group consisting of pneumonia, antibiotic-associated haemorrhagic colitis, sepsis and meningitis.

18. A method for non-diagnostic purposes for detecting K. oxytoca in a sample, comprising: amplifying the sample using a composition according to any one of claims 1 to 4; and determining the presence or absence of K. oxytoca in the sample from the amplification results.

19. A method for non-diagnostic purposes for detecting K. pneumoniae in a sample, comprising: amplifying the sample using a composition according to any one of claims 5 to 8; and determining the presence or absence of K. pneumoniae in the sample from the amplification results.

20. A method for non-diagnostic purposes for detecting K. oxytoca and / or K. pneumoniae in a sample, comprising: amplifying the sample using a composition according to any one of claims 9 to 12; and determining the presence or absence of K. oxytoca and / or K. pneumoniae in the sample from the amplification results.

21. The method according to any one of claims 18 to 20, wherein the amplification is by real-time quantitative PCR.

22. Use of a composition according to any one of claims 1 to 4 for the manufacture of a kit for detecting K. oxytoca in a sample.

23. Use of a composition according to any one of claims 5 to 8 for the manufacture of a kit for detecting K. pneumoniae in a sample.

24. Use of a composition according to any one of claims 9 to 12 for the manufacture of a kit for detecting K. oxytoca and / or K. pneumoniae in a sample.

25. The use according to any one of claims 22 to 24, wherein the sample is a sample from a human or an animal.

26. The use according to claim 25, wherein the sample is a human respiratory tract sample.

27. The use according to claim 26, wherein the sample is a lung sample.

Images