Method for rapidly screening antibacterial peptide in chlamydomonas based on luciferase labeling and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a method for rapidly screening antibacterial peptides in chlamydomonas based on luciferase labeling and application of the method. Specifically, a plasmid with a luciferase tag and ubiquitin protein is utilized, antibacterial peptide is introduced into the plasmid, and a chlamydomonas reinhardtii strain capable of stably secreting the antibacterial peptide to the outside of a cell in an exosome form is developed. The ubiquitin secretion efficiency of the exosome is further optimized and improved, so that the protein secretion efficiency of the antibacterial peptide is improved, and the method has good practical application prospect and value.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a method for rapidly screening antibacterial peptides in Chlamydomonas based on luciferase labeling and its application. Background Art

[0002] The information disclosed in the background art of the present invention is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an indication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] In aquaculture, common bacterial diseases include white skin disease, red skin disease and even septicemia caused by Pseudomonas; enteritis and skin ulcer disease caused by Aeromonas hydrophila; bacterial gill rot disease and white skin disease caused by Cytophaga columnaris, etc. These diseases can cause large-scale deaths of aquatic animals when severe. Although antibiotics are the most commonly used main means to control pathogenic bacteria, due to the lack of standardization in the selection and use methods of drugs in aquaculture, the phenomenon of abuse of antibiotics inevitably occurs, resulting in environmental pollution and multiple incidents of excessive drug residues in aquaculture products. To solve these problems, in addition to strengthening the management of the use of antibiotics, finding substitutes for traditional antibiotics is also an urgent problem to be solved. Among them, antibacterial peptides have become one of the most promising candidate drugs due to their role in killing drug-resistant microorganisms. Different from traditional antibiotics, antibacterial peptides usually cause rapid cell death by disrupting the microbial membrane, rather than targeting specific bacterial processes (such as protein synthesis or cell wall synthesis). This physical destruction mechanism reduces the possibility of pathogens developing drug resistance. In addition, antibacterial peptides have low toxicity to host cells and usually have high specificity for microbial cells. This makes them safer in the treatment of infections, especially in sensitive tissues.

[0004] Antibacterial peptides are a class of small peptides, usually composed of 12 - 50 amino acid residues, and more than 3100 natural antibacterial peptides have been discovered so far. Research shows that antibacterial peptides are an important part of the innate immune systems of most organisms (including plants, mollusks, amphibians, fish and mammals, etc.), participating in regulating the immune system against a variety of invasive pathogens, and are considered an important defense component of the non-specific immune function of organisms. Antibacterial peptides have broad-spectrum antibacterial effects, can kill certain fungi, protozoa and drug-resistant bacteria, and also have certain antiviral and anti-tumor effects. In the field of aquaculture, the application of antibacterial peptides has been widely studied. For example, Sparanegtin expressed in mud crabs has been proven to have significant inhibitory effects on Gram-positive bacteria, Gram-negative bacteria and fungi. This shows that antibacterial peptides not only have important theoretical significance, but also show great potential in practical applications.

[0005] The development and application of antimicrobial peptides have important research significance in the fields of medicine, pharmacology, animal and plant physiology, and marine pollution. However, the expression level of antimicrobial peptides in animal and plant cells is very low, and the growth cycle of animal and plant cells is long and the differentiation is slow. It is difficult to express antimicrobial peptides in large quantities through animals and plants. Therefore, how to prepare active antimicrobial peptides in large quantities, at low cost, and with high efficiency is crucial.

[0006] Currently, there are many challenges in purifying antimicrobial peptides by existing methods. Traditional purification methods such as chromatography may be costly, especially for large-scale production, and it is not easy to obtain high-purity antimicrobial peptides. In addition, antimicrobial peptides may be easily degraded by proteases during the purification process, affecting their stability. During the purification process, the activity of antimicrobial peptides may be reduced due to changes in environmental conditions.

[0007] The Escherichia coli expression system is the earliest established and most mature prokaryotic expression system for expressing heterologous genes, with the advantages of high expression level, simple operation, and low cost. However, it contains a large amount of endotoxins that can cause immune responses, which will affect the separation and purification of antimicrobial peptides. This system lacks the biological processes of folding, modification, and processing of eukaryotic proteins and is prone to form inclusion bodies. Due to the inhibitory effect of antimicrobial peptides themselves on Escherichia coli, many antimicrobial peptides cannot be expressed through Escherichia coli. Yeast is the most commonly used eukaryotic protein expression system, which can correctly perform post-translational modification on antimicrobial peptides, but will over-glycosylate antimicrobial peptides, thus affecting their antibacterial activity. In addition, when yeast is fermented at high density, the large growth of bacteria will cause insufficient dissolved oxygen, which will then inhibit proliferation and reduce the expression level of antimicrobial peptides, making it difficult for separation and purification. Both expression systems require heterotrophic fermentation, consuming a large amount of culture medium, oxygen, and electrical energy, increasing costs and causing environmental pollution.

[0008] Transgenic microalgae, as an expression host for heterologous proteins, have received increasing attention. Chlamydomonas reinhardtii is a single-celled eukaryotic green alga, and all its genomes have been sequenced, and genome transformation is very mature. Chlamydomonas reinhardtii performs post-translational modification on the expressed heterologous proteins and is an excellent eukaryotic protein expression platform. More importantly, Chlamydomonas reinhardtii grows rapidly in a photobioreactor using a low-cost culture medium, and the culture technology is mature. In addition, Chlamydomonas reinhardtii contains chloroplasts that can perform photosynthesis, absorb CO2 and synthesize plant proteins, and can be used as bait for aquatic organisms such as fish and shrimp. It will not release metabolites and endotoxins harmful to the environment or the human body during the entire growth cycle. Given these characteristics, using the Chlamydomonas reinhardtii system for the expression and production of antimicrobial peptides is not only feasible but also has great application potential in the aquaculture industry. This system provides an environmentally friendly and efficient production method, which helps to promote the sustainable development of the industry.

[0009] In recent scientific research, the research team has successfully achieved heterologous expression of specific antimicrobial peptides in Chlamydomonas reinhardtii and conducted a detailed evaluation of the biological activities of these peptides. Taking the antimicrobial peptide ToAmP4 as an example, after being expressed by the Chlamydomonas reinhardtii expression system, this peptide exhibits significant biological activity and has effective inhibitory effects on both Escherichia coli and Staphylococcus aureus. However, the protein still needs to be purified. In addition, the researchers used signal peptides in Chlamydomonas reinhardtii to secrete antimicrobial peptides into the extracellular environment, but this process usually relies on cell wall-deficient Chlamydomonas strains. However, cell wall-deficient Chlamydomonas are products after genetic modification, and their growth status is more affected by the environment than that of normal wild types, which is not conducive to their practical application. Summary of the Invention

[0010] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a method for rapidly screening antimicrobial peptides in Chlamydomonas based on luciferase labeling and its application. Specifically, the present invention uses a plasmid with a luciferase tag and ubiquitin protein, introduces the antimicrobial peptide into this plasmid, and develops a Chlamydomonas reinhardtii strain that can stably secrete the antimicrobial peptide in the form of exosomes into the extracellular environment; and further optimizes and improves the efficiency of exosome secretion of ubiquitin, thereby improving the secretion efficiency of the antimicrobial peptide protein. Based on the above research results, the present invention is completed.

[0011] Specifically, the technical solutions of the present invention are as follows:

[0012] In the first aspect of the present invention, there is provided a method for rapidly screening antimicrobial peptides in Chlamydomonas based on luciferase labeling, the method comprising: introducing genes encoding ubiquitin protein, target antimicrobial peptide, and luciferase into a vector to obtain a recombinant expression vector, and introducing the recombinant expression vector into Chlamydomonas for expression.

[0013] In the second aspect of the present invention, there is provided the antimicrobial peptide obtained by the above method and the corresponding transgenic Chlamydomonas strain.

[0014] In the third aspect of the present invention, there is provided the application of the above method in any one or more of the following:

[0015] (a) Rapidly screening and identifying heterologously expressed antimicrobial peptides with antibacterial activity;

[0016] (b) Preparing aquatic feed.

