A small peptide for improving abiotic stress resistance of tartary buckwheat and its application
By applying the small peptide FtRALF6 on the buckwheat, the problem of poor tolerance to abiotic stress of buckwheat was solved, and a significant increase in resistance to salt stress, heavy metal stress, cold stress and heat stress was achieved, which promoted the normal growth and physiological functions of buckwheat, and improved yield and quality.
Patent Information
- Application Number
- CN202510765001.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-06-10
AI Technical Summary
The prior art is difficult to effectively improve the tolerance of threshing buckwheat to abiotic stress. The traditional breeding methods have a long cycle and low efficiency, and the effect of cultivation management measures is limited. There are few studies on small peptides for threshing buckwheat, especially small peptides that improve the tolerance of abiotic stress and their mechanism of action are unclear.
A small peptide FtRALF6 is provided, with an amino acid sequence of RYISYGALKRDYIPCS, which is applied by spraying or irrigation, dissolved in water or nutrient solution, and has a concentration of 1 μM. The application period is 3 to 4 leaf stages of the crop, and is used to improve the tolerance of buckwheat to salt stress, heavy metal stress, cold stress and heat stress.
Significantly improve the ability of buckwheat to resist salt stress, heavy metal stress, cold stress and heat stress, maintain normal growth and physiological functions, improve yield and quality, expand planting scope, and improve economic benefits.
Smart Images

Figure CN120329406B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biotechnology and botany, and in particular to a small peptide for improving the abiotic stress resistance of tartary buckwheat and application thereof. Background Art
[0002] Abiotic stresses are non-living environmental conditions that are detrimental to plant survival and growth, and can even lead to injury, damage, and death. These include low temperatures, high temperatures, drought, salinity, flooding, excessive light, ultraviolet radiation, mineral nutrient deficiencies, oxygen deficiency, strong winds, damage, and air, soil, or water pollution such as heavy metals, pesticides, ozone, and sulfur dioxide. Common abiotic stresses include extreme temperatures, high salinity, and heavy metal pollution.
[0003] Currently, improving buckwheat's tolerance to abiotic stresses is primarily achieved through traditional breeding methods and cultivation management practices. Traditional breeding methods are long, inefficient, and limited by the genetic resources of buckwheat. While cultivation management practices such as appropriate irrigation and fertilization can mitigate the effects of abiotic stresses to some extent, their effectiveness is limited. Recent research has identified peptides as a novel class of plant growth regulators. In addition to possessing the properties of proteins, they also play a crucial role in regulating plant growth, development, reproduction, and responses to environmental stresses. Small peptides, as a type of peptide, possess advantages such as small molecular weight, ease of absorption, and high activity. Studies in other crops have shown that certain small peptides can improve plant tolerance to abiotic stresses such as salt and drought stress. However, relatively little research has been conducted on small peptides in buckwheat, particularly regarding small peptides that can enhance buckwheat's abiotic stress tolerance and their mechanisms of action. Therefore, developing small peptides that can enhance buckwheat's abiotic stress tolerance is of great theoretical and practical significance. Summary of the Invention
[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides a small peptide for improving the abiotic stress resistance of tartary buckwheat and its application.
[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:
[0006] Provided is a small peptide for improving the abiotic stress resistance of tartary buckwheat. The small peptide is FtRALF6, and the amino acid sequence of FtRALF6 is shown in SEQ ID No.1.
[0007] The present invention also provides the use of the small peptide, which is used to improve the tolerance of tartary buckwheat to abiotic stress.
[0008] Furthermore, abiotic stresses include salt stress, heavy metal stress, cold stress and heat stress.
[0009] Furthermore, heavy metal stress is cadmium stress or antimony stress; cold stress is temperature less than or equal to 4°C; heat stress is temperature greater than or equal to 40°C.
[0010] Furthermore, the small peptide is applied by spraying or irrigation, and the small peptide is dissolved in water or nutrient solution during application, and the application concentration of the small peptide is 1 μM.
[0011] Furthermore, the small peptide is applied during the 3-4 leaf stage of the crop.
[0012] The present invention also provides a preparation for improving abiotic stress of tartary buckwheat, which comprises the FtRALF6 small peptide.
