Methods of treating ulcerative colitis or primary sclerosing cholangitis
By specifically removing anti-integrin αvβ6 antibodies in patients with ulcerative colitis and primary sclerotic cholangitis, and using their competitive binding with fibronectin, the problem of major side effects of existing treatment methods is solved, and a safer and more effective treatment plan is provided.
Patent Information
- Application Number
- CN202380083510.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-05
- Filing Date
- 2023-12-05
- Publication Date
- 2025-07-18
AI Technical Summary
The existing treatment methods for ulcerative colitis and primary sclerotic cholangitis have problems such as having great side effects and incomplete cure, especially the treatment of anti-TNFα antibody has many side effects.
By removing or inhibiting the specific anti-integrin αvβ6 antibody produced in the patient, using the antibody to compete with fibronectin to neutralize its role in the disease, the treatment is performed using solid carrier or blood component separation technology that loads integrin αvβ6.
It reduces interference from normal functional molecules in healthy humans, reduces side effects, and provides new treatment methods to effectively treat ulcerative colitis and primary sclerotic cholangitis, avoiding the side effects of traditional treatments.
Smart Images

Figure CN120344280A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to methods, systems, etc. for treating ulcerative colitis (hereinafter, also referred to as "UC") or primary sclerosing cholangitis (hereinafter, also referred to as "PSC"). Background Art
[0002] Ulcerative colitis is a refractory disease of unknown etiology, in which erosions or inflammatory ulcers continuously occur in the large intestine mucosa from the rectum, accompanied by symptoms such as diarrhea, bloody stools, and abdominal pain. Ulcerative colitis occurs in people from young to old, with repeated remissions and relapses, so long-term treatment is required. The number of patients is very large and has been increasing worldwide in recent years.
[0003] In addition, primary sclerosing cholangitis is a progressive chronic liver disease in which multiple / diffuse fibrotic strictures occur in the intrahepatic and extrahepatic bile ducts, and about half of the patients progress to liver cirrhosis in 10 years. And in cases where primary sclerosing cholangitis progresses to liver cirrhosis, liver transplantation is required, but many patients die without being able to receive transplantation. Primary sclerosing cholangitis is considered to be a multifactorial disease including immunological abnormalities and its etiology is unknown. Primary sclerosing cholangitis often coexists with inflammatory bowel disease (hereinafter, also referred to as "IBD"), and ulcerative colitis also coexists in a certain proportion of patients with primary sclerosing cholangitis (it is reported that about 40% of patients with primary sclerosing cholangitis in Japan coexist with ulcerative colitis, especially about 60% of young patients with primary sclerosing cholangitis coexist with ulcerative colitis. In addition, it is reported that about 70 - 80% of patients with primary sclerosing cholangitis in Europe and America coexist with ulcerative colitis.).
[0004] In the medical treatment of ulcerative colitis, depending on the severity of the symptoms, 5-aminosalicylic acid preparations are used in mild cases, immunosuppressants such as steroids are used in moderate cases, blood component removal therapy, biological agents such as anti-TNFα antibodies, JAK inhibitors, etc. are used in moderate to severe cases (for example, regarding anti-TNFα antibodies, refer to Non-Patent Document 1, website name: UpToDate, [searched on November 28, 2022], Internet <URL: https: / / www.uptodate.com / contents / search?search=%E6%BD%B0%E7%98%8D%E6%80%A7%E5%A4%A7%E8%85%B8%E7%82%8E%E3%80%80TNF&sp=0&searchType=PLAIN_TEXT&source=USER_INPUT&searchControl=TOP_PULLDOWN&searchOffset=1&autoComplete=false&language=ja&max=10&index=&autoCompleteTerm=>). However, ulcerative colitis cannot be completely cured in medical treatment. In addition, various side effects are associated with the therapeutic agents. For example, when taking the anti-TNFα antibody used in moderate to severe ulcerative colitis as an example, when the function of TNFα is inhibited with the anti-TNFα antibody in the treatment of ulcerative colitis, side reactions such as infections and the expression of malignant tumors occur. Indeed, the anti-TNFα antibody can show a therapeutic effect on ulcerative colitis. However, since the targeted TNFα itself plays a central role in the immune system in a wide range such as infection defense and anti-tumor effects and supports biological functions, if the TNFα required for the normal state is damaged, the above-mentioned various side reactions occur.
[0005] In addition, in the medical treatment of primary sclerosing cholangitis, agents such as ursodeoxycholic acid are administered, but currently, there is not enough data on whether the long-term prognosis has been improved. Therefore, new treatment methods are urgently needed.
[0006] Prior Art Documents
[0007] Non-Patent Documents
[0008] Non-Patent Document 1: Nature Reviews Immunology volume 15, pages362-374 (2015) Summary of the Invention
[0009] Problems to be Solved by the Invention
[0010] Accordingly, an object of the present invention is to develop a new treatment method for ulcerative colitis or primary sclerosing cholangitis that suppresses side reactions compared to conventional methods.
[0011] Means for Solving the Problem
[0012] The inventors conducted in-depth research to solve the above problems and, surprisingly, found that anti-integrin αvβ6 autoantibodies specifically produced in patients with ulcerative colitis and primary sclerosing cholangitis are involved in the pathogenesis of these diseases, and that these diseases can be treated by targeting these autoantibodies, thereby completing the present invention.
[0013] The present invention provides the following aspects.
[0014] (1) A treatment system for ulcerative colitis or primary sclerosing cholangitis, which comprises a unit for removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, wherein the anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0015] (2) The system according to (1), wherein the unit comprises a substance that specifically binds to the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cells.
[0016] (3) The system according to (2), wherein the substance is a fragment or all of the integrin αvβ6 protein.
[0017] (4) The system according to (3), which comprises a column loaded with a fragment or all of the integrin αvβ6 protein.
[0018] (5) A solid carrier for treating ulcerative colitis or primary sclerosing cholangitis, which is loaded with a fragment or all of the integrin αvβ6 protein that can specifically bind to the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, thereby being able to adsorb the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cells, wherein the anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0019] (6) The solid support described in (5), wherein, in the case of the anti-integrin αvβ6 antibody whose fragment or all of the aforementioned integrin αvβ6 protein contains a sequence of amino acid residues of any one of RGD, RGRD, and / or RGSGD in CDR2 or CDR3 of the heavy chain, the binding dissociation constant (KD value) is 100 nM or less.
[0020] (7) The solid support described in (5) or (6), wherein the aforementioned integrin αvβ6 protein is immobilized in an amount of 2 times the weight or more of the capture antibody, or the fragment of the aforementioned αvβ6 protein is immobilized in an amount of 2 times the weight of the capture antibody multiplied by the ratio of the aforementioned fragment to the molecular weight of the entire integrin αvβ6.
[0021] (8) A column comprising the solid support described in any one of (5) to (7).
[0022] (9) The column described in (8), which comprises the aforementioned solid support in such a manner that the amount of the fragment or all of the aforementioned integrin αvβ6 protein per column satisfies the following: the amount of the aforementioned integrin αvβ6 protein is 2 times the weight or more of the capture antibody, or the amount of the fragment of the aforementioned αvβ6 protein is 2 times the weight of the capture antibody multiplied by the ratio of the aforementioned fragment to the molecular weight of the entire integrin αvβ6.
[0023] (10) The column described in (8) or (9), which is used for blood component separation (apheresis).
[0024] (11) A method for preparing a primary sclerosing cholangitis model animal, which includes the step of immunizing a non-human animal with a fragment or all of the integrin αvβ6 protein.
[0025] (12) A method for preparing a primary sclerosing cholangitis model animal, which includes the step of knocking out the integrin β6 gene in a non-human animal.
[0026] (13) A method for preparing a ulcerative colitis or primary sclerosing cholangitis model animal, which includes the step of administering an anti-integrin αvβ6 antibody derived from a patient with ulcerative colitis or primary sclerosing cholangitis to a non-human animal.
[0027] (14) The preparation method described in (13), wherein the aforementioned antibody is serum or a monoclonal antibody.
[0028] (15) A ulcerative colitis model animal having the symptoms of ulcerative colitis.
[0029] (16) A primary sclerosing cholangitis model animal having the symptoms of primary sclerosing cholangitis.
[0030] The primary sclerosing cholangitis model animal described in (17)(16) is a knockout mouse lacking the function of integrin αvβ6.
[0031] (18) A method for screening a therapeutic or prophylactic agent for ulcerative colitis or primary sclerosing cholangitis, which comprises the step of administering a candidate substance to the model animal according to any one of (15) to (17).
[0032] (19) A method for treating ulcerative colitis or primary sclerosing cholangitis, which comprises the step of removing an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cell that produces the anti-integrin αvβ6 antibody, wherein the anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0033] (20) A method for removing an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cell that produces the anti-integrin αvβ6 antibody from a subject, which comprises the step of bringing a substance that specifically binds to the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cell that produces the anti-integrin αvβ6 antibody into contact with a sample derived from the subject, wherein the anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0034] Advantages of the Invention
[0035] In the present invention, it has surprisingly been found that the presence of anti-integrin αvβ6 autoantibody is involved in the pathogenesis of ulcerative colitis and primary sclerosing cholangitis. Therefore, according to the present invention, by removing the anti-integrin αvβ6 autoantibody and the B cells that produce the antibody in patients with ulcerative colitis or primary sclerosing cholangitis, patients with ulcerative colitis or primary sclerosing cholangitis can be treated. In addition, in the present invention, a treatment system for patients with ulcerative colitis or primary sclerosing cholangitis that can be used in this treatment is provided.
[0036] Since the present invention is based on a concept completely different from the conventional standard usage, it provides a new treatment unit for patients who have not seen an effect with the conventional treatment methods. Since existing therapeutic agents for ulcerative colitis (e.g., anti-TNFα antibodies, etc.) target molecules that also exist in healthy individuals, they have large side effects. However, the anti-integrin αvβ6 autoantibody targeted in the present invention does not exist or hardly exists in healthy individuals, so even if it is eliminated, it does not affect health, and thus it is considered to have few side effects. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 Results of a fibronectin-integrin αvβ6 binding inhibition assay showing autoantibodies derived from patients with primary sclerosing cholangitis. The vertical axis shows the binding inhibition rate (%).
[0038] Figure 2 Dose-dependent inhibition of fibronectin-integrin αvβ6 binding by autoantibodies derived from patients with primary sclerosing cholangitis. The vertical axis shows the binding inhibition rate (%). The horizontal axis shows the dilution rate of patient- or control-derived IgG used in the assay.
[0039] Figure 3 Shows the correlation between the titer of autoantibodies derived from patients with primary sclerosing cholangitis and the fibronectin-integrin αvβ6 binding inhibitory activity.
[0040] Figure 4 Results of a binding inhibition assay of autoantibodies derived from patients with primary sclerosing cholangitis and integrin αvβ6 by addition of RGDS peptide. The vertical axis shows the titer of autoantibodies detected on the solid phase (A 450 ). The horizontal axis shows the amount of peptide added (μg / mL).
[0041] Figure 5 Results of a binding inhibition assay of autoantibodies derived from patients with primary sclerosing cholangitis and integrin αvβ6 by addition of RGES peptide. The vertical axis shows the titer of autoantibodies detected on the solid phase (A 450 ). The horizontal axis shows the amount of peptide added (μg / mL).
[0042] Figure 6 Shows the integrin αvβ6-fibronectin binding inhibitory effect by monoclonal anti-integrin αv6β antibodies derived from patients with ulcerative colitis or primary sclerosing cholangitis. In the figure, "UC antibody 1", "UC antibody 2", "UC antibody 3", "UC antibody 4", "UC antibody 5", "UC antibody 6", "UC antibody 7" and "UC antibody 8" represent 8 monoclonal anti-integrin αvβ6 antibodies established from the blood of UC patients. "PSC antibody 1" represents a monoclonal anti-integrin αvβ6 antibody established from the blood of PSC patients.
[0043] Figure 7 Are micrographs of bile ducts in integrin αvβ6-immunized mice and control-immunized mice.
[0044] Figure 8 Are micrographs of bile ducts in integrin αvβ6-immunized mice administered various depletion antibodies.
[0045] Figure 9 is a microscopic photograph of the bile duct in a mouse lacking the function of integrin αvβ6.
[0046] Figure 10 shows the concentration-dependent adsorption rate of a column loaded with integrin αvβ6.
[0047] Figure 11 shows the adsorption rate of antibodies in the serum of patients with ulcerative colitis in a column loaded with integrin αvβ6.
[0048] Figure 12 shows the adsorption rate of antibodies in the serum of patients with primary sclerosing cholangitis in a column loaded with integrin αvβ6.