[0017] The beneficial technical effects of the above one or more technical solutions:

[0018] The above technical solution developed an innovative screening system based on the luciferase reporter gene to improve the working efficiency of screening antibacterial peptides, and realized the extracellular secretion of antibacterial peptides through the exosome (vesicle) pathway of transgenic Chlamydomonas reinhardtii. This strategy not only improves the screening efficiency, but also provides a simple and efficient in vitro screening method for quickly identifying heterologously expressed antibacterial peptides with antibacterial activity. Through this strategy, researchers can directly obtain and evaluate the activity of antibacterial peptides from the culture medium under simple operations, thus opening up new ways for the discovery and application of antibacterial peptides. It has important scientific and clinical significance for the development of new antibacterial agents, especially for new treatment strategies against drug-resistant bacteria.

[0019] At the same time, compared with the Escherichia coli and yeast expression systems, Chlamydomonas reinhardtii can also be used as bait for aquatic organisms such as fish and shrimp, and can also be cultured in closed aquaculture ponds, which has important application potential in the aquaculture industry. Therefore, the above technical solution has good practical application prospects and value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings forming a part of this invention are used to provide a further understanding of the invention. The schematic embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0021] Figure 1 In the present invention, the Leap2B nucleic acid sequence is introduced into the pBR25-ble plasmid, located at the C-terminus of the ble sequence, and the Leap2B protein is separated from the ble protein by the self-cleaving peptide F2A. It will not be secreted.

[0022] Figure 2 In the present invention, Western bloting experiments were used to detect the expression of Leap2B in electrotransformed pBR25-ble-Leap2B Chlamydomonas positive transformants.

[0023] Figure 3 In the present invention, the Leap2B protein was purified and an in vitro antibacterial zone experiment was carried out, and no antibacterial zone appeared.

[0024] Figure 4 In the present invention, the plasmid maps of PUC19-PsaD-2×HA-ubiquitin-Leap2B-6×His-luc-paromomycin and PUC19-PsaD-2×HA-ubiquitin-linker-Leap2B-6×His-luc-paromomycin were constructed.

[0025] Figure 5In the present invention, in the screening of 96-well plates for the electrotransformation of PUC19-PsaD-2×HA-ubiquitin-Leap2B-6×His-luc-paromomycin and PUC19-PsaD-2×HA-ubiquitin-linker-Leap2B-6×His-luc-paromomycin plasmids in Chlamydomonas reinhardtii, the luciferase expression in the culture supernatant was detected, and the plasmid with the linker was more likely to be secreted.

[0026] Figure 6 In the present invention, in order to further verify the effect after adding the linker, Chlamydomonas reinhardtii was cultured in a blown conical flask (50 ml), and the luciferase expression in the culture supernatant and cells of Chlamydomonas reinhardtii was detected. (Before separating the supernatant and precipitate, the absorbance was measured and the data was normalized.)

[0027] Figure 7 In the present invention, Paramecium was co-fed with wild-type Chlamydomonas reinhardtii, g1-Leap2B Chlamydomonas reinhardtii, and g1-ubiquitin-linker-Leap2B Chlamydomonas reinhardtii to equal-length zebrafish, and the length of zebrafish in different groups was detected. (The two types of Chlamydomonas reinhardtii were co-cultured with zebrafish larvae. Divided into three groups: Paramecium + g1, Paramecium + g1-Leap2B, Paramecium + g1-ub-linker-Leap2B. The growth of zebrafish was statistically analyzed (05 was the start date). It was found that adding the g1-ub-linker-Leap2B antimicrobial peptide significantly increased the growth length of zebrafish.)

[0028] Figure 8 In the present invention, only the experiments on Paramecium + g1-Leap2B and Paramecium + g1-ub-linker-Leap2B were carried out to further detect the effect of the secreted Leap2B Chlamydomonas reinhardtii on the length of zebrafish, and the statistics were carried out three times on the first day, the fifth day, and the eighth day.

[0029] Figure 9 In the present invention, a pre-experiment (4 fish) of the zebrafish challenge experiment was carried out, and Chlamydomonas reinhardtii expressing ub-linker-Leap2B was co-cultured with zebrafish larvae (both added with Paramecium). The group expressing Leap2B could improve the survival rate of zebrafish.

[0030] Figure 10 In the present invention, a zebrafish challenge experiment was carried out in groups, with 14 fish (in the same state). The group of Chlamydomonas reinhardtii expressing Leap2B could improve the survival rate of zebrafish. Detailed implementation mode

[0031] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0032] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they specify the presence of features, steps, operations, devices, components, and / or their combinations.

[0033] As mentioned above, for the method of extracellularly secreting antimicrobial peptides in vitro through signal peptides (leader peptides), it relies on cell wall-deficient Chlamydomonas reinhardtii. Cell wall-deficient Chlamydomonas reinhardtii is a product after genetic modification, and its growth state is more affected by the environment than that of normal wild types.

[0034] At the same time, due to the small molecular weight of antimicrobial peptides, it is often difficult to efficiently screen positive transformants during Western blotting experiments. Traditional methods rely on multiple steps of antigen-antibody binding, which is not only cumbersome but also likely to miss transformants expressing exogenous antimicrobial peptides when the growth state of Chlamydomonas reinhardtii is poor, thus reducing the accuracy and efficiency of screening.

[0035] In view of this, when constructing an exogenous plasmid vector, the present invention introduced the Gaussia luciferase gene. Utilizing the high-sensitivity characteristic of luciferase, only adding the substrate coelenterazine to the reaction system can cause luminescence under the catalysis of luciferase. This process does not rely on the participation of ATP, making the screening process more suitable for the requirements of high-throughput screening. In addition, by fusing the expression of antimicrobial peptide protein and luciferase protein, the expression level of antimicrobial peptide protein can be intuitively reflected by measuring the activity of luciferase. This method not only improves the accuracy of screening but also simplifies the operation process, providing an effective strategy for rapidly evaluating the expression of antimicrobial peptide proteins. Through this method, we can more precisely screen out transformants expressing the target antimicrobial peptide, thus accelerating the research and application process of antimicrobial peptides. In subsequent experiments, we also detected that the expression of luciferase does not affect the activity of antimicrobial peptides.

[0036] Compared with Escherichia coli and yeast expression systems, Chlamydomonas reinhardtii can be used as bait for aquatic organisms such as fish and shrimp, and can also be cultured in closed aquaculture ponds, having important application potential in the aquaculture industry. By secreting antimicrobial peptides into the environment in the form of exosomes (vesicles), it can improve the water resource quality on the basis of providing feed, enhance the antimicrobial ability of aquatic products both in vivo and in vitro, and improve the survival rate. It saves the extraction process of non-secretory antimicrobial peptide Chlamydomonas reinhardtii.

[0037] In fact, the present invention has proven through experiments that when constructing the Leap2B plasmid (pBR25-ble-Leap2B-HA) of a common expression vector, the antimicrobial peptide is not secreted extracellularly through exosomes. Although positive strains were screened through western experiments, the experimental results showed that the Leap2B protein extracted from Chlamydomonas reinhardtii could not significantly inhibit the reproduction of bacteria (in vitro antibacterial zone experiment). At the same time, feeding zebrafish with g1-Leap2B Chlamydomonas reinhardtii did not increase the length of the fish, and co-culturing zebrafish with g1-Leap2B Chlamydomonas reinhardtii and bacteria did not increase the survival rate of zebrafish.

[0038] Therefore, the present invention constructs Leap2B Chlamydomonas reinhardtii based on ubiquitin secretion: g1-ub-Leap2B (Leap2B can be secreted extracellularly through the exosome pathway). However, the research found that the secretion efficiency of Leap2B directly linked to ubiquitin is still not very high. By adding a linker (protein sequence GASGQGASGA, SEQ ID NO.1; nucleic acid sequence GGCGCCTCCGGCCAGGGCGCCTCCGGCGCG, SEQ ID NO.2) between ubiquitin and Leap2B, the secretion of Leap2B in the supernatant can be significantly improved, thus playing a good antibacterial role and promoting the growth of fish.

[0039] Therefore, specifically, in a typical embodiment of the present invention, a method for rapidly screening antimicrobial peptides in Chlamydomonas reinhardtii based on luciferase labeling is provided. The method includes: introducing genes encoding ubiquitin protein, target antimicrobial peptide, and luciferase into a vector to obtain a recombinant expression vector, and introducing the recombinant expression vector into Chlamydomonas reinhardtii for expression.

[0040] In the present invention, the Chlamydomonas reinhardtii is Chlamydomonas reinhardtii, and more specifically, the Chlamydomonas reinhardtii is CC-5415nit1 agg1 mt+ (Witman g1, https: / / www.chlamycollection.org / ). By exogenous introduction of ubiquitin protein, the target antimicrobial peptide is secreted from the flagella of Chlamydomonas reinhardtii.

[0041] In the present invention, the luciferase can be Gaussia luciferase (Gluc, Gaussia Luciferase).

[0042] The antimicrobial peptide can be Pg-AMP1, Piscidin, Sparanegtin, Leap2B, etc., among which Leap2B is preferred.

[0043] Furthermore, on the recombinant expression vector, the gene encoding the ubiquitin protein is linked to the gene encoding the antimicrobial peptide through the gene encoding the linker peptide. Through research, the present invention has found that the secretion efficiency of Leap2B directly linked to ubiquitin is relatively low, while by linking ubiquitin and Leap2B through the linker peptide linker, the secretion of Leap2B in the supernatant can be significantly improved.

[0044] Therefore, further, the recombinant expression vector can be PUC19 - PsaD - 2×HA - ubiquitin - linker - Leap2B - 6×His - luc - paromomycin, and its nucleotide sequence is as shown in SEQ ID NO.3.

[0045] Furthermore, the method further includes screening the antimicrobial peptide by detecting the luciferase.

[0046] In another specific embodiment of the present invention, the antimicrobial peptide obtained by the above method and the corresponding transgenic Chlamydomonas reinhardtii strain are provided.

[0047] In another specific embodiment of the present invention, the application of the above method in any one or more of the following is provided:

[0048] (a) Rapidly screening and identifying heterologously expressed antimicrobial peptides with antibacterial activity;

[0049] (b) Preparing aquatic feed.

[0050] Among them, the aquatic feed is an aquatic antibacterial feed. Specifically, the transgenic Chlamydomonas reinhardtii strain can be used as the aquatic feed or a component of the aquatic feed. Further, the aquatic antibacterial feed has both in - vivo and in - vitro antibacterial effects, thus effectively improving the living environment (water environment) of aquatic products.

[0051] The following further explains the present invention through examples, but does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0052] Example

[0053] 1. Construct the pBR25 - ble - Leap2B - HA plasmid. The plasmid is directly synthesized by the company's fragments and then ligated.

[0054] The nucleotide sequence of Leap2B without the signal peptide:

[0055] GTGCCCGTCGTGACCCCCGAGGTGCGCAGCGACCTGCAGTCCCCGCATATCCTGCACCGCAAGATCCGCATGAGCCCCCTGTGGCGCATCATGGGCTTCAAGCCCTATGGCGCCTACTGCCACGACAACATCGAGTGCATCACCGGCCTGTGCCGCAACGGCCACTGCTCGTTCAACGAGCCCGTGCATTCC(SEQ ID NO.4)

[0056] The plasmid was electrotransformed into wild-type Chlamydomonas reinhardtii g1 (CC-5415 nit1 agg1 mt+ (Witman g1, https: / / www.chlamycollection.org / )), and screening was performed by western blotting to detect protein expression. The specific operation method is as follows:

[0057] (1) Bacterial shaking: Shake Escherichia coli, Edwardsiella, and Burkholderia until OD600 = 2.0;

[0058] (2) Dilute the bacteria 10-fold with LB, take 100 μL of the diluted bacterial solution and add it to 200 mL of LB medium, mix well, pour the plate, and let it stand to dry and solidify;

[0059] (3) Punch holes in the solid plate using a puncher;

[0060] (4) Divide into positive control (ampicillin antibiotic), negative control (Chlamydomonas medium), and experimental group (Leap2B Chlamydomonas crude body fluid, supernatant after ultrasonic disruption of Chlamydomonas), add 200 μL to each well, let it stand at room temperature, and observe the inhibition zone every 1 h.

[0061] The result found: no inhibitory effect.

[0062] Design the following primers to amplify the Leap2B fragment (with homologous arms) to construct the PUC19-PsaD-2×HA-ubiquitin-Leap2B-6×His-luc-paromomycin plasmid

[0063]

[0064] PCR system

[0065]

[0066]

[0067] Gloria Nova HS2×Master Mix with Dy was purchased from ABclonal (Cat.No.RK20728)

[0068] Primer:

[0069] ubiquitin-Leap2B-F ubiquitin-Leap2B-R

[0070] PCR reaction conditions:

[0071]

[0072] PUC19-PsaD-2×HA-ubiquitin-luc-paromomycin plasmid was treated with EcoRV (Cat.No.1042s, TaKaRa) restriction endonuclease

[0073] System:

[0074] 2 μL of EcoRV, 20 μL of buffer, 10 μg of plasmid, made up to 200 μL with ddH2O

[0075] Treat at 37 °C for 2 h

[0076] The Leap2B-6×His target fragment was ligated to the digested plasmid using seamless cloning enzyme (Cat.No.RK21020, ABclonal)

[0077]

[0078] Note: X = [0.02x number of base pairs] ng / concentration of digested vector

[0079] Y = [0.04x number of base pairs] ng / concentration of target fragment

[0080] Reaction time: 50 °C, 20 min

[0081] Transformation (competent cell: DH5α)

[0082] Construct the PUC19-PsaD-2×HA-ubiquitin-linker-Leap2B-6×His-luc-paromomycin plasmid, and its nucleotide sequence information is as follows:

[0083]

[0084] The system program is the same as above, and the connection method is the same as above.

[0085] Primers: ub-linker-Leap2B-F; ubiquitin-Leap2B-R

[0086] The two plasmids were introduced into Chlamydomonas g1 by electroporation.

[0087] The positive transformants of Leap2B were screened by a microplate reader and cultured in 24-well plates. The following results are the luciferase detection data of the supernatant of Chlamydomonas expressing the two plasmids (the absorbance of Chlamydomonas cells was measured to normalize the cell number and make the cell numbers in different groups the same):

[0088] To further verify the effect after adding the linker, it was cultured in 50 ml of TAP medium. The luciferase expression levels in the supernatant and precipitate were detected (the absorbance was measured before separating the supernatant and precipitate to normalize the data).

[0089] The two types of Chlamydomonas were co-cultured with zebrafish larvae. It was divided into three groups: Paramecium + g1, Paramecium + g1-Leap2B, Paramecium + g1-ub-linker-Leap2B. The growth of zebrafish was statistically analyzed ( Figure 7 05 in the middle is the starting time for statistics, that is, the 5th day, and so on). It was found that adding the g1-ub-linker-Leap2B antibacterial peptide significantly increased the growth length of zebrafish.

[0090] Specific experimental methods:

[0091] (1) Cultivate the same number of zebrafish larvae in different groups with similar lengths;

[0092] (2) Conduct three groups of experiments: Paramecium + g1, Paramecium + g1-Leap2B, Paramecium + g1-ub-linker-Leap2B. Paramecium was added to each group, and the water in the fish tank was changed daily, and 25 ml of Chlamydomonas was added;

[0093] (3) Measure the length of zebrafish every certain number of days.

[0094] Next, only the experiments on Paramecium + g1-Leap2B and Paramecium + g1-ub-linker-Leap2B were conducted and statistically analyzed three times.

[0095] Zebrafish challenge experiment:

[0096] Raise zebrafish for 6 days. Co-culture Chlamydomonas expressing ub-linker-Leap2B with zebrafish larvae (both added with Paramecium). The group expressing Leap2B can improve the survival rate of zebrafish (possibly due to the too high concentration of bacteria added and the poor condition of zebrafish in the control group, resulting in the premature death of zebrafish in the control group).

[0097] Conduct a zebrafish challenge experiment by grouping, with 14 fish (in the same condition). The Chlamydomonas group expressing Leap2B can improve the survival rate of zebrafish.

[0098] Specific experimental method: Prepare Chlamydomonas (g1, Chlamydomonas expressing antibacterial peptide), Aeromonas hydrophila, and larvae (feed: Paramecium or Artemia nauplii).

[0099] Put zebrafish larvae into 3 100-ml beakers containing 50 ml of water two days in advance and group them to adapt to the environment, and mark them (WT, Chlamydomonas expressing antibacterial peptide, Ctrl).

[0100] Shake the bacteria: Aeromonas hydrophila 20 ml the night before, so that the final concentration of the bacteria is at OD 600 = 1 (10 9 CFU / ml).

[0101] Add the bacterial solution: Centrifuge 3 tubes, each tube with 5 ml of OD 600 = 1 bacteria, resuspend it with the same volume of PBS, and add it to the beaker; note that the final volume of water in the beaker remains 50 ml, and the final concentration of the bacteria is 10 8 CFU / ml (challenge concentration).

[0102] Add Chlamydomonas: Count the Chlamydomonas to ensure the same amount of added Chlamydomonas; centrifuge the counted Chlamydomonas and resuspend it with the same volume of PBS, and add g1 Chlamydomonas to the control group.

[0103] Statistical analysis and water change: Replace half of the culture water every 24 h. After each water change, add Aeromonas hydrophila and Chlamydomonas again respectively, and count the number of zebrafish at the same time.

[0104] Matters not covered in this invention are well-known technologies.

[0105] The nucleotide / amino acid sequence information involved in this application

[0106] Amino acid sequence of Ubiquitin:

[0107] MQIFVKTLTGKTITLEVESSDTIENVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGA (SEQ ID NO.5)

[0108] Nucleic acid sequence of Ubiquitin:

[0109] ATGCAGATTTTCGTGAAGACCCTGACCGGCAAGACTATCACCCTCGAGGTGGAGTCGTCCGACACCATTGAGAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGCCTGATCTTCGCCGGCAAGCAGCTGGAGGACGGCCGCACCCTGGCTGACTACAACATCCAGAAGGAGTCGACTCTGCACCTGGTGCTGCGCCTGCGCGGTGCG(SEQ ID NO.6)

[0110] luc is Gaussia luciferase, and its nucleotide sequence is as follows:

[0111] ATGgtcaacGGCGTGAAGGTGCTGTTCGCCCTGATCTGCATCGCCGTGGCCGAGGCCAAGCCCACCGAGAACAACGAGGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCCACCACCGACCTGGACGCCGACCGCGGCAAGCTGCCCGGCAAGAAGCTGCCCCTGGAGGTGCTGAAGGAGATGGAGGCCAACGCCCGCAAGGCCGGCTGCACCCGCGGCTGCCTGATCTGCCTGAGCCACATCAAGTGCACCCCCAAGATGAAGAAGTTCATCCCCGGCCGCTGCCACACCTACGAGGGCGACAAGGAGAGCGCCCAGGGCGGCATCGGCGAGGCCATCGTGGACATCCCCGAGATCCCCGGCTTCAAGGACCTGGAGCCCATGGAGCAGTTCATCGCCCAGGTGGACCTGTGCGTGGACTGCACCACCGGCTGCCTGAAGGGCCTGGCCAACGTGCAGTGCAGCGACCTGCTGAAGAAGTGGCTGCCCCAGCGCTGCGCCACCTTCGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGCGCCGGCGGCGACgatacg(SEQ ID NO.7)

[0112] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for rapidly screening antibacterial peptides in Chlamydomonas based on luciferase labeling, characterized in that, The method includes: introducing genes encoding ubiquitin protein, target antimicrobial peptide, and luciferase into a vector to obtain a recombinant expression vector, and introducing the recombinant expression vector into Chlamydomonas for expression.

2. The method according to claim 1, wherein The Chlamydomonas is Chlamydomonas reinhardtii.

3. The method according to claim 1, wherein The luciferase is Gaussia luciferase.

4. The method according to claim 1, wherein The antimicrobial peptides are Pg-AMP1, Piscidin, Sparanegtin, and Leap2B, among which Leap2B is preferred.

5. The method according to claim 1, characterized in that, On the recombinant expression vector, the gene encoding the ubiquitin protein is linked to the gene encoding the antimicrobial peptide through a gene encoding a linker peptide.

6. The method according to claim 5, characterized in that, The recombinant expression vector can be PUC19-PsaD-2×HA-ubiquitin-linker-Leap2B-6×His-luc-paromomycin.

7. The method according to claim 1, characterized in that, The method further includes screening the antimicrobial peptide by detecting the luciferase.

8. The antimicrobial peptide obtained by the method according to any one of claims 1-7, and the corresponding transgenic Chlamydomonas strain.

9. Use of the method according to any one of claims 1-7 in any one or more of the following: (a) Rapidly screening and identifying heterologously expressed antimicrobial peptides with antibacterial activity; (b) Preparing aquatic feed.

10. The application according to claim 9, characterized in that, The aquatic feed is an aquatic antibacterial feed, specifically using the transgenic Chlamydomonas strain as an aquatic feed or an aquatic feed component.

Images