[0013] The beneficial effects of the present invention are:
[0014] The present invention, through exogenous application of the FtRALF6 peptide, significantly improves buckwheat's resistance to salt stress, heavy metal stress, cold stress, and heat stress, effectively maintaining normal growth and physiological functions under adverse conditions, and improving yield and quality. Furthermore, the peptide has a small molecular weight, is easily absorbed, and is environmentally friendly, with great potential for application. It can not only expand the scope of buckwheat cultivation and improve its economic benefits, but also provide new insights for crop stress resistance research and technology development. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 This is a statistical comparison of the effects of different abiotic stresses on the expression of FtRALF6 genes in buckwheat roots and leaves in Example 1;
[0016] Figure 2 This is a phenotypic comparison diagram of hydroponic buckwheat under different abiotic stresses in Example 2;
[0017] Figure 3 This is a statistical comparison of the root phenotype, taproot length, and fresh weight of tartary buckwheat under different abiotic stresses in Example 2;
[0018] Figure 4 This is a statistical comparison chart of malondialdehyde and superoxide anion in tartary buckwheat under different abiotic stresses in Example 3;
[0019] Figure 5 This is a statistical comparison chart of dehydrogenase activity of tartary buckwheat under different abiotic stresses in Example 4;
[0020] Figure 6 This is a statistical comparison chart of the photosynthetic pigment content of tartary buckwheat under different abiotic stresses in Example 5. DETAILED DESCRIPTION
[0021] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0022] The sources of the raw materials used in the embodiments of the present invention are shown in Table 1 below:
[0023] Table 1
[0024]
[0025] The tartary buckwheat used in the embodiments of the present invention is Chengku No. 2, which was successfully bred independently by Chengdu University on March 16, 2023.
[0026] Example 1: Buckwheat was hydroponically cultivated in batches under the same environment. When the buckwheat had grown 3-4 true leaves, seedlings with similar growth were selected and divided into six groups, with 12 plants in each group. The control group was cultured in normal Hoagland nutrient solution, while the stress groups were cultured in 150 mM NaCl, 100 μM Sb (III) (analytical grade, C8H4K2O 12 Buckwheat was hydroponically cultured under conditions of 200 μM Sb2 and 200 μM CdCl2, as well as cold (4°C) and hot (40°C) conditions. Leaves and roots of the seedlings were collected at 0, 6, 12, and 24 hours of treatment, and total RNA was extracted according to the instructions of the plant total RNA isolation kit. Qualified RNA was reverse transcribed into cDNA using the HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit. The Ftactin gene was used as an internal reference, and the primer sequences were:
[0027] Ftactin-F:GGAAGTATAGCGTCTGGATTGGC; (as shown in SEQ ID No. 2)
[0028] Ftactin-R: CACTTGCGGTGAACGATTGC. (as shown in SEQ ID No. 3)
[0029] Simultaneously design gene-specific primers:
[0030] FtRALF6-F:GCGGAGGAGGACGAGGAGATG; (as shown in SEQ ID No. 4)
[0031] FtRALF6-R: GGCGGCAGTTGTAGTAGGATGTTC. (as shown in SEQ ID No. 5)
[0032] The experiment was repeated three times, and the expression of FtRALF6 was detected by real-time fluorescence quantitative PCR on a BAI7500 real-time fluorescence quantitative PCR instrument. -ΔΔCT The algorithm calculates the relative expression of the target gene; set the 2 -ΔΔCT The value was 1, and the expression folds at 0, 6, 12, and 24 h under the control, 150 mM NaCl, 100 μM Sb, 200 μM CdCl2, cold (4°C), and hot (40°C) environments were calculated.
[0033] The results are as follows Figure 1 As shown, Figure 1 A and Figure 1 B respectively represents the expression levels of FtRALF6 in roots and leaves under NaCl environment at different treatment times; Figure 1 C and Figure 1 D respectively represent the expression levels of FtRALF6 in roots and leaves under different treatment times under CdCl2 environment; Figure 1 E and Figure 1 F respectively represents the expression levels of FtRALF6 in roots and leaves at different treatment times under Sb environment; Figure 1 G and Figure 1 H are the expression levels of FtRALF6 in roots and leaves at different treatment times under 4°C environment; Figure 1 I and Figure 1 J represents the expression levels of FtRALF6 in roots and leaves at different treatment times under 40℃ environment; Control represents the control group.