[0049] Figure 13 shows the results of a ligand protein specificity confirmation test for monoclonal anti-integrin αvβ6 autoantibodies derived from patients with ulcerative colitis.
[0050] Figure 14 shows the adsorption rates of monoclonal autoantibodies derived from patients with ulcerative colitis and autoantibodies derived from the serum of patients with ulcerative colitis in an integrin αvβ6-fixed carrier by the NHS covalent binding method.
[0051] Figure 15 shows the adsorption rate of monoclonal autoantibodies derived from patients with ulcerative colitis in an integrin αvβ6-fixed carrier by the avidin-biotin binding method.
[0052] Figure 16 shows a comparison of the adsorption amounts of monoclonal anti-integrin αv6β autoantibodies derived from patients with ulcerative colitis in integrin αvβ6 fixed by the avidin-biotin binding method and integrin αvβ6 fixed by the covalent binding method.
[0053] Figure 17 shows an overview of an example of a circulating column system.
[0054] Figure 18-1 shows the adsorption rate of anti-integrin αvβ6 antibodies in a circulating column filled with an integrin αvβ6-fixed adsorption material.
[0055] Figure 18-2 shows the adsorption rate of anti-integrin αvβ6 antibodies in a circulating column filled with a BSA-fixed adsorption material.
[0056] Figure 19 is a microscopic photograph of the large intestine of a mouse administered with the serum of UC patients and PSC patients.
[0057] Figure 20 are microscopic photographs of the bile ducts of mice administered with sera from UC patients and sera from PSC patients.
[0058] Figure 21 are microscopic photographs of the large intestines of DSS-administered mice administered with sera from UC patients and sera from PSC patients.
[0059] Figure 22 are microscopic photographs of the bile ducts of DSS-administered mice administered with sera from UC patients and sera from PSC patients.
[0060] Figure 23 are microscopic photographs of the large intestines of mice administered with anti-integrin αvβ6 monoclonal antibodies derived from UC patients.
[0061] Figure 24 are microscopic photographs of the large intestines of DSS-administered mice administered with anti-integrin αvβ6 monoclonal antibodies derived from UC patients. Detailed Description of the Invention
[0062] The inventors have shown in previous studies that anti-integrin αvβ6 antibodies are specifically produced in patients with ulcerative colitis or primary sclerosing cholangitis (International Publication No. WO2020 / 141608). It is known that integrin αvβ6 binds to ligands such as fibronectin by recognizing the RGD tripeptide motif. Further, in previous studies by the inventors, it was shown that in in vitro experiments by the ELISA method, the binding of integrin αvβ6 to fibronectin was inhibited concentration-dependently by the addition of autoantibodies derived from ulcerative colitis patients, that this inhibitory activity was correlated with the titer of anti-integrin αvβ6 antibodies derived from these patients, and that the binding of these patient-derived autoantibodies to integrin αvβ6 was inhibited concentration-dependently by RGD peptides (Gastroenterology Vol. 160, No. 7, June 2021, Pages 2383-2394).
[0063] Therefore, in the present case, the inventors established the following hypothesis: the binding of integrin αvβ6 expressed in the epithelial cell layer of the large intestine or bile duct to fibronectin in the connective tissue layer via the RGD tripeptide motif is inhibited by anti-integrin αvβ6 autoantibodies, which causes ulcerative colitis or primary sclerosing cholangitis, and investigated the etiology of these diseases. In the present invention, it was actually clarified that anti-integrin αvβ6 autoantibodies derived from patients with ulcerative colitis and primary sclerosing cholangitis contain an RGD tripeptide motif or a similar sequence in the complementarity-determining region (CDR) that forms the antigen-binding site, that is, the epitope of this antibody is located in the RGD-binding site of integrin αvβ6 (Example 2). Further, regarding the autoantibodies derived from patients with primary sclerosing cholangitis, it was clarified that they inhibit the binding of integrin αvβ6 to fibronectin in a concentration-dependent manner, that this inhibitory activity is correlated with the titer of anti-integrin αvβ6 antibodies derived from these patients, and that the binding of the autoantibodies derived from these patients to integrin αvβ6 is inhibited in a concentration-dependent manner by RGD peptides (Example 1). It was further clarified that primary sclerosing cholangitis develops by inducing the production of anti-integrin αvβ6 antibodies by immunizing mice with integrin αvβ6, and that this pathological condition is alleviated by antibody removal (Example 3). Further, integrin αvβ6 gene knockout mice were also prepared, and findings consistent with primary sclerosing cholangitis were confirmed (Example 4). Thus, in the present invention, it was found that anti-integrin αvβ6 antibodies are involved in the pathogenesis of ulcerative colitis and primary sclerosing cholangitis. Based on this knowledge, the present invention provides a technique characterized by removing anti-integrin αvβ6 antibodies or anti-integrin αvβ6 antibody-producing B cells that produce such anti-integrin αvβ6 antibodies, wherein the anti-integrin αvβ6 antibodies have an activity of competing with fibronectin in binding to integrin αvβ6 and are specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis.
[0064] <1. Subject>
[0065] The subject to which the present invention is applicable is an animal suffering from ulcerative colitis or primary sclerosing cholangitis and in need of treatment. Preferably, the subject is an animal that is positive for anti-integrin αvβ6 antibodies in the blood (an animal that produces anti-integrin αvβ6 antibodies in vivo). More preferably, the subject is an animal that is positive for anti-integrin αvβ6 antibodies in the blood and has not been improved by other treatment methods (for example, conventional treatment methods). The species of this animal is not particularly limited, and it can be a human or other non-human mammals, but a human is preferred.
[0066] <2. Anti-integrin αvβ6 Antibody>
[0067] Integrin is a protein composed of heterodimeric molecules in its natural form. The heterodimeric molecule consists of two subunit chains, an α-chain and a β-chain. As the α-chain, α1-α11, αv, αX, αM, αL, αD, αE, αIIb are known, and as the β-chain, β1-β8 are known. There are multiple different isotypes in their combinations. Integrin exists on the surface of epithelial cells and binds to laminin, fibronectin, etc., which are extracellular matrix proteins on the surface of connective tissues, and plays an important role in cell adhesion.
[0068] Integrin αvβ6 is composed of a heterodimeric molecule containing αv as the α-chain and β6 as the β-chain. Integrin αvβ6 is hardly expressed in normal tissues and is expressed on the surface of epithelial cells during inflammatory stimuli, etc.
[0069] The "anti-integrin αvβ6 antibody" in this specification refers to an antibody that specifically binds to integrin αvβ6 or its fragment.
[0070] Therefore, the anti-integrin αvβ6 antibody to be removed in the present invention is an anti-integrin αvβ6 antibody specifically produced in a subject with ulcerative colitis or primary sclerosing cholangitis. The aforementioned anti-integrin αvβ6 antibody is an autoantibody. The anti-integrin αvβ6 autoantibody does not exist or hardly exists in healthy individuals.
[0071] Furthermore, the aforementioned anti-integrin αvβ6 antibody has the activity of competing with fibronectin in binding to integrin αvβ6. That is, the aforementioned anti-integrin αvβ6 antibody is an antibody that specifically binds to integrin αvβ6 and inhibits the binding of this integrin αvβ6 to fibronectin. The "inhibition" in this specification includes inhibition, reduction, or loss.
[0072] The aforementioned anti-integrin αvβ6 antibody preferably inhibits or suppresses the binding of integrin αvβ6 to fibronectin via the RGD tripeptide motif of fibronectin. More preferably, the aforementioned anti-integrin αvβ6 antibody is an antibody that binds to an epitope containing an RGD binding domain on integrin αvβ6.
[0073] Furthermore, more preferably, the aforementioned anti-integrin αvβ6 antibody contains an RGD peptide sequence or a sequence similar thereto. Examples of sequences similar to the RGD peptide include, but are not limited to, RGRD (SEQ ID NO: 7), RGSGD (SEQ ID NO: 8), RED, KGD, SGD, etc. The aforementioned RGD peptide sequence or a sequence similar thereto is preferably contained in the complementarity-determining region (CDR) of the heavy chain and / or light chain of the aforementioned anti-integrin αvβ6 antibody, more preferably in CDR2 or CDR3 of the heavy chain and / or light chain, particularly preferably contained in CDR2 or CDR3 of the heavy chain, and further preferably in CDR3 of the heavy chain. For example, the aforementioned anti-integrin αvβ6 antibody contains a heavy chain CDR3 containing the sequence shown by AKVIPRIRGSGDKAGIKDYYYYGMDV (SEQ ID NO: 3), ATDRPLKLRGRDYNYYVMDV (SEQ ID NO: 4), AKDRGRRGDSGWYRHFDY (SEQ ID NO: 5), or ARDRGFRGDTAMIKGGMDV (SEQ ID NO: 6).
[0074] The dissociation constant (KD value) of the aforementioned anti-integrin αvβ6 antibody for binding to integrin αvβ6 or a fragment thereof is preferably 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. The anti-integrin αvβ6 antibody preferably containing an RGD peptide sequence or a sequence similar thereto, more preferably contained in CDR2 or CDR3 of the heavy chain or light chain, particularly preferably contained in CDR2 or CDR3 of the heavy chain, and further preferably contained in CDR3 of the heavy chain binds to integrin αvβ6 or a fragment thereof with a KD value of, for example, 100 nM or less, preferably 50 nM or less, and more preferably 25 nM or less. Further, the aforementioned anti-integrin αvβ6 antibody preferably exhibits the property of capturing with an adsorption rate of 50% or more for integrin αvβ6 having a weight of 2 times or more the weight of the capture antibody, or for a fragment thereof having a weight of 2 times the weight of the capture antibody multiplied by the ratio of the integrin αvβ6 protein fragment to the total molecular weight of integrin αvβ6. In addition, the "adsorption rate" in this specification is the ratio of the amount of antigen-bound antibody to the amount of antibody added in the antigen-antibody reaction system. For example, the amount of free antibody (the amount of antibody not bound to the antigen) after adding the antibody to the reaction system containing the antigen can be measured, and the ratio of the amount of antibody bound to the antigen to the amount of antibody added to the aforementioned reaction system can be determined. It is known that the integrin αvβ6 antibody in the sera of UC and PSC patients is about 5 - 10 μg / mL. In the case of using it for patients with a high antibody titer in the clinical situation, it can also be dealt with by using a larger amount of the adsorption material.
[0075] <3. Anti-integrin αvβ6 antibody-producing B cells>
[0076] As used herein, "anti-integrin αvβ6 antibody-producing B cells" refers to B cells that produce the aforementioned anti-integrin αvβ6 antibody. Antibody-producing B cells express on their cell surface a B cell antigen receptor (membrane immunoglobulin) having the same structure as the antibody. Thus, anti-integrin αvβ6 antibody-producing B cells express the membrane form of the aforementioned anti-integrin αvβ6 antibody. Accordingly, any substance that specifically binds to the anti-integrin αvβ6 antibody specifically binds to anti-integrin αvβ6 antibody-producing B cells.
[0077] <4. Method for treating ulcerative colitis or primary sclerosing cholangitis>
[0078] The treatment method of the present invention includes the step of removing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, wherein the aforementioned anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0079] As used herein, "removal" of the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells means that the aforementioned antibody or B cells are removed from the body of the subject. For example, if they are in the blood, a part or all of the aforementioned antibody or B cells present in the blood are removed from the blood.
[0080] The removal of the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells can be carried out by any method. To remove the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, for example, a substance that specifically binds to the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells (hereinafter, also collectively referred to as "substances that specifically bind to the anti-integrin αvβ6 antibody") can be applied. The substance that specifically binds to the anti-integrin αvβ6 antibody is a substance that specifically binds to the antigen receptor of the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells and inhibits the binding of the antigen receptor of the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells to endogenous integrin αvβ6.
[0081] Examples of the aforementioned substances that specifically bind to the anti-integrin αvβ6 antibody include, but are not limited to, the antigen of the aforementioned antibody or B cells, i.e., integrin αvβ6 or a fragment thereof, an antigen-like protein or a fragment thereof, a peptide that specifically binds to the anti-integrin αvβ6 antibody, a compound that specifically binds to the anti-integrin αvβ6 antibody, and the like.
[0082] In order to remove anti-integrin αvβ6 antibodies or B cells that produce anti-integrin αvβ6 antibodies, for example, a solid carrier immobilized with the aforementioned substance that specifically binds to the anti-integrin αvβ6 antibody can be applied. As the solid carrier, for example, beads, fibers, membranes, hollow fiber membranes, gels, thin films, shapes formed by combining these, etc. formed from carbohydrate materials such as agarose, dextran, cellulose, activated carbon, synthetic polymers such as polymethacrylate, polystyrene, polyacrylamide, polyamide, polysulfone, polyethylene, polyvinyl alcohol, polypropylene, polyacrylonitrile, polyethylene terephthalate, polyester, styrene / divinylbenzene copolymer, ethylene-vinyl alcohol copolymer, inorganic materials such as silica gel, glass, metal, composite materials added with metal, etc. are listed, but are not limited thereto. Commercially available solid carriers can also be applied. The immobilization of the aforementioned substance to the solid carrier can be carried out by methods known in the art such as physical adsorption method, covalent bonding method, ionic bonding method, chelating bonding method, avidin-biotin bonding method, etc. For example, as the covalent bonding method, methods using active groups such as cyanate ester, NHS (N-hydroxysuccinimide) ester, aldehyde, formyl, azalactone, CDI (carbonyldiimidazole), mercapto group, carbonyl group, carboxyl group, active hydrogen, epoxy group, EAH (epoxy-activated hexahydrophthalic anhydride), ECH (epoxy-activated cyclohexane), thiopropyl group, activated thiol, etc. are listed. For example, in the avidin-biotin bonding method, in addition to avidin, avidin-like substances or modified avidin such as streptavidin, deglycosylated avidin (NeutrAvidin (registered trademark)), reversible avidin (Switchavidin), monomeric avidin (Monomeric avidin, SAvPhire (registered trademark) monomeric streptavidin), mushroom-derived avidin-like protein (Tamavidin (registered trademark) 2-REV), genetically modified streptavidin, or genetically modified avidin can also be used. Further, the solid carrier immobilized with the substance that specifically binds to the anti-integrin αvβ6 antibody can be filled in columns, blood bags, and other bags.
[0083] Depletion of the anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody can be carried out by contacting a sample derived from a subject, such as the blood of the subject (e.g., whole blood, serum or plasma, preferably plasma) with the substance that specifically binds to the anti-integrin αvβ6 antibody. Preferably, it can be carried out by contacting a sample derived from a subject with a solid support on which the substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized. For example, by applying a column filled with a solid support on which the substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized, the anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody in the blood of the subject can be removed by adsorption to the column. The blood from which the anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody have been removed is preferably returned to the subject again.
[0084] Therefore, as an example of the treatment method of the present invention, a blood component separation therapy for treating ulcerative colitis or primary sclerosing cholangitis is cited, which includes the steps of collecting blood from a subject, treating the blood with the aforementioned column, and then returning it to the subject.
[0085] In addition, as another aspect of the present invention, a method for removing the anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody from the aforementioned sample is provided, which includes the step of contacting a sample derived from a subject with the substance that specifically binds to the anti-integrin αvβ6 antibody.
[0086] <5. Fragments or all of integrin αvβ6>
[0087] The origin of the fragment or the whole of integrin αvβ6 used in the present invention is not particularly limited, and preferably the same species as the subject. The base sequence information of the genes encoding the αv chain and β6 chain of integrin in mammalian species such as humans and the amino acid sequence information of each chain can be obtained from publicly known databases (GenBank, etc.). In particular, the amino acid sequence of the preproprotein of human integrin αv chain isoform 1 is registered as GenBank Accession Number NP_002201.2 and is shown in SEQ ID NO: 1. The amino acid sequence of the precursor of human integrin β6 chain is registered as GenBank Accession Number NP_000879.2 and is shown in SEQ ID NO: 2. The amino acid sequence information of the αv chain and β6 chain of various mammalian species other than humans can also be obtained from publicly known databases (GenBank, etc.). The αv chain and β6 chain containing the amino acid sequence formed by further undergoing post-translational modification of one or both of the αv chain and β6 chain registered in the database can constitute integrin αvβ6. For example, the partial sequence from the 1st to the 30th positions in the amino acid sequence of SEQ ID NO: 1 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of human integrin αv chain contains the sequence from the 31st to the 1048th positions in the amino acid sequence of SEQ ID NO: 1. Similarly, the partial sequence from the 1st to the 21st positions in the amino acid sequence of SEQ ID NO: 2 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of human integrin β6 chain contains the sequence from the 22nd to the 788th positions in the amino acid sequence of SEQ ID NO: 2. In addition, in the amino acid sequence of human integrin αv chain shown in SEQ ID NO: 1, respectively, the 31st to 992nd positions correspond to the extracellular region, the 993rd to 1016th positions correspond to the transmembrane region, and the 1017th to 1048th positions correspond to the intracellular region. Furthermore, in the amino acid sequence of human integrin β6 chain shown in SEQ ID NO: 2, respectively, the 22nd to 707th positions correspond to the extracellular region, the 708th to 730th positions correspond to the transmembrane region, and the 731st to 788th positions correspond to the intracellular region.
[0088] In the present specification, unless otherwise specified, the fragment or the whole of integrin αvβ6 is collectively referred to as "integrin αvβ6". Further, in the case of no special indication, integrin αvβ6 in the present specification is not limited to the natural type containing the mature or immature amino acid sequence, and may also be a variant in an equivalent form to the natural integrin αvβ6.
[0089] In addition, integrin αvβ6 is not limited to the form containing the full length of the α chain and β chain of the natural type or variant containing the mature or immature amino acid sequence (i.e., the whole of integrin αvβ6), and may also be in the form of a fragment of integrin αvβ6.
[0090] Fragments or the whole of integrin αvβ6 may have biotin attached to the following: those in which other peptides are attached to the fragments or the whole of integrin αvβ6 (e.g., those attached to the C-terminal side), or those in which other peptides are attached to the fragments, the whole, or all of the individual chains of integrin αvβ6 (e.g., those attached to the C-terminal side). As other peptides, for example, coiled-coil sequences (e.g., acidic tail sequences or basic tail sequences), tag (or marker) sequences, etc. are listed, but are not limited thereto. These other peptides are used, for example, for the purpose of facilitating dimerization, purification, or immobilization on a carrier in the preparation of fragments or the whole of integrin αvβ6. The aforementioned other peptides may be attached via a linker sequence. As the linker sequence, those skilled in the art can appropriately select. For example, a peptide linker composed of about 1 to 10 amino acids such as GGGGSGGGGS containing glycine and serine or about 2 to 5 such as GGGGS can be used, but is not limited thereto.
[0091] As fragments of integrin αvβ6, those in which at least one of the αv chain and the β6 chain constituting the dimer of integrin is shorter than the mature or immature native form or its variant are listed. For example, integrin αvβ6 fragments containing the extracellular region of the αv chain or the β6 chain are listed. Therefore, specifically, a dimer in which the αv chain containing the partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence of the αv chain shown in SEQ ID NO: 1 is used as the αv chain, and / or the β6 chain containing the partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence of the β6 chain shown in SEQ ID NO: 2 is used as the β6 chain can be exemplified as a fragment of integrin αvβ6. Fragments of the αv chain or the β6 chain may contain a signal sequence. Therefore, as another example of a fragment of integrin αvβ6, a dimer in which the αv chain containing the partial sequence from Met at position 1 to Val at position 992 in the amino acid sequence of the αv chain shown in SEQ ID NO: 1 is used as the αv chain, and / or the β6 chain containing the partial sequence from Met at position 1 to Asn at position 707 in the amino acid sequence of the β6 chain shown in SEQ ID NO: 2 is used as the β6 chain is listed. Fragments of integrin αvβ6 preferably form dimers, and more preferably have binding activity to extracellular matrix proteins such as laminin and fibronectin. The binding activity of fragments of integrin αvβ6 to extracellular matrix proteins can be confirmed, for example, by ELISA method.
[0092] That the whole or its fragments of integrin αvβ6 form dimers can be confirmed, for example, as follows: when the whole or its fragments of integrin αvβ6 are supplied to SDS-PAGE in the absence of 2-mercaptoethanol, a band corresponding to the molecular weight of the dimer can be detected, and when supplied to SDS-PAGE in the presence of 2-mercaptoethanol, the band corresponding to the molecular weight of the dimer disappears.
[0093] As the commercially available integrin αvβ6, recombinant human integrin αvβ6 (R&D Systems, Minnesota, USA, product number 3817-AV) can be exemplified. This recombinant human integrin αvβ6 is a dimer composed of an αv chain consisting of a partial sequence of Phe at position 31 to Val at position 992 in the amino acid sequence of the αv chain shown in SEQ ID NO: 1, a linker sequence and an acidic tail sequence attached to its C-terminus, and a β6 chain consisting of a partial sequence of Gly at position 22 to Asn at position 707 in the amino acid sequence of the β6 chain shown in SEQ ID NO: 2, a linker sequence and a basic tail sequence attached to its C-terminus.
[0094] As a more specific embodiment of the αv chain that constitutes a fragment or all of integrin αvβ6, the following polypeptides are listed:
[0095] (I) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or a partial sequence of the amino acid sequence shown in SEQ ID NO: 1 from Phe at position 31 to Thr at position 1048,
[0096] (II) A polypeptide comprising a partial sequence of the amino acid sequence shown in SEQ ID NO: 1 and being functionally equivalent to the polypeptide of (I),
[0097] (III) A polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 1 or a partial sequence thereof and being functionally equivalent to the polypeptide of (I), and
[0098] (IV) A polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, and / or added in the amino acid sequence shown in SEQ ID NO: 1 or a partial sequence thereof and being functionally equivalent to the polypeptide of (I).
[0099] The polypeptides of the foregoing (I) to (IV) may be polypeptides containing the following amino acid sequences: in the amino acid sequence or partial sequence defined in the foregoing (I) to (IV), an amino acid sequence in which at least one, preferably on the C-terminal side, of other amino acid sequences is further added on the N-terminal side and the C-terminal side.
[0100] Among the aforementioned (II), (III), and (IV), polypeptides functionally equivalent to the polypeptide of (I) may include, for example, polypeptides that can form a dimer with the integrin β6 chain (specifically preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 2, a polypeptide chain consisting of a partial sequence from Gly at position 22 to Cys at position 788 in the amino acid sequence shown in SEQ ID NO: 2, or a polypeptide chain consisting of a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2), and the formed dimer has the ability to bind to extracellular matrix proteins that can bind to natural integrin αvβ6 such as laminin and fibronectin or commercially available integrin αvβ6.
[0101] As the partial sequence in the aforementioned (II), a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1 is listed. As the partial sequences in the aforementioned (III) and (IV), a partial sequence from Phe at position 31 to Thr at position 1048 in the amino acid sequence shown in SEQ ID NO: 1, or a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1 is listed.
[0102] The sequence identity in the aforementioned (III) is preferably 90% or more, more preferably 95% or more, still more preferably 96% or more, particularly preferably 97% or more, most preferably 98% or more, or 99% or more.
[0103] In the aforementioned (IV), "one or more" is, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, preferably 1.
[0104] As a more specific embodiment of the β6 chain constituting a fragment or the whole of integrin αvβ6, polypeptides selected from the following are listed:
[0105] (V) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or a partial sequence from Gly at position 22 to Cys at position 788 in the amino acid sequence shown in SEQ ID NO: 2,
[0106] (VI) A polypeptide comprising a partial sequence of the amino acid sequence shown in SEQ ID NO: 2 and functionally equivalent to the polypeptide of (V),
[0107] (VII) A polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2 or a partial sequence thereof and functionally equivalent to the polypeptide of (V), and
[0108] (VIII) A polypeptide that contains the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence in which one or more amino acids are substituted, deleted, and / or added in a partial sequence thereof, and is functionally equivalent to the polypeptide of (V).
[0109] The polypeptides of the foregoing (V) to (VIII) may be polypeptides containing the following amino acid sequences: in the amino acid sequences or partial sequences defined in the foregoing (V) to (VIII), an amino acid sequence in which at least one, preferably on the C-terminal side, of other amino acid sequences is further added on the N-terminal side and the C-terminal side.
[0110] Among the foregoing (VI), (VII), and (VIII), polypeptides functionally equivalent to the polypeptide of (V) may include the following polypeptides: those capable of forming a dimer with the integrin αv chain (particularly preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 1, a polypeptide chain consisting of a partial sequence from Phe at position 31 to Thr at position 1048 in the amino acid sequence shown in SEQ ID NO: 1, or a polypeptide chain consisting of a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1), and the formed dimer has the ability to bind to extracellular matrix proteins that can bind to natural integrin αvβ6 such as laminin and fibronectin or commercially available integrin αvβ6.
[0111] As the partial sequence in the foregoing (VI), a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2 is listed. As the partial sequences in the foregoing (VII) and (VIII), a partial sequence from Gly at position 22 to Cys at position 788 in the amino acid sequence shown in SEQ ID NO: 2 or a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2 is listed.
[0112] The sequence identity of the amino acid sequence in the foregoing (VII) is preferably 90% or more, more preferably 95% or more, further more preferably 96% or more, particularly preferably 97% or more, most preferably 98% or more, or 99% or more.
[0113] In the foregoing (VIII), "one or more" is, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, preferably 1.
[0114] In the foregoing (III) and (VII), the sequence identity of the amino acid sequence can be determined using methods well known to those skilled in the art, sequence analysis software, etc. As sequence analysis software, for example, the blastp program of the BLAST algorithm and the fasta program of the FASTA algorithm are listed.
[0115] <6. System for treating ulcerative colitis or primary sclerosing cholangitis>
[0116] The system of the present invention is a system for treating ulcerative colitis or primary sclerosing cholangitis, which comprises a unit for removing an anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, wherein the anti-integrin αvβ6 antibody has an activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.
[0117] The "system" in this specification includes a single device, a combination of multiple devices, a treatment chamber, etc.
[0118] The "unit" for removing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells can be any unit as long as it can remove the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, and there is no particular limitation. For example, the unit may include a substance for removing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, but is not limited thereto.
[0119] As the substance for removing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, for example, a substance that specifically binds to the anti-integrin αvβ6 antibody as described above is listed. For example, the unit may be a device for adsorbing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells.
[0120] The substance that specifically binds to the anti-integrin αvβ6 antibody can be immobilized on a solid support. The solid support immobilized with the substance that specifically binds to the anti-integrin αvβ6 antibody can be further packed in a column. The amount of the solid support packed in the column, the amount of the substance that specifically binds to the anti-integrin αvβ6 antibody immobilized, and the size of the column are not particularly limited and can be appropriately selected by those skilled in the art. As the substance that specifically binds to the anti-integrin αvβ6 antibody, for example, a fragment or all of integrin αvβ6 is listed, but is not limited thereto.
[0121] Thus, as an example, the system of the present invention may include a column for treating ulcerative colitis or primary sclerosing cholangitis, the column being loaded with a substance that specifically binds to an anti-integrin αvβ6 antibody, whereby the anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody can be adsorbed. The column may be a column containing a solid carrier to which the substance specifically binding to the anti-integrin αvβ6 antibody is immobilized. The column can be regenerated after use by dissociating the adsorbed anti-integrin αvβ6 antibody or B cells producing the anti-integrin αvβ6 antibody. The column may preferably be a column for blood component separation. For example, the system of the present invention may be a system for blood component separation.
[0122] For example, as the aforementioned therapeutic column, a column containing a carrier immobilized with integrin αvβ6 or a fragment thereof is exemplified. The carrier or column specifically adsorbs an anti-integrin αvβ6 antibody or a B cell producing the antibody that preferably contains an RGD peptide sequence or an RGD peptide analog sequence in its heavy or light chain CDR, more preferably in heavy chain CDR2 or CDR3, and further preferably in heavy chain CDR3. In addition, the carrier or column preferably adsorbs an anti-integrin αvβ6 antibody or a B cell producing the antibody with a binding dissociation constant (KD value) for integrin αvβ6 or a fragment thereof of 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. In other words, the carrier or column preferably adsorbs an anti-integrin αvβ6 antibody or a B cell producing the antibody with a KD value of 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. Further, in the carrier or column, preferably, integrin αvβ6 can be immobilized in an amount of 2-fold weight or more of the capture antibody, or its fragment can be immobilized in an amount of 2-fold weight of the capture antibody multiplied by the ratio of the molecular weight of the integrin αvβ6 protein fragment to the total molecular weight of integrin αvβ6. More preferably, the carrier or column adsorbs an anti-integrin αvβ6 antibody or a B cell producing the antibody with an adsorption rate of 50% or more to integrin αvβ6 immobilized in an amount of 2-fold weight or more of the capture antibody, or to its fragment immobilized in an amount of 2-fold weight of the capture antibody multiplied by the ratio of the molecular weight of the integrin αvβ6 protein fragment to the total molecular weight of integrin αvβ6. Further, the aforementioned column contains a carrier, and the carrier preferably immobilizes the whole or a fragment of the aforementioned integrin αvβ6 in the following amounts: the amount of integrin αvβ6 protein is 2-fold weight or more of the capture antibody amount, or the amount of the αvβ6 protein fragment is 2-fold weight of the capture antibody multiplied by the ratio of the aforementioned fragment to the total molecular weight of integrin αvβ6. In addition, the "adsorption rate" in this specification is the ratio of the amount of antigen bound to the antibody in the antigen-antibody reaction system to the amount of antibody added. For example, the amount of free antibody (the amount of antibody not captured by the carrier or column) after adding and reacting the antibody in the reaction system containing the aforementioned carrier or column can be measured, and the ratio of the amount of captured antibody to the amount of antibody added to the aforementioned reaction system can be obtained.
[0123] In addition, another example of the system of the present invention is a therapeutic device for ulcerative colitis or primary sclerosing cholangitis, which may include one or more devices containing the aforementioned column. For example, in addition to the aforementioned column, the system may further include one or more devices selected from the following: a device for collecting blood from a subject, a device for returning blood to the subject, a pump for circulating blood, a plasma separator (e.g., a membrane-type plasma separator, etc.), a filter for removing foreign substances, fine particles, air bubbles, etc. from the blood, a circuit for circulating blood (delivery pipeline, return pipeline, etc.), a fluid infusion pipeline, etc.
[0124] As another example of the system of the present invention, a treatment chamber for the treatment of ulcerative colitis or primary sclerosing cholangitis is exemplified, which includes a unit for removing the aforementioned anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells. The "treatment chamber" in this specification is a compartment for accommodating a subject and treating for ulcerative colitis or primary sclerosing cholangitis, and is preferably an independent room. The aforementioned treatment chamber preferably includes the aforementioned substance that specifically binds to the anti-integrin αvβ6 antibody. More preferably, the aforementioned treatment chamber includes the aforementioned column or device. The aforementioned treatment chamber may further include a treatment table or the like.
[0125] The aforementioned devices, components, etc. included in the system of the present invention can be controlled by a computer.
[0126] Regarding the aforementioned anti-integrin αvβ6 antibody, anti-integrin αvβ6 antibody-producing B cells, substance that specifically binds to the anti-integrin αvβ6 antibody, and solid support, as described in the aforementioned section "4. Method for treating ulcerative colitis or primary sclerosing cholangitis".
[0127] <7. Kit for treating ulcerative colitis or primary sclerosing cholangitis>
[0128] The present invention further provides a kit for the treatment of ulcerative colitis or primary sclerosing cholangitis, which kit includes the aforementioned substance that specifically binds to the anti-integrin αvβ6 antibody, the aforementioned solid support immobilized with the substance that specifically binds to the anti-integrin αvβ6 antibody, or the aforementioned column loaded with the substance that specifically binds to the anti-integrin αvβ6 antibody. Regarding the aforementioned substance that specifically binds to the anti-integrin αvβ6 antibody, solid support, and column, as described in the aforementioned section "4. Method for treating ulcerative colitis or primary sclerosing cholangitis".
[0129] <8. Model animals for ulcerative colitis or primary sclerosing cholangitis>
[0130] The present invention further provides model animals for ulcerative colitis or primary sclerosing cholangitis, and methods for their preparation. As the animal, any non-human animal can be used, and non-human mammals are preferred. For example, mice, rats, guinea pigs, rabbits, monkeys, goats, dogs, hamsters, ferrets, pigs, etc. are exemplified, but not limited thereto.
[0131] In one aspect, a method for preparing a model animal for primary sclerosing cholangitis is provided, which includes the step of immunizing an animal with integrin αvβ6. It is considered that in this immunized animal, anti-integrin αvβ6 autoantibodies are produced and the aforementioned symptoms occur.
[0132] In the method for preparing the foregoing primary sclerosing cholangitis model animal, integrin αvβ6 can preferably be co-administered to the animal with an adjuvant. In addition, in the method for preparing the foregoing primary sclerosing cholangitis model animal, the number of immunizations is not particularly limited, and it is preferably 2 or more times, for example, 2 to 5 times, at appropriate intervals. For example, integrin αvβ6 can be administered 3 times every 2 weeks or 3 times every 4 weeks. The administration of integrin αvβ6 is, for example, by injection, for example, by subcutaneous injection from the back. The administration route, dosage, administration frequency, number of administrations, etc. of integrin αvβ6 can be appropriately determined by those skilled in the art. For example, it can be administered by mixing 50 μg / 200 μl PBS of integrin αvβ6 in one dose with 200 μl of CFA and subcutaneously injecting it into the back of the animal.
[0133] In another aspect, a method for preparing a primary sclerosing cholangitis model animal by knocking out the integrin αvβ6 gene in an animal is provided. Gene knockout can be performed by known methods such as genome editing, a method of using ES cells that disrupt the target gene, etc. According to the present invention, in the formation of the pathological condition of primary sclerosing cholangitis, it has been clarified that anti-integrin αvβ6 autoantibodies bind to integrin αvβ6 present in the animal's body, that is, it is related to the functional inhibition or lack of integrin αvβ6 through the binding of autoantibodies. Therefore, in the present invention, by knocking out the integrin αvβ6 gene, integrin αvβ6 itself is lacking, and thus primary sclerosing cholangitis is successfully induced.
[0134] In yet another aspect, a method for preparing a model animal of ulcerative colitis or primary sclerosing cholangitis is provided, which includes the step of administering an anti-integrin αvβ6 antibody derived from a patient with ulcerative colitis or primary sclerosing cholangitis to the animal. The foregoing patient is an animal, preferably a mammal, and more preferably a human. As an example of the foregoing antibody, antiserum (polyclonal antibody) or monoclonal antibody is listed. As the foregoing antiserum, serum derived from a patient with ulcerative colitis or primary sclerosing cholangitis can be used. Preferably, a monoclonal antibody is administered. The foregoing monoclonal antibody can be prepared from the serum derived from a patient with ulcerative colitis or primary sclerosing cholangitis by known methods. For example, the hybridoma method, etc. can be used.
[0135] The administration method, administration route, administration amount, administration frequency, administration frequency, and administration interval of the aforementioned antibody can be appropriately determined by those skilled in the art. For example, the serum derived from a patient can be administered to an animal more than once, for example, 1 ml to 3 ml per animal can be administered at appropriate intervals 1 to 3 times by injection. For example, 2 ml of the patient's serum can be subcutaneously injected into the back of each animal once. In this case, symptoms of ulcerative colitis or primary sclerosing cholangitis appear at the latest about 24 hours after administration. For example, the anti-integrin αvβ6 monoclonal antibody can be preferably administered to an animal more than twice, for example, 1 mg to 20 mg per animal 1 to 3 times a week, for example, in a period of 1 to 3 weeks, by injection. For example, 10 mg of the anti-integrin αvβ6 antibody can be subcutaneously injected from the back of each animal twice a week for a period of 3 weeks (a total of 6 times). In this case, symptoms of ulcerative colitis or primary sclerosing cholangitis appear at the latest about 48 hours after the last administration.
[0136] The aforementioned antibody preferably contains an RGD peptide sequence or a similar sequence in CDR2 or CDR3, more preferably in CDR2 or CDR3 of the heavy chain, and particularly preferably in CDR3 of the heavy chain. Regarding the similar sequence of the RGD peptide, as described in the section of <2. Anti-integrin αvβ6 antibody>.
[0137] The aforementioned monoclonal antibody is, for example, selected from the following:
[0138] (a) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which contains three heavy chain CDRs containing the sequences shown in SEQ ID NOs: 11 to 13, respectively, and three light chain CDRs containing the sequences shown in SEQ ID NOs: 14 to 16, respectively, and contains a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 83, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 84.
[0139] (b) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which contains three heavy chain CDRs containing the sequences shown in SEQ ID NOs: 17 to 19, respectively, and three light chain CDRs containing the sequences shown in SEQ ID NOs: 20 to 22, respectively, and contains a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 85, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 86.
[0140] (c) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which comprises three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 23 to 25, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 26 to 28, respectively, and comprises a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 87, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 88,
[0141] (d) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which comprises three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 29 to 31, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 32 to 34, respectively, and comprises a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 89, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 90,
[0142] (e) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which comprises three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 35 to 37, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 38 to 40, respectively, and comprises a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 91, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 92,
[0143] (f) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, which comprises three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 41 to 43, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 50 to 52, respectively, and comprises a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 93, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 94,
[0144] (g) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 47 to 49 respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 44 to 46 respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 95, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 96,
[0145] (h) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 53 to 55 respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 56 to 58 respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 97, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 98,
[0146] (i) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 59 to 61 respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 62 to 64 respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 99, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 100,
[0147] (j) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 65 to 67 respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 68 to 70 respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 101, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 102,
[0148] (k) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 71-73, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 74-76, respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 103, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 104, or
[0149] (l) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, comprising three heavy-chain CDRs containing the sequences shown in SEQ ID NOs: 77-79, respectively, and three light-chain CDRs containing the sequences shown in SEQ ID NOs: 80-82, respectively, and comprising a heavy-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 105, and a light-chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 106.
[0150] Preferably, a polypeptide selected from (a)-(i), (k) or (l) is used. More preferably, a polypeptide selected from (a)-(i) or (k) is used. Even more preferably, a polypeptide selected from (b)-(i) or (k) is used.
[0151] Preferably, in the preparation of a model animal for ulcerative colitis, an anti-integrin αvβ6 antibody derived from a patient with ulcerative colitis is applied. In the preparation of a model animal for primary sclerosing cholangitis, an anti-integrin αvβ6 antibody derived from a patient with primary sclerosing cholangitis is applied. For example, the polypeptides selected from the aforementioned (a)-(j), preferably the polypeptides selected from the aforementioned (a)-(i), more preferably the polypeptides selected from the aforementioned (b)-(i), and even more preferably the polypeptides selected from the aforementioned (c) or (d) are preferably used in the preparation of a model animal for ulcerative colitis. For example, the polypeptides selected from the aforementioned (k) or (l), preferably the polypeptide shown in the aforementioned (k) are preferably used in the preparation of a model animal for primary sclerosing cholangitis. However, since CDR3 is the most important site in the specificity (binding ability) of an antibody, in the case where the antibodies derived from patients with ulcerative colitis and patients with primary sclerosing cholangitis have a common CDR3 sequence, there may sometimes be a case where a model animal for both ulcerative colitis and primary sclerosing cholangitis can be prepared using the antibodies derived from either patient.
[0152] The aforementioned animal can be pre-administered with dextran sulfate sodium (DSS). DSS is an agent known to induce enteritis. Since integrin αvβ6 is known to increase in expression during the inflammation and healing phases, pre-administration of DSS increases the amount of integrin αvβ6 in the animal's body, thereby increasing the reaction with anti-integrin αvβ6 autoantibodies, and thus increasing the onset of the disease. The dosage of DSS can be appropriately determined by those skilled in the art and is not particularly limited. Preferably, an amount that causes a mild degree of inflammation, such as about 1% DSS, is given using a water dispenser. The administration of DSS can be carried out, for example, by oral administration or injection, preferably by oral administration. The administration period of DSS is not particularly limited and can be appropriately determined by those skilled in the art. For example, it can be carried out for about 1 day to 3 weeks. Preferably, after the administration of DSS, a drug withdrawal period is set to allow the inflammation to heal, and then the aforementioned patient serum or the aforementioned monoclonal antibody is administered. The drug withdrawal period is not particularly limited, for example, 3 weeks or more is sufficient.
[0153] The ulcerative colitis model animal prepared by the above method has the symptoms of ulcerative colitis, particularly cell infiltration in the large intestine (e.g., submucosal cell infiltration), or crypt disorder or torsion. The primary sclerosing cholangitis model animal prepared by the above method has the symptoms of primary sclerosing cholangitis, particularly disappearance of a part of the bile duct, or periductal cell infiltration or fibrosis. The model animal thus obtained is an ideal animal model for ulcerative colitis or primary sclerosing cholangitis, and using this model, the development of various therapeutic drugs becomes possible. Therefore, as another aspect of the present invention, there is provided a method for screening a therapeutic or prophylactic drug for ulcerative colitis or primary sclerosing cholangitis, which comprises the step of administering a therapeutic candidate substance for ulcerative colitis or primary sclerosing cholangitis to the aforementioned model animal.
[0154] In addition, as described at the beginning, the inventors and others have previously found that the presence of autoantibodies against integrin αvβ6 in patients is an indicator of ulcerative colitis and primary sclerosing cholangitis (International Publication No. WO2020 / 141608, Gastroenterology Vol. 160, No. 7, June 2021, Pages 2383-2394). In ulcerative colitis, many serological antibodies have been reported as indicators of ulcerative colitis in addition to autoantibodies against integrin αvβ6. However, it is considered that such serological antibodies are not direct effectors involved in the etiology of ulcerative colitis, but markers of abnormal immune responses (World J Gastroenterol, 2016 January 21, 22(3): 1304-1310). Before the present invention, regarding autoantibodies against integrin αvβ6, the medical community recognized that they are not direct effectors involved in the etiology of ulcerative colitis, but markers of abnormal immune responses.
[0155] Examples
[0156] Hereinafter, the present invention will be further described in detail by way of examples, but the present invention is not limited to these examples.
[0157] <Example 1. Empirical experiment related to anti-integrin αvβ6 autoantibodies specifically produced in PSC patients>
[0158] 1. Inhibition of integrin αvβ6-fibronectin binding by PSC patient-derived antibodies
[0159] A solid-phase binding assay was used to study the inhibition of the binding of integrin αvβ6 to fibronectin by antibodies (IgG: immunoglobulin G) derived from PSC human patients.
[0160] [Method]
[0161] (1) Preparation of human IgG
[0162] Purify IgG from the sera of PSC patients or controls (patients with cholangiocarcinoma, IgG4-related sclerosing cholangitis, autoimmune hepatitis, primary biliary cholangitis, or other autoimmune diseases or healthy individuals) using Ab-Rapid SPinN (P-013, ProteNova, Higashikagawa, Japan) according to the manufacturer's instructions. Dialyze the purified IgG against phosphate-buffered saline (pH 7.2), concentrate it to the same volume as the pre-purification serum by ultrafiltration using an Amicon Ultra filter (UFC805024; Millipore), and store it at -20 °C. Determine the concentration of the purified IgG using a human IgG enzyme immunoassay kit (MK136; TaKaRa). For the purity of the IgG fraction, confirm the presence of IgA, IgM, IgE, and protein impurities by testing using a human IgA ELISA kit (E88-102; Bethyl Laboratories), a human IgM ELISA kit (E88-100; Bethyl Laboratories), a human IgE ELISA kit (E88-108; Bethyl Laboratories), and sodium dodecyl sulfate polyacrylamide gel electrophoresis using Coomassie brilliant blue staining.
[0163] (2) Solid-phase integrin αvβ6 binding assay
[0164] A 96-well microtiter plate was coated with 150 μL / well of 2 μg / mL human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) overnight at 4 °C, blocked, and incubated with 120 μL of diluted patient or control IgG (1:10 - 1:80) for 60 minutes at room temperature. After washing, the plate was incubated with 100 μL of 2 μg / mL fibronectin (FC010; MilliporeSigma, Burlington, MA) for 60 minutes at room temperature. After washing, anti-fibronectin antibody (diluted 1:5000; ab2413; Abcam) was added and incubated for 60 minutes at room temperature. After washing, HRP-labeled anti-rabbit antibody (diluted 1:10000; A27036; ThermoFisher Scientific) was added and incubated for 60 minutes at room temperature. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 10 minutes, and fibronectin bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance at 450 nm. This assay was performed in the presence of MgCl2 (1 mM) and CaCl2 (1 mM). Additionally, human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) is a heterodimeric protein that contains: an extracellular region from Phe at position 31 to Val at position 992 in the amino acid sequence of the human integrin αv chain, and an α chain with a linker sequence, an acidic tail sequence, and a polyhistidine tag at its C-terminus, and an extracellular region from Gly at position 22 to Asn at position 707 in the amino acid sequence of the human integrin β6 chain, and a β chain with a linker sequence and a basic tail sequence at its C-terminus.
[0165] In addition, to calculate the binding inhibition rate, the well coated with integrin αvβ6 and incubated with fibronectin in the absence of patient or control IgG was used as a blank well, and the absorbance at 450 nm (OD) was measured in the same manner as above. The binding inhibition rate (%) was calculated according to the following formula.
[0166] Binding inhibition rate (%) = {[(OD value of blank well) - (OD value of well with added IgG)] / (OD value of blank well)} × 100
[0167] [Results]
[0168] The results of the binding inhibition assay for the case of applying IgG diluted 1:10 are shown in Figure 1 . Figure 1 in which the cut-off OD value level is indicated by a dashed line. The cut-off OD value is the value of the average of control IgG plus 3 times the standard deviation (SD). Fifteen out of 37 PSC patients (40.5%) had IgG that inhibited the binding of integrin αvβ6 to fibronectin (Figure 1 It is depicted with values exceeding the cut-off OD value. ). On the other hand, control IgG from control disease patients (12 people) does not inhibit the binding of integrin αvβ6 to fibronectin. In addition, IgG from healthy individuals (4 people) also does not inhibit the binding of integrin αvβ6 to fibronectin.
[0169] Figure 2 Dose-dependent inhibition of fibronectin-integrin αvβ6 binding by autoantibodies from patients with primary sclerosing cholangitis is shown. The integrin αvβ6-fibronectin binding inhibitory activity of IgG from the above PSC patients is shown to be dose-dependent ( Figure 2 ). IgG from PSC patients ( Figure 2 labeled as PSC21, PSC19, PSC17, PSC29, PSC32, PSC26, PSC1, PSC2, PSC3 in Figure 2 ) containing anti-integrin αvβ6 antibodies dose-dependently inhibits the binding of integrin αvβ6 to fibronectin. In contrast, IgG from control IgG4-related sclerosing cholangitis patients ( Figure 2 labeled as IgG4-SC7 in Figure 2 ), patients with cholangiocellular carcinoma (
[0170] ), and healthy controls ( Figure 3 labeled as HC3 in Figure 3 ) does not show inhibitory activity.
[0171] 2. Binding of PSC patient-derived antibodies to fibronectin motif binding sites
[0172] It is known that integrin αvβ6 binds to ligands such as fibronectin by recognizing the RGD sequence motif. Here, a hypothesis is established that anti-integrin αvβ6 antibodies from PSC patients exert their inhibitory activity by targeting the RGD binding site of integrin αvβ6, and the binding site of this antibody is verified.
[0173] [Method]
[0174] After coating 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4 °C in a microtiter plate, blocking, and together with 100 μL of patient-derived IgG diluent (1:100), as the RGD motif or RGE motif (control), the peptides RGDS (SEQ ID NO: 9: Arg-Gly-Asp-Ser) or RGES (SEQ ID NO: 10: Arg-Gly-Glu-Ser) were added separately and incubated at room temperature for 60 minutes. After washing, 100 μl / well of HRP-labeled anti-human IgG antibody (diluted 50,000-fold; ab6759; Abcam) was added and incubated at room temperature for 60 minutes. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and the human IgG bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance density (OD value) at 450 nm.
[0175] [Results]
[0176] Figure 4 Shows the results of the binding inhibition assay of primary sclerosing cholangitis patient-derived autoantibodies to integrin αvβ6 by addition of the RGDS peptide (in addition, Figure 4 the markers used to identify each patient are the same as Figure 2 .). The peptide RGDS dose-dependently reduced the binding of PSC patient IgG to integrin αvβ6. On the other hand, Figure 5 Shows the results of the binding inhibition assay of primary sclerosing cholangitis patient-derived autoantibodies to integrin αvβ6 by addition of the RGES peptide (in addition, Figure 5 the markers used to identify each patient are the same as Figure 2 .). The peptide RGES did not inhibit the binding of PSC patient IgG to integrin αvβ6. Therefore, the RGD peptide and the anti-integrin αvβ6 antibody showed competition for binding to the RGD motif binding site on integrin αvβ6.
[0177] <Example 2. Establishment of monoclonal anti-integrin αvβ6 antibody>
[0178] 1. Establishment of monoclonal antibody
[0179] Monoclonal anti-integrin αvβ6 antibodies were established from the peripheral blood of human patients with ulcerative colitis or primary sclerosing cholangitis by conventional methods. Briefly, peripheral blood was obtained from patients with ulcerative colitis and primary sclerosing cholangitis, immortalized by infecting with Epstein-Barr virus, and clones producing anti-integrin αvβ6 antibodies were selected. The DNA sequence of the IgG of the clone was decoded by sequencing, and after introducing its DNA sequence into a plasmid, it was transfected into CHO cells to establish monoclonal anti-integrin αvβ6 antibodies. As a result, four monoclonal anti-integrin αvβ6 antibodies (designated as UC antibody 1, UC antibody 2, UC antibody 3, and UC antibody 4, respectively) were established from one patient with ulcerative colitis, and one monoclonal anti-integrin αvβ6 antibody each (designated as PSC antibody 1 and PSC antibody 2, respectively) was established from two patients with primary sclerosing cholangitis. Further, four, one, and one monoclonal anti-integrin αvβ6 antibodies (designated as UC antibodies 5-8, UC antibody 9, and UC antibody 10, respectively) were established from three other patients with ulcerative colitis, respectively.
[0180] When the obtained monoclonal antibody sequences were analyzed, it was found that the heavy chain CDR3 or CDR2 sequences respectively had an RGD motif or an RGD-like sequence. In addition, in reports of other groups, there were also examples of monoclonal antibodies derived from UC patients having sequences similar to RGD such as RED, KGD, or SGD in addition to the RGD motif in the heavy chain CDR3, and antibodies containing these sequences showed high binding ability to integrin αvβ6 (Nature Medicine volume 28, 766-779 (2022), J Exp Med (2023) 220 (4): e20220538.).
[0181] Regarding the obtained monoclonal antibodies, the CDR sequences of the heavy and light chains are shown below. Further, the amino acid sequences and nucleotide sequences of the variable region sequences are shown. In the amino acid sequence of the variable region, the CDR sequences are indicated by underlines and bold.
[0182] [Table 1-1]
[0183]
[0184] [Table 1-2]
[0185]
[0186] [Table 2-1]
[0187]
[0188] [Table 2-2]
[0189]
[0190] [Table 2-3]
[0191]
[0192] [Table 2-4]
[0193]
[0194] UC antibody 1:
[0195] Heavy chain variable region
[0196] CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 107)
[0197] Light chain variable region
[0198] GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAACCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA(SEQ ID NO: 108)
[0199] UC antibody 2:
[0200] Heavy chain variable region
[0201] GAGGTGCAGTTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGAGTCTCCTGTGTAGTCTCTGGATTCACAATCACTAACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTAGTAAAAGCAAAACTGATGGTGGGACAACAGACTACATTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACACTTTATCTGGAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTGCCACAGATCGGCCTCTGAAACTAAGGGGTAGAGACTACAACTACTACGTTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA(SEQ ID NO: 109)
[0202] Light chain variable region
[0203] GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCTTCTGTTGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTGCCAGATCTTTAAATTGGTATCAGCAAAAACCAGGGAAAGCCCCTAATCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCGGCAGTCTGCAACCTGAAGATTTCGCAACTTACTCCTGTCAACAGAGTTCCAGTTCCCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAG (SEQ ID NO: 110)
[0204] UC antibody 3:
[0205] Heavy chain variable region
[0206] CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGAGTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTATTTATGGGATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATTTCATCTGATGGAACTAATCAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAACAACACGGTGTATCTGCAAATGAACAGCCTGGGAGGTGAGGACACGGCTGTGTATTACTGTGCGAAAGATCGGGGCCGCCGGGGGGACAGTGGCTGGTACCGACACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA (SEQ ID NO: 111)
[0207] Light chain variable region
[0208] CAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACAATGGGAATAATTATGTATCCTGGTACCAGCAGGTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTAGTCTTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 112)
[0209] UC antibody 4:
[0210] Heavy chain variable region
[0211] CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 113)
[0212] Light chain variable region
[0213] TCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCAAAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAATGGCCACCTTGACTATCAGTGGGGCCCAGGTGGAGGATGAAGGTGACTACTACTGTTCCTCAACAGACAGCAATTCTCAGCGCGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 114)
[0214] UC antibody 5:
[0215] Heavy chain variable region
[0216] CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 115)
[0217] Light chain variable region
[0218] GTGCTGACGCAGCCGCCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCAGCATCACCTGCTCTGGAGATAAATTGGGGGATAAATATGCTTGCTGGTACCAGCAGAAGTCAGGCCAGGCCCCTGTATTGGTCATCTATCAAGATAGCAAGCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCGCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 116)
[0219] UC antibody 6:
[0220] Heavy chain variable region
[0221] CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 117)
[0222] Light chain variable region
[0223] CAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGTTCCACCATCGGGGCAAATAATGATGTACACTGGTACCAGCAACTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAACAAGAATCGCCCCTCAGGGGTCTCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGTCTGAGTGATCTTTATGTCTTCGGAACGGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 118)
[0224] UC antibody 7:
[0225] Heavy chain variable region
[0226] GTGCAGCTGGTGGAGTCTGGAGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 119)
[0227] Light chain variable region
[0228] GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAA(SEQ ID NO: 120)
[0229] UC antibody 8:
[0230] Heavy chain variable region
[0231] CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAACCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATCCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCGAGGGACCACGGTCACCGTCTCCTCA(SEQ ID NO: 121)
[0232] Light chain variable region
[0233] GAAATTGTGTTGACACAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCAGTGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA(SEQ ID NO: 122)
[0234] UC antibody 9:
[0235] Heavy chain variable region
[0236] CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA(SEQ ID NO: 123)
[0237] Light chain variable region
[0238] CAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 124)
[0239] UC antibody 10:
[0240] Heavy chain variable region
[0241] CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAAGTCTCCTGCAAGGTTTCCGGATACACCCTCACTGAATTACGCATACACTGGGTGCGACAGGTTCCTGGAAAAGGGCTTGAGTGGATGGGAGGTTTTGATCCTGAAGATGGTGAAACAATCTACACACAGAAGTTCCAGGGCAGAGTCACGATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTCTATTACTGTACAACAGATCTTTTCGCTTTCGTTCGGGGAGTTAGGGGTGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCTTCA (SEQ ID NO: 125)
[0242] Light chain variable region
[0243] GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGACCATTACTACTTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAGAGCATCCAGTTTGCACAGTGGGGTCCCATCTAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACCGTACCCTCTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAC (SEQ ID NO: 126)
[0244] PSC Antibody 1:
[0245] Heavy chain variable region
[0246] CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 127)
[0247] Light chain variable region
[0248] CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCCAACTCATAATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAGGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 128)
[0249] PSC antibody 2:
[0250] Heavy chain variable region
[0251] GAGGCGCATCTGTTGGAGTCTGGGGGAGGCCTGGTACAGCCTGGGGGGTCCCTGAGACTCTCATGTGAAGGCTCTGGGTTCGACTTTAGCAATTATGTCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCCGCAATTACTGACAGAGGTGATAGTCGATACTATATAAATTCAGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTTTCTGGAGATGTACGGCCTGACACCCGAAGACACGGCCGTCTATTACTGTGCCAAGGATCAGACATTTGCGGGCGACGACCCCACCGTCTTCGACTCCTGGGGCCTGGGAACCCTGGTCACCGTCTCCTCA (SEQ ID NO: 129)
[0252] Light chain variable region
[0253] CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACATTGGTGGTTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAATAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAACTCATATACAACCAGCAGCACTTCTGTCTTCGGAACTGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 130)
[0254] 2. Binding inhibition assay for integrin αvβ6
[0255] Furthermore, the function of the obtained monoclonal antibody was confirmed by competitive analysis of binding to integrin αvβ6 with fibronectin. Briefly, a 96-well microtiter plate was coated with 150 μL / well of 2 μg / mL human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) overnight at 4 °C, blocked, and incubated with 120 μL of the monoclonal antibody (0.0001 - 10 μg / mL) for 60 minutes at room temperature. After washing, it was incubated with 100 μL of 2 μg / mL fibronectin (FC010; MilliporeSigma, Burlington, MA) in the plate for 60 minutes at room temperature. After washing, an anti-fibronectin antibody (diluted 1:5000; ab2413; Abcam) was added and incubated for 60 minutes at room temperature. After washing, an HRP-labeled anti-rabbit IgG antibody (diluted 1:10000; A27036; ThermoFisher Scientific) was added and incubated for 60 minutes at room temperature. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 10 minutes, and the fibronectin bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance at 450 nm. This analysis was performed in the presence of MgCl2 (1 mM) and CaCl2 (1 mM). In addition, to calculate the binding inhibition rate, blank wells coated with integrin αvβ6 were incubated with fibronectin in the absence of the antibody, and the absorbance density (OD) at 450 nm was measured in the same manner as above. The binding inhibition rate (%) was calculated according to the following formula. The results are shown in Figure 6 。
[0256] Combination inhibition rate (%) = {[(OD value of blank well) - (OD value of well with added antibody)] / (OD value of blank well)} × 100
[0257] All the monoclonal antibodies tested (UC antibodies 1 - 8, PSC antibody 1) inhibited the binding of fibronectin to integrin αvβ6 ( Figure 6 ).
[0258] CDR3 is the most important part in the specificity (binding property) of the antibody. Therefore, it is known that the epitopes of the anti - integrin αvβ6 autoantibodies derived from patients with ulcerative colitis and primary sclerosing cholangitis are parts that include the RGD - binding site on integrin αvβ6. In addition, it is known that in ulcerative colitis or primary sclerosing cholangitis, the binding of fibronectin to integrin αvβ6 is inhibited by the competition of the anti - integrin αvβ6 autoantibody with the RGD of fibronectin.
[0259] 3. Binding affinity analysis
[0260] Next, the binding affinities of the anti - integrin αvβ6 monoclonal antibodies derived from UC or PSC patients obtained were determined. The KD value was measured by biolayer interferometry using OctetRED96 (Sartorius). Using a buffer of 20 mM Tris, 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 0.1% human serum albumin (014 - 27604; Fujifilm Wako Pure Chemical Industries), and 0.02% Tween 20 (1610781; Bio - Rad), a solution of the aforementioned antibody at 100 nM and a solution of biotinylated integrin αvβ6 protein serially diluted in the range of 200 - 6.25 nM were prepared and added to a 96 - well plate (Greiner; 655209) at 200 μL / well. The biotinylated integrin αvβ6 was allowed to bind to a biosensor (18 - 5136; Sartorius) immersed in the aforementioned buffer for 5 minutes. After washing the sensor, the biosensor was immersed in each antibody solution for 5 minutes (binding reaction). Thereafter, the sensor was immersed in the aforementioned buffer solution for 1 minute (dissociation reaction). Using the analysis software (Octet BLI Analysis) attached to the machine, the binding dissociation constant (KD value) between "integrin αvβ6 - each monoclonal antibody" was determined. The results are shown in Table 3.
[0261] [Table 3]
[0262]
[0263] Based on the KD values of UC antibodies 1, 2, 4, 5, 7, 9 and PSC antibody 1 are in the x10 -9 M level. In addition, the KD values of UC antibodies 3, 6 and 8 are 1x10-8 At the M level, it was found that these antibodies have a high binding affinity for integrin αvβ6. Regarding UC antibodies 3, 6, and 8, they are consistent with the three antibodies with the lowest inhibitory effect of fibronectin on the binding of integrin αvβ6( Figure 6 ). Since the KD values of UC antibody 10 and PSC antibody 2 are not measurable, this suggests that they are antibodies with low binding affinity for integrin αvβ6.
[0264] <Example 3. Preparation of Model Animals with Primary Sclerosing Cholangitis>
[0265] In 8-week-old mice (10 C57BL / 6J mice and 5 BALB / c mice), 100 μg / animal of human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) was subcutaneously injected into the back together with an adjuvant [CFA (Freund's Complete Adjuvant, manufacturer; BD, product number: 263810) or IFA (Freund's Incomplete Adjuvant, manufacturer; BD, product number: 263910)] for immunization (day 0). Subsequently, on days 14 and 28, the same antigen amount as on day 1 was used for immunization to induce the production of anti-integrin αvβ6 antibodies. As a control, mice were immunized with OVA (ovalbumin) in the same manner.
[0266] When the mice were sacrificed 56 days after immunization and the bile ducts were observed, disappearance of a part of the bile ducts and cell infiltration around the bile ducts were seen in the integrin αvβ6-immunized mice( Figure 7 ). These are similar to the pathological findings of PSC. Cell infiltration consistent with the pathology of PSC was seen in the bile ducts of all integrin αvβ6-immunized mice. On the other hand, in the mice immunized with the control OVA, neither cell infiltration around the bile ducts nor disappearance of the bile ducts was seen.
[0267] <Example 4. Study of the Mechanism in Model Animals with Primary Sclerosing Cholangitis>
[0268] In the PSC model mice prepared in Example 3, in order to study which element of cellular immunity (immunity that works mainly with T cells) and humoral immunity (immunity that works mainly with B cells and prepares antibodies to fight foreign substances) plays a strong role, as an antibody removal agent, an anti-CD8 antibody (manufactured by BioXcell, InVivoMab anti-mouse CD8a Clone: 2.43), an anti-CD20 antibody (manufactured by BioXcell, InVivoMAb anti-mouse CD20 Clone: AISB12), or an anti-CD4 antibody (manufactured by BioXcell, InVivoMab anti-mouse CD4 Clone: GK1.5) was administered. The anti-CD8 antibody inhibits cellular immunity, the anti-CD20 antibody inhibits humoral immunity, and the anti-CD4 antibody inhibits both cellular immunity and humoral immunity.
[0269] As a result, in the case of administering the anti-CD20 antibody or the anti-CD4 antibody, inhibition of cell infiltration ( Figure 8 of “+CDa4dep. or +CD20dep.”) was observed. On the other hand, in the case of administering the anti-CD8 antibody, there was no pathological change ( Figure 8 of “+CD8dep.”). Therefore, it is considered that the pathogenesis of PSC is caused by antibody production through humoral immunity (here, the production of anti-integrin αvβ6 antibody).
[0270] <Example 5. Preparation of integrin αvβ6 knockout animals>
[0271] In C57BL / 6J mice, using the gene editing technology of CRISPR / Cas9, Exon3 and Exon4 of the integrin β6 gene were deleted, and gene editing was performed to introduce a stop codon into Exon5 to prepare integrin αvβ6 gene knockout mice (n = 5). Since there are several types of bound β in αv, but only αv binds to β6, if the integrin β6 gene is knocked out, the integrin αvβ6 protein is knocked out (only the integrin αvβ6 protein function is lacking among the integrin family proteins).
[0272] Figure 9 Micrographs of bile ducts in mice lacking the function of the integrin αvβ6 protein are shown. In integrin β6 gene knockout mice (mice lacking the function of the integrin αvβ6 protein), disappearance of a part of the bile ducts and inflammatory cell infiltration (lymphocyte infiltration) around the bile ducts ( Figure 9 ) were observed. Therefore, the following finding in Example 4 was confirmed: inhibition of the function of integrin αvβ6 by an anti-integrin αvβ6 antibody is related to the pathogenesis of PSC.
[0273] <Example 6. Antibody removal experiment 1 using an anti-integrin αvβ6 antibody adsorption column>
[0274] Using a commercially available histidine-tag purification kit (His tagged Protein PURIFICATION KIT, MBL, #3310), in a column packed with anti-histidine-tag beads (the kind where anti-histidine-tag antibody is conjugated to agarose beads), extracellular domain protein of integrin αvβ6 with an additional histidine tag (10 μg / mL; ACROBiosystems, #IT6-H52E1) and serum samples collected from patients with ulcerative colitis (n = 3) (50 μL) were added and allowed to react. After centrifugation, the sample that dropped from the column (the sample that passed through the column) was recovered. After coating 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4°C in a microtiter plate, it was washed and blocked. After washing, the aforementioned sample that passed through the column was diluted 10-fold and added at 100 μL / well, and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (diluted 50,000-fold; ab6759; Abcam) was added at 100 μL / well, and incubated at room temperature for 60 minutes. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and human IgG bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance at 450 nm (OD value).
[0275] Furthermore, for the concentration-dependent experiment, histidine-tagged integrin αvβ6 at 1, 2, 5, or 10 μg / mL and 25 μL of serum samples from patients with ulcerative colitis were used, and the experiment was conducted in the same manner as above. However, in the measurement of the absorbance at 450 nm (OD value), the sample that passed through the column was diluted 5-fold before use.
[0276] As a control, only the patient serum was added to the column, and the absorbance at 450 nm (OD value) of the serum that passed through the column was measured in the same manner as above. The column adsorption rate of the anti-integrin αvβ6 antibody was calculated according to the following formula:
[0277] Adsorption rate (%) = [((OD value of the control) - (OD value of the sample)) / (OD value of the control)] × 100
[0278] In addition, in the formula (and in Tables 2 and 3 described later), "sample" means the sample that passed through the column when histidine-tagged integrin αvβ6 and the patient serum sample were added to the column.
[0279] The results are shown in Tables 4, 5, and Figure 10 . As expected, by applying integrin αvβ6, the anti-integrin αvβ6 antibody in the patient serum was adsorbed to the column. In addition, this antibody adsorption reaction was dependent on the concentration of integrin αvβ6 in the reaction ( Figure 10 ).
[0280] [Table 4]
[0281]
[0282] [Table 5]
[0283]
[0284] <Example 7. Antibody Removal Experiment 2 Using an Anti-Integrin αvβ6 Antibody Adsorption Column>
[0285] An adsorption material in which histidine-tagged integrin αvβ6 protein is immobilized on anti-histidine-tag antibody-labeled magnetic agarose was used to perform an adsorption test for anti-integrin αvβ6 antibodies contained in sera from patients with ulcerative colitis and sera from patients with primary sclerosing cholangitis.
[0286] Antibody adsorption test:
[0287] 5 μg / mL or 25 μg / mL of histidine-tagged integrin αvβ6 (ACRO Biosystems, IT6-H52E1) was mixed with 10 μL (5 μg as the amount of anti-histidine-tag antibody) of anti-histidine-tag antibody-labeled magnetic agarose (MBL, D291-10) and 25 μL of sera from patients with ulcerative colitis (n = 8, UC patients 4 - 11) or sera from patients with primary sclerosing cholangitis (n = 9, PSC patients 1 - 9), and the mixture was subjected to a reverse mixing reaction at 4°C for 12 hours in a total volume of 500 μL of solution. After the reaction, the tube subjected to reverse mixing was placed on a magnetic stand to recover the reaction solution. As a control, a mixture without histidine-tagged integrin αvβ6 added (the one obtained by mixing only the above-mentioned agarose and patient sera) was used to perform the same reaction.
[0288] Anti-integrin αvβ6 antibody concentration measurement:
[0289] The concentration of anti-integrin αvβ6 antibody contained in the recovered solution was measured by ELISA. After coating 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4°C in a microtiter plate, it was washed and blocked. After washing, the aforementioned recovered reaction solution was diluted 10-fold and added at 100 μL / well, and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (diluted 50,000-fold; ab6759; Abcam) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and the human IgG bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance at 450 nm (OD value).
[0290] Anti-integrin αvβ6 antibody concentration conversion:
[0291] In a microtiter plate coated with 2 μg / mL of integrin αvβ6, 1 - 0.001 μg / mL of UC antibody 1 prepared in Example 2 (refer to Table 1) diluted at a common ratio of 3 was added, and incubated at room temperature for 60 minutes. After washing the plate, as the secondary antibody, 100 μL / well of HRP-labeled anti-human IgG antibody (diluted 50,000-fold; ab6759; Abcam) was added, incubated at room temperature for 60 minutes, then incubated with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and the absorbance at 450 nm (OD value) was measured. Subsequently, a standard curve for calculating the anti-integrin αvβ6 antibody concentration based on the obtained OD values was prepared. Using this standard curve, the anti-integrin αvβ6 antibody concentration contained in the solution for the antibody adsorption reaction was determined. The adsorption rate of anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated according to the following formula. Additionally, the adsorbed sample refers to the solution recovered after the binding reaction with integrin αvβ6 on the solid phase.
[0292] Adsorption rate (%) = [((antibody concentration of control) - (antibody concentration of adsorbed sample)) / (antibody concentration of control)] × 100
[0293] Results:
[0294] The results are shown in Figure 11 and Figure 12 . According to Figure 11 and Figure 12 It is clear that as the amount of integrin αvβ6 added in the antibody adsorption reaction increases, the adsorption amount of anti-integrin αvβ6 antibody contained in the sera from UC patients and PSC patients increases. In the case where the integrin addition amount is 25 μg / mL, the adsorption rate of autoantibodies in all samples from UC or PSC patients is 50% or more.
[0295] <Example 8. Specificity confirmation test of ligand protein>
[0296] There are 5 types of integrin β subunits, namely β1, β3, β5, β6, and β8, which are known to form heterodimers with integrin αv. An adsorption material in which the above 5 types of histidine-tagged integrin proteins are immobilized on agarose is labeled with an anti-histidine tag antibody, and an adsorption test of monoclonal autoantibodies from ulcerative colitis patients is performed to confirm whether the adsorption of this autoantibody is specific to integrin αvβ6.
[0297] Mix 10 μL of an anti-His-tag antibody-labeled magnetic agarose (MBL, D291-10) (where the amount of the anti-His-tag antibody is 5 μg), 150 ng of the monoclonal autoantibody derived from a patient with ulcerative colitis prepared in Example 2 (UC antibody 1 shown in Table 1), and any of the following integrins at 5 μg / mL or 25 μg / mL, and perform an inversion mixing reaction at 4°C for 12 hours in a total solution of 500 μL. Recover the solution after the reaction. As a control, use a mixture without added integrin (the one that only mixes the above-mentioned agarose and the autoantibody) and perform the same reaction.
[0298] Integrin αvβ1 (ACRO Biosystems, IT1-H82W6)
[0299] Integrin αvβ3 (ACRO Biosystems, IT3-H52E3)
[0300] Integrin αvβ5 (ACRO Biosystems, IT5-H52W5)
[0301] Integrin αvβ6 (ACRO Biosystems, IT6-H52E1)
[0302] Integrin αvβ8 (ACRO Biosystems, IT8-H52W4)
[0303] Using the same method as described in Example 7, determine the concentration of the anti-integrin αvβ6 antibody contained in the recovered solution, and calculate the adsorption rate of the anti-integrin αvβ6 antibody in the antibody adsorption reaction. The results are shown in Figure 13 .
[0304] According to Figure 13 It is clear that the anti-integrin αvβ6 antibody is adsorbed only in the case where integrin αvβ6 is applied in the ligand. Accordingly, it is known that the autoantibody in UC patients specifically recognizes integrin αvβ6.
[0305] <Example 9. Antibody Removal Performance Test of Immobilized Integrin αvβ6 by NHS Covalent Binding Method>
[0306] Use an adsorption material in which integrin αvβ6 protein is covalently bound and immobilized with NHS (N-hydroxysuccinimide) in magnetic agarose to perform an adsorption test for the monoclonal autoantibody derived from a patient with ulcerative colitis and the anti-integrin αvβ6 antibody contained in the serum of a patient with ulcerative colitis.
[0307] Integrin αvβ6 (ACRO Biosystems, IT6-H52E1) at 3 - 30 μg was mixed with 25 μL of NHS mag Sepharose (Cytiva, 28-9440-09) (containing 5 μL of the carrier) and 500 ng of the monoclonal autoantibody from a patient with ulcerative colitis (UC antibody 1 prepared in Example 2) or 25 μL of serum from a patient with ulcerative colitis (UC patient 11 in Example 7). The reaction was carried out by inverting and mixing at 4°C for 12 hours in a total solution volume of 500 μL. After the reaction, the tube was placed on a magnetic rack to recover the reaction solution. As a control, a mixture without the addition of integrin αvβ6 was used to carry out the same reaction.
[0308] Using the same method as described in Example 7, the concentration of the anti-integrin αvβ6 antibody contained in the recovered solution was determined, and the adsorption rate of the anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated. The results are shown in Figure 14 .
[0309] According to Figure 14 It is clear that with the increase in the addition of integrin αvβ6 used in the antibody adsorption, the adsorption amount of the anti-integrin αvβ6 antibody contained in UC antibody 1 and the serum from UC patient 11 increases.
[0310] <Example 10. Antibody Removal Performance Test of Integrin αvβ6 Immobilized on Various Carriers by NHS Covalent Bonding Method>
[0311] Integrin αvβ6 was immobilized on a cellulose carrier or a polymethyl methacrylate (PMMA) carrier through an NHS covalent bond, and an antibody adsorption test was carried out. The cellulose carrier and the PMMA carrier were prepared as follows.
[0312] Preparation of the cellulose carrier:
[0313] As the cellulose carrier, Celphere C P-305 (Asahi Kasei) was used. 1 g of the cellulose carrier was added to a flask reactor, suspended in 0.05 M sodium phosphate buffer (90 mL, pH 6.8), and then TEMPO (2,2,6,6-tetramethylpiperidine 1-oxide, 0.016 g, 0.1 mmol) and sodium hypochlorite (80%, 1.13 g, 10 mmol) were added and gently stirred. Then, a 2 M aqueous sodium hypochlorite solution (0.5 mL, 1.0 mmol) and 0.05 M sodium phosphate buffer (0.5 mL, pH 6.8) were mixed, added to the aforementioned reaction suspension and mixed, and a heating reaction was carried out at 60 °C for 2, 6, 24, 48, and 72 hours. After each reaction time, the suspension was filtered after returning to room temperature, the filtrate was washed 3 times with distilled water, and by performing cutting for 30 minutes, crystalline cellulose beads with COOH groups attached to the surface were obtained. 1 g of this carrier was filtered and washed twice with 10 mL of 0.05 M 2-(N-morpholino)ethanesulfonic acid monohydrate (MES) buffer (pH 5.0), and 20 mL of a carrier MES buffer suspension of 50 mg / ml was prepared. In this suspension, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was dissolved in the MES buffer to prepare 640 μL of a solution adjusted to 150 mM. Sulfo NHS (sodium N-hydroxysulfosuccinimide) was dissolved in the MES buffer to prepare 320 μL of a solution adjusted to 300 mM. The EDC solution and the sulfo NHS solution were sequentially added to the carrier suspension, stirred with shaking at room temperature for 1 hour, then filtered, and washed with 0.1 M phosphate buffer (pH 7.4) to obtain an NHS-activated carrier.
[0314] Preparation of PMMA carrier:
[0315] Poly(methyl methacrylate) (PMMA) particles with COOH groups introduced were obtained by copolymerizing methyl methacrylate (MMA) and methacrylic acid (MAA) by dispersion polymerization. 50 g of MMA (M0087; Tokyo Chemical Industry), 50 g of MAA (M0079; Tokyo Chemical Industry), 116 g of pure water (161-08247; Fujifilm Wako), and 464 g of methanol (131-01826; Fujifilm Wako) were mixed. Further, 10 g of polyvinylpyrrolidone (P0691; Tokyo Chemical Industry) as a dispersion stabilizer and 2 g of 2,2'-azobisisobutyronitrile (A0566; Tokyo Chemical Industry) as a polymerization initiator were mixed in the aforementioned polymerization flask, and the reaction was carried out at 60 °C for 6 hours while stirring at 120 rpm. After the reaction, the particles were washed and the obtained particles were used for the test. Hereinafter, in the same manner as the cellulose carrier, an NHS-activated carrier was obtained.
[0316] Immobilization of integrin αvβ6 protein to NHS-activated carrier:
[0317] Weigh the necessary amount of carrier for the NHS-activated carrier and wash it with 1 mM hydrochloric acid. Mix this carrier with the integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) at a volume ratio of 2:1 and mix by inversion at room temperature for 2 hours. After the reaction, to block it, replace it with 0.5 M ethanolamine solution (pH 8.3, containing 500 mM NaCl) and mix by inversion at room temperature for 2 hours. Thereafter, to remove excess reagents and reaction by-products, wash it alternately with 0.1 M Tris-HCl buffer (pH 8.3, containing 500 mM NaCl) and 0.1 M acetate buffer (pH 4.0, containing 500 mM NaCl), and finally replace it with 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution and store it as a 50% slurry at 4°C.
[0318] Using the two adsorption materials obtained in this way, in the same manner as described in Example 9, an adsorption test of monoclonal autoantibodies derived from ulcerative colitis patients (UC antibody 1 prepared in Example 2) was carried out, and the adsorption rate was calculated. The results are shown in Table 6. In addition, in Table 6, for comparison, the adsorption rate of an agarose carrier (NHS mag Sepharose; Cytiva, 28-9440-09) immobilized with the same amount (10 μg per 5 μL carrier) of integrin αvβ6 as shown in Example 9 is also shown.
[0319] [Table 6]
[0320]
[0321] <Example 11. Antibody removal test for immobilizing integrin αvβ6 by covalent binding methods other than the NHS method>
[0322] Using an adsorption material in which integrin αvβ6 is immobilized on a carrier activated by the Formyl method, Epoxy method, or EAH method, an adsorption test of monoclonal autoantibodies derived from ulcerative colitis patients (UC antibody 1 prepared in Example 2) was carried out. Each carrier was prepared as follows.
[0323] Formyl group-immobilized carrier preparation method:
[0324] Mix the integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) with formyl-activated cellulose (19853: JNC) at a volume ratio of 1:1 and mix by inversion at room temperature for 1 hour. Add 2 mg of trimethylamine borane (CH3)3NBH3 to each tube and mix by inversion at room temperature for 2 hours. Through this reaction, a covalent bond is formed between the exposed amino group of the integrin αvβ6 protein and the formyl group of the cellulose carrier, and the protein is immobilized on the surface of the carrier. Further, in order to block the unreacted formyl groups on the surface of the carrier, immerse the aforementioned immobilized carrier in a 200 mM Tris-HCl buffer (pH 7.0) containing 1 M ethanolamine and mix by inversion at room temperature for 2 hours. After the reaction, replace the solvent of the carrier with a 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution and store as a 50% slurry at 4°C.
[0325] Preparation method of epoxy group-immobilized carrier:
[0326] As the epoxy group-activated carrier, apply epoxy-activated Sepharose 6B (Cytiva, 17048001). Weigh the necessary amount of the carrier, swell it with distilled water, wash it with a neutral buffer on a glass filter, and then mix the carrier with the integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) at a volume ratio of 1:1 and carry out an oscillating reaction at room temperature for 16 hours. After the reaction, replace it with a 1 M ethanolamine solution at pH 8.0 for blocking and let it stand at 40°C for 4 hours. Subsequently, in order to remove the excess reagents and reaction by-products, wash it alternately with a 0.1 M Tris-HCl buffer (pH 8.0, containing 500 mM NaCl) and a 0.1 M acetic acid buffer (pH 4.0, containing 500 mM NaCl), and finally replace it with a 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution and store as a 50% slurry at 4°C.
[0327] Preparation method of EAH group-immobilized carrier:
[0328] Use EAH Sepharose (registered trademark) 4B (Cytiva, 17056901) as the EAH-based carrier. After washing the necessary amount of the carrier on a glass filter with distilled water adjusted to pH 4.5 with hydrochloric acid, wash the carrier with 500 mM NaCl. Mix the carrier with the integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) at a volume ratio of 2:1 and react overnight at 4°C. After the reaction, to remove excess reagents and reaction by-products, wash alternately with 0.1 M Tris-HCl buffer (pH 8.0, containing 500 mM NaCl) and 0.1 M acetate buffer (pH 4.0, containing 500 mM NaCl), and finally replace with 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution and store as a 50% slurry at 4°C.
[0329] Mix the aforementioned carrier or albumin-immobilized carrier (control) immobilized with 13 μg of integrin αvβ6 and 500 ng of a monoclonal autoantibody derived from a patient with ulcerative colitis (UC antibody 1). After performing a reverse mixing reaction at 4°C for 12 hours in a total solution volume of 500 μL, recover the reaction solution.
[0330] Except for using an HRP-labeled anti-human IgG antibody (ab98535, diluted 40,000-fold) as the labeled antibody, use the same method as described in Example 7 to determine the concentration of the anti-integrin αvβ6 antibody contained in the recovered solution and calculate the adsorption rate of the anti-integrin αvβ6 antibody in the antibody adsorption reaction. The results are shown in Table 7.
[0331] [Table 7]
[0332]
[0333] <Example 12. Antibody Removal Test of Immobilized Integrin αvβ6 by Avidin-Biotin Binding Method>
[0334] Integrin with biotin attached to the C-terminus of any subunit (α-chain or β-chain) can bind to an avidin-immobilized carrier with a binding affinity equivalent to that of a covalent bond. In this binding mode, since the integrin is vertically immobilized relative to the carrier, many heads that are putative recognition sites for autoantibodies are open, and an increase in the efficiency of interaction with autoantibodies is expected. Use an avidin-attached carrier immobilized with biotinylated integrin αvβ6 to perform an adsorption test for a monoclonal autoantibody derived from a patient with ulcerative colitis (UC antibody 1 prepared in Example 2).
[0335] (1) Antibody Removal Test of NeutrAvidin Agarose-Immobilized Integrin αvβ6
[0336] After washing 400 μL (200 μL as the carrier) of NeutrAvidin agarose (Thermo Fisher Scientific, 29200) with binding buffer (25 mM Tris, 0.15 M sodium chloride, pH 7.2), 200 μL (80 μg) of biotinylated integrin αvβ6 (ACRO Biosystems, IT6-H82E4) was mixed and allowed to stand at room temperature for 15 minutes. Thereafter, the supernatant was removed and the immobilized gel was washed with buffer (20 mM Tris, 150 mM NaCl, pH 7.4), and stored at 4 °C as a 50% slurry. As a control, an agarose carrier (BSA) with biotinylated bovine serum albumin (SIGMA, A8549) immobilized on NeutrAvidin was prepared in the same manner. In addition, biotinylated human integrin αvβ6 (ACROBiosystems, product number IT6-H82E4) is a heterodimeric protein that contains: an extracellular region from Phe at position 31 to Val at position 992 in the amino acid sequence of the human integrin αv chain, an acidic tail sequence at its C-terminus, a polyhistidine tag, an Avi tag (registered trademark) on the α chain, and an extracellular region from Gly at position 22 to Asn at position 707 in the amino acid sequence of the human integrin β6 chain and a basic tail sequence at its C-terminus on the β chain.
[0337] 500 ng of an anti-integrin αvβ6 antibody (UC antibody 1) was mixed with 10 μL or 30 μL of the above-mentioned carrier-immobilized integrin αvβ6 or BSA (the immobilized amounts were 2 μg or 7 μg respectively), with a total volume of 500 μL, and inverted mixing was carried out at 4 °C for 12 hours. After the reaction, it was allowed to stand, and then the solution was recovered.
[0338] Except that an HRP-labeled anti-human IgG antibody (diluted 40,000-fold; ab98535; Abcam) was used as the labeled antibody, in the same manner as described in Example 7, the concentration of the anti-integrin αvβ6 antibody contained in the recovered solution was determined, and the adsorption rate of the anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated according to the following formula. In the case of this example, the antibody concentration before adsorption reaction (Pre antibody concentration) was 1 μg / mL (= 500 ng / 500 μL). The results are shown in Figure 15 。
[0339] Adsorption rate (%) = [{(antibody concentration before adsorption reaction = Pre) - (antibody concentration in the adsorbed sample)} / (antibody concentration before adsorption reaction = Pre)] × 100
[0340] As a result, the antibody adsorption rates of the adsorption materials with 2 μg and 7 μg of integrin αvβ6 immobilized were 48% and 88% respectively (Figure 15 )。The adsorption rate of the carrier (control) immobilized with BSA was at most 14%. Accordingly, it was found that the integrin αvβ6-immobilized carrier specifically adsorbed the anti-integrin αvβ6 antibody.
[0341] (2) Antibody removal test for immobilizing integrin αvβ6 with various carriers or various avidin
[0342] As various carriers other than agarose, a cellulose carrier and a PMMA carrier were prepared in the same manner as described in Example 10, and 1 mg of NeutrAvidin (Thermo Fisheer) was immobilized on 100 μL of the carrier. Further, as carriers for immobilizing various avidin other than NeutrAvidin, StreptAvidin agarose (Thermo Fisher), which is StreptAvidin-immobilized agarose, and Avidin agarose (Thermo Fisher), which is Avidin-immobilized agarose, were used.
[0343] Using these carriers thus obtained, biotinylated integrin αvβ6 (ACRO Biosystems, IT6-H82E4) was immobilized in the same manner as described in Example 12(1) above, and an antibody adsorption test was performed. The results are shown in Table 8. In addition, for comparison in Table 6, the adsorption rate of integrin αvβ6 immobilized on NeutrAvidin agarose shown in Example 12(1) above is also shown.
[0344] [Table 8]
[0345]
[0346] (3) Comparison between the avidin-biotin method and the covalent binding method
[0347] Using the adsorption material obtained by immobilizing biotinylated integrin αvβ6 on NeutrAvidin-immobilized agarose prepared in Example 12(1) above and the adsorption material obtained by immobilizing integrin αvβ6 on NHS mag Sepharose (Cytiva) prepared in Example 9, a monoclonal antibody adsorption test was performed under the conditions described in Example 12(1) above, and their performances were compared. The results are shown in Figure 16 .
[0348] According to Figure 16 It was clear that the adsorption material obtained by immobilizing biotinylated integrin αvβ6 on NeutrAvidin-immobilized agarose had superior antibody adsorption performance compared to the adsorption material immobilized by the covalent binding method.
[0349] <Example 13. Antibody removal test using a circulating column>
[0350] Using a column packed with the NeutrAvidin-biotinylated integrin αvβ6 immobilized agarose adsorbent material prepared in Example 12, a circulating adsorption test of a monoclonal autoantibody solution derived from a patient with ulcerative colitis was performed.
[0351] Circulating column:
[0352] Figure 16 The outline of an example of the circulating column is shown. A 10 mL solution (with an antibody concentration of 1 μg / mL) containing 10 μg of a monoclonal autoantibody derived from a patient with ulcerative colitