Kit and method for simultaneously and rapidly identifying and detecting harassment apios and Zika virus carried by harassment apios based on RAA technology
Through the application of RAA technology, the problems of low efficiency and shortage of professional talents in mosquito population identification have been solved, rapid and accurate mosquito and Zika virus detection have been achieved, and identification efficiency and result stability have been improved.
Patent Information
- Application Number
- CN202311351700.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-18
- Publication Date
- 2025-07-18
AI Technical Summary
The prior art has problems such as long identification cycle, low efficiency, shortage of professional talents, difficulty in identifying complex populations and incomplete development stages in mosquito population identification, and molecular biological methods have the shortcomings of time-consuming, high cost and unstable results.
Recombinase-mediated strand replacement nucleic acid amplification (RAA) technology based on mitochondrial DNA cytochrome oxidase I gene and Zika virus NS5 gene was developed to develop a rapid identification and detection kit for mosquito identification and pathogen detection, and use specific amplification primers to perform simultaneous identification of mosquitoes and Zika viruses.
It improves the efficiency of mosquito molecular identification and pathogen detection, achieves safe, fast and accurate mosquito population identification, simplifies the operation process, and reduces the dependence on professional talents.
Smart Images
Figure CN120330337A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection, and particularly to a kit and method for simultaneously and rapidly identifying and detecting Ochlerotatus (Ochlerotatus) vexans and Zika virus carried thereby, based on the RAA technology. Background Art
[0002] The main method for identifying mosquito species at ports of entry is morphological identification, relying on port inspection and quarantine personnel with experience in morphological identification and the ability to identify mosquito morphology, and conducting identification according to the medical mosquito classification retrieval table. However, morphological identification faces many problems: there are few professional mosquito identification talents, and the personnel training cycle is long; factors such as the experience level, professional level, integrity and developmental stage of the mosquitoes can lead to a long identification cycle and low efficiency; it is difficult to identify some complex populations such as sibling species and homomorphic species; for mosquito eggs, larvae and pupae, in order to obtain reliable identification characteristics, mosquito artificial culture is often required before identification; if the number of mosquitoes submitted for inspection at the port is large, it is a very big test for the port mosquito identification work; and so on. Therefore, in addition to improving the identification ability of quarantine personnel and developing an identification assistance system, there is still a need to develop safe, rapid, accurate and sensitive identification methods to achieve rapid mosquito identification.
[0003] Traditional mosquito identification mainly relies on morphological identification. However, the morphological characteristics of vector organisms may be damaged during collection or storage, and not all developmental stages can be identified simultaneously. Therefore, only experienced morphological identification experts can accurately identify. In recent years, with the development of molecular biology techniques, molecular methods such as conventional PCR, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), single-strand conformation polymorphism (SSCP), and DNA barcoding technology have been applied to mosquito species identification. However, these identification methods all have deficiencies: conventional detection of specific PCR product sequences relies on relatively expensive molecular probes or product sequencing; RFLP identification of mosquito species is not only time-consuming but also requires a large number of samples; RAPD identification of mosquito species is rapid, but the results are unstable and sometimes non-repeatable; SSCP can only be used as a method for detecting mosquito gene mutations. To determine the position and type of mutations, further sequencing is required, and the electrophoresis conditions are relatively strict; the subsequent sequencing work of DNA barcoding technology is time-consuming and costly. In view of the deficiencies of the above methods, in order to safely, rapidly, accurately and sensitively achieve molecular identification of mosquito populations, new molecular identification means need to be explored. Summary of the Invention
[0004] The present invention provides a kit and method for simultaneously and rapidly identifying and detecting Ochlerotatus (Ochlerotatus) vexans and Zika virus carried thereby, based on the RAA technology.
[0005] The present invention is realized by the following technical solutions: The present invention applies the recombinase-aid amplification (RAA) technology based on the mitochondrial DNA cytochrome oxidase I gene (COI) and the Zika virus NS5 gene to mosquito identification and the detection of pathogens carried by mosquitoes.
[0006] The present invention first obtains a set of specific amplification primers for the rapid identification of Armigeres subalbatus and Zika virus carried by it based on the RAA technology, and the sequences are as follows: coi gene of mitochondrial genome: Armigeres subalbatus-f4: (forward 5-3) caactcttcatggaactcaatttacttatagaccagc; Armigeres subalbatus-r4: (reverse 5-3) ttgcgaatactgctcctattgataatacataatg; ns5 gene: Zika virus (zikv)-f6: (forward 5-3) tcacttacgctcttaacacatttaccaacctagt; Zika virus (zikv)-r6: (reverse 5-3) cttcacaacgcaatcatctccactgactgcca.
[0007] The present invention also provides a kit for the simultaneous rapid identification of Armigeres subalbatus and Zika virus carried by it based on the RAA technology, including the above primer sequences.
[0008] Compared with the existing detection means, the beneficial effects of the present invention are as follows: Traditional mosquito identification mainly relies on morphological identification. However, the morphological characteristics of vector organisms may be damaged during the collection or storage process, and not all developmental stages can be identified simultaneously. Therefore, only experienced morphological identification experts can accurately identify. The recombinase-aid amplification (RAA) technology based on the mitochondrial DNA cytochrome oxidase I gene (COI) and the Zika virus NS5 gene is applied to mosquito identification and the detection of pathogens carried by mosquitoes. Compared with traditional morphological identification methods and fluorescence PCR methods, it can greatly improve the efficiency of mosquito molecular identification and pathogen detection. Description of the Drawings
[0009] Figure 1 It is the specific result of the RAA detection method for Armigeres subalbatus.
[0010] Figure 2It is the specific result of the ZIKV RT-RAA detection method.
[0011] Figure 3 It is the sensitivity result of the Armigeres subalbatus RAA detection method.
[0012] Figure 4 It is the sensitivity result of the ZIKV RT-RAA detection method. Detailed implementation manners
[0013] The present invention will be further described below by using examples. Example 1
[0014] This example provides a set of specific amplification primers for the rapid identification of Armigeres subalbatus and Zika virus carried based on the RAA technology, and the sequences are as follows: Coi gene of mitochondrial genome: Armigeres subalbatus-f4: (forward 5-3) caactcttcatggaactcaatttacttatagaccagc; Armigeres subalbatus-r4: (reverse 5-3) ttgcgaatactgctcctattgataatacataatg; Ns5 gene: Zika virus (zikv)-f6: (forward 5-3) tcacttacgctcttaacacatttaccaacctagt; Zika virus (zikv)-r6: (reverse 5-3) cttcacaacgcaatcatctccactgactgcca.
[0015] Example 2 Specificity and sensitivity detection Nucleic acid extraction Use the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 (product number: 9766) kit to extract the mitochondrial genome nucleic acids of one hind leg of each of the mosquito species such as Aedes albopictus, Armigeres subalbatus, Anopheles sinensis, Aedes dorsalis, and Aedes stimulans, and extract the RNA nucleic acids of Zika virus (zikv), Chikungunya virus (chikv), Dengue virus (denv), Japanese encephalitis virus (jev), and Yellow fever virus (yfv).
[0016] RAA and RT-RAA detection steps Use the RAA nucleic acid amplification reagent (basic type) of Hangzhou Zhongce Biotechnology Co., Ltd. to amplify the DNA nucleic acids of each mosquito species, and use the RT-RAA nucleic acid amplification reagent (basic type) of Hangzhou Zhongce Biotechnology Co., Ltd. to amplify the RNA nucleic acids of each virus.
[0017] The specificity of the RAA or RT-RAA detection method for *Armigeres subalbatus* and Zika virus. The results are shown in the figure. The primers F4-R4 for *Armigeres subalbatus* ( Figure 1 ), and the primers F6-R6 for Zika virus ( Figure 2 ) showed good specificity compared to the corresponding controls.
[0018] The sensitivity of the RAA or RT-RAA detection method for *Armigeres subalbatus*, Zika virus. The results are shown in the figure. The primers F4-R4 for *Armigeres subalbatus* ( Figure 3 ), and the primers F6-R6 for Zika virus ( Figure 4 ). The mitochondrial genomic nucleic acid extracted from one hind leg of *Armigeres subalbatus* was serially diluted 10-fold. It can be seen from Figure 3 that its sensitivity can reach 10 -4 dilution. The Zika virus cultured in cells was serially diluted 10-fold. It can be seen from Figure 4 that their respective sensitivities can reach 10 -4 dilution.
[0019] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Those of ordinary skill in the art, within the scope of the essence of the present invention, any changes, modifications, additions or substitutions should fall within the protection scope of the present invention.
Claims
1. A specific amplification primer for rapid identification of harassing mosquitoes and Zika virus carriers based on RAA technology, characterized in that: The sequences are as follows: Armigeres subalbatus - F4: CAACTCTTCATGGAACTCAATTTACTTATAGACCAGC; Armigeres subalbatus - R4: TTGCGAATACTGCTCCTATTGATAATACATAATG; Zika virus (ZIKV) - F6: TCACTTACGCTCTTAACACATTTACCAACCTAGT; Zika virus (ZIKV) - R6: CTTCACAACGCAATCATCTCCACTGACTGCCA.
2. A kit for rapid identification of Argyi mosquitoes and Zika virus carriers based on RAA technology, characterized in that: It includes the primer sequences described in claim 1.