[0034] Depend on Figure 1FtRALF6 expression was significantly upregulated under all five abiotic stresses. Under salt (NaCl) stress (12 hours), its expression in roots and leaves reached 10.7-fold and 30.2-fold, respectively, compared to the control. After 6 hours of cadmium (CdCl₂) exposure, FtRALF6 expression in roots was induced 4.04-fold relative to the control, and after 12 hours, expression in leaves increased 18.62-fold. After 12 hours of antimony (Sb) treatment, expression in roots and leaves increased 4.0-fold and 42.28-fold, respectively, relative to the control. After 24 hours of cold (4°C) exposure, FtRALF6 expression in roots and leaves increased 5.10-fold and 8.57-fold, respectively, relative to the control. After 6 hours of heat stress (40°C), expression in roots increased 14.17-fold and in leaves 13.86-fold. These results demonstrate that FtRALF6 has the capacity to regulate multiple stress responses under diverse abiotic stresses.
[0035] Example 2: FtRALF6 peptide was synthesized using the Fmoc solid-phase synthesis method. The amino acid sequence of FtRALF6 is RYISYGALKRDYIPCS (SEQ ID No. 1). The prepared FtRALF6 peptide powder was centrifuged at 4000 rpm / min for 5 minutes and dissolved in a nutrient solution to produce an FtRALF6 / nutrient solution mixture. The concentration of the FtRALF6 peptide in the nutrient solution was 1 μM. Seedlings with 3-4 true leaves and similar growth characteristics were treated with the FtRALF6 / nutrient solution mixture for one day.
[0036] The seedlings treated with FtRALF6 peptide were subjected to abiotic stress, including salt (NaCl), heavy metals (Sb, CdCl2), cold (4°C) and heat (40°C). The groups that required abiotic stress were treated for two days and the phenotypes were observed. The results are shown in Figure 2. Figure 2 As shown, the white block in the lower right corner is the scale bar (4 cm);
[0037] CK refers to the CK control group seedlings that were not intervened with FtRALF6 peptide and not subjected to abiotic stress treatment;
[0038] FtRALF6 refers to the seedlings in the FtRALF6 treatment group that were intervened with FtRALF6 peptide but not subjected to abiotic stress treatment;
[0039] NaCl refers to seedlings that were not intervened by FtRALF6 peptide and were treated with salt stress;
[0040] CdCl2 refers to seedlings that were not intervened by FtRALF6 peptide and were subjected to heavy metal cadmium stress;
[0041] Sb refers to seedlings that were not intervened by FtRALF6 peptide and were treated with heavy metal antimony stress;
[0042] Cold refers to seedlings that were not intervened with FtRALF6 peptide and were treated with cold stress;
[0043] Heat refers to seedlings that were not intervened with FtRALF6 peptide and were treated with heat stress;
[0044] NaCl+FtRALF6 refers to seedlings that were intervened with FtRALF6 peptide and subjected to salt stress;
[0045] CdCl2+FtRALF6 refers to seedlings that were intervened with FtRALF6 peptide and subjected to heavy metal cadmium stress;
[0046] Sb+FtRALF6 refers to seedlings that were intervened with FtRALF6 peptide and subjected to heavy metal antimony stress;
[0047] Cold+FtRALF6 refers to seedlings that were intervened with FtRALF6 peptide and subjected to cold stress treatment;
[0048] Heat+FtRALF6 refers to seedlings that were intervened with FtRALF6 peptide and subjected to heat stress treatment;
[0049] Depend on Figure 2 The results showed that there were no significant phenotype differences between the CK control group and the FtRALF6-treated group. However, compared with the CK control group, the growth of buckwheat was significantly inhibited under different abiotic stresses (i.e., NaCl, CdCl2, Sb, Cold, and Heat). Furthermore, compared with the individual abiotic stresses (i.e., NaCl, CdCl2, Sb, Cold, and Heat), exogenous application of FtRALF6 (i.e., NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, and Heat+FtRALF6) effectively reduced the inhibitory effects of these stresses on buckwheat growth.
[0050] The seedlings from the different treatment groups were removed and their roots were washed with clean water. After washing, the roots were scanned and analyzed using the WinRHIZO root scanning system (Version 2007d, Regent Instrument Inc, Canada). The taproot length of each seedling was measured with a ruler, and the fresh weight was weighed with an electronic scale. Figure 3 As shown (p < 0.05), among which, Figure 3 AE is the phenotypic comparison of seedlings; Figure 3 FJ is the statistical comparison of taproot length under salt, cadmium, antimony, cold and heat stresses respectively; Figure 3KO is the statistical comparison of fresh weight of taproot under salt, cadmium, antimony, cold and heat stress; Figure 3 Different abiotic stresses significantly inhibited buckwheat root development. Compared with the CK control, taproot length decreased by 30.34%, 41.24%, 34.73%, 43.81%, and 50.19% under salt, cadmium, antimony, cold, and heat treatments, respectively, and fresh weight decreased by 66.16%, 49.47%, 54.31%, 75.42%, and 84.88%, respectively. However, exogenous application of FtRALF6 increased taproot length by 46.72%, 35.37%, 46.60%, 87.87%, and 80.51%, respectively, while fresh weight increased by 91.28%, 38.96%, 44.89%, 108.43%, and 228.64%, respectively, compared with the stress control.
[0051] Example 3: Take root samples from different treatment groups in Example 2, grind the samples into homogenate using the extract under ice bath conditions, centrifuge, take the supernatant, add malondialdehyde (MDA) detection working solution, treat in a boiling water bath for 60 min, cool to room temperature in an ice bath, centrifuge, and detect the absorbance of the supernatant at wavelengths of 450 nm, 532 nm and 600 nm, respectively, to detect the MDA content in the roots.
[0052] In addition, the extract and hydroxylamine hydrochloride were added to the supernatant, mixed thoroughly, reacted at 37°C for 20 min, then p-aminobenzenesulfonic acid and α-naphthylamine were added, reacted at 37°C for 20 min, then chloroform was added, mixed thoroughly, centrifuged, and the absorbance at 530 nm was measured to determine the superoxide anion (O2• - ) content. The results are as follows Figure 4 As shown (p < 0.05), Figure 4 AE is the statistical comparison of MDA content in roots subjected to salt, cadmium, antimony, cold and heat stresses; Figure 4 FJ is the O2• - Statistical comparison of content;
[0053] Depend on Figure 4 It can be seen that compared with the CK control group, the MDA content in the roots of the stress control groups (NaCl, CdCl2, Sb, Cold, Heat) increased by 10.97%, 22.78%, 11.82%, 24.83% and 63.65%, respectively, and the O2• -The contents increased by 193.61%, 258.93%, 349.18%, 997.73% and 133.27% respectively. However, the MDA contents in the roots of the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) after the application of exogenous FtRALF6 decreased by 11.8%, 17.89%, 14.26%, 18.83% and 6.5% respectively, and the O2• - The contents of FtRALF6 decreased by 89.26%, 71.35%, 82.42%, 57% and 77.94% respectively.Thus, the application of FtRALF6 alleviated the root oxidative stress.
[0054] Example 4: Take the root tip samples of the different treatment groups in Example 2, add 2,3,5-triphenyltetrazolium chloride, culture in the dark at 37°C for 3 hours, immediately put in an ice bath for 5 minutes, and then observe the distribution of plant dehydrogenase (PDHA) in the root system under a microscope. Preheat the microplate reader for more than 30 minutes, adjust the wavelength to 485 nm, and adjust the ethyl acetate to zero. Add the reagents in sequence to the centrifuge tube, add ethyl acetate and grind it thoroughly to a homogenous slurry, transfer it to a centrifuge tube, adjust the volume to 2 mL with ethyl acetate, mix it thoroughly, centrifuge it at 4°C and 10,000g for 5 minutes, and take the supernatant. After centrifugation, the absorbance of the supernatant was detected at a wavelength of 485 nm to measure the PDHA activity. The results are as follows Figure 5 As shown (p < 0.05), Figure 5 AE are the activity staining images of PDHA under salt, cadmium, antimony, cold and heat stress respectively. Figure 5 FJ are comparisons of PDHA activity under salt, cadmium, antimony, cold and heat stresses, respectively.
[0055] Depend on Figure 5FJ showed that compared with the CK control group, the PDHA activity of the stress control groups under different stress conditions (NaCl, Sb, CdCl2, Cold, Heat) decreased by 96.69%, 65.67%, 90.89%, 52.81% and 77.79%, respectively. However, the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) after application of exogenous FtRALF6 significantly reversed this inhibitory effect. Compared with the stress control groups (NaCl, CdCl2, Sb, Cold, Heat), the PDHA activities of the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) increased by 346.02% (FtRALF6+NaCl), 54.05% (FtRALF6+Cd), 303.75% (FtRALF6+Sb), 90.58% (FtRALF6+Cold), and 181.11% (FtRALF6+Heat), respectively.
[0056] Example 5: 0.5 g of leaves from the different treatment groups in Example 2 were extracted with a mixture of ethanol, acetone, and distilled water in a ratio of 4.5:4.5:1. The extraction process was carried out in the dark. When the leaves turned white, the supernatant was aspirated and the absorption peaks of chlorophyll a, chlorophyll b, and carotenoids were measured at wavelengths of 663 nm, 645 nm, and 470 nm, respectively. The results are shown in Figure 5. Figure 6 As shown (p < 0.05), among which, Figure 6 AE is the statistical comparison of total chlorophyll content in leaves subjected to salt, cadmium, antimony, cold and heat stresses, respectively; Figure 6 FJ are statistical comparisons of carotenoid contents in leaves subjected to salt, cadmium, antimony, cold and heat stresses, respectively.
[0057] Depend on Figure 6It can be seen that the total chlorophyll and carotenoid contents of the stress control groups (NaCl, CdCl2, Sb, Cold, and Heat) were significantly reduced under abiotic stress. The total chlorophyll level decreased by 37.84%, 58.63%, 18.00%, 50.27%, and 50.19%, respectively, and the carotenoid content decreased by 49.48%, 72.83%, 11.56%, 59.00%, and 58.70%, respectively. However, the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, and Heat+FtRALF6) effectively alleviated the stress-induced photosynthetic damage. Compared with the stress control groups (NaCl, CdCl2, Sb, Cold, and Heat), the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, and Heat+FtRALF6) The total chlorophyll contents of FtRALF6+NaCl, FtRALF6+Cd, FtRALF6+Sb, FtRALF6+Cold and FtRALF6+Heat increased by 85.45% (FtRALF6+NaCl), 51.46% (FtRALF6+Cd), 33.10% (FtRALF6+Sb), 33.02% (FtRALF6+Cold) and 73.60% (FtRALF6+Heat), respectively, and the carotenoid contents increased by 81.31%, 62.30%, 23.57%, 59.22% and 99.81%, respectively.
Claims
1. A small peptide that improves the abiotic stress resistance of tartary buckwheat, characterized in that: The small peptide is FtRALF6, and the amino acid sequence of FtRALF6 is shown in SEQ ID No.
1.
2. The use of the small peptide according to claim 1, characterized in that: The small peptide is used to improve the tolerance of tartary buckwheat to abiotic stress; The abiotic stress is salt stress, heavy metal stress, metalloid stress, cold stress and heat stress; The heavy metal stress is cadmium stress; the metalloid stress is antimony stress; cold stress is a temperature less than or equal to 4°C; and heat stress is a temperature greater than or equal to 40°C.
3. The use according to claim 2, characterized in that The small peptide is applied by spraying or irrigation, and is dissolved in water or nutrient solution during application, and the application concentration of the small peptide is 1 μM.
4. The use according to claim 3, characterized in that The application period of the small peptide is the 3-4 leaf stage of the crop.
5. A preparation for improving abiotic stress of tartary buckwheat, characterized in that: The preparation comprises the small peptide according to claim 1.
Citation Information
Patent Citations
FtACA13 gene derived from tartary buckwheat and expression vector and application of FtACA13 gene
CN119685356A
Small peptide for improving abiotic stress tolerance of crops and application thereof
CN119751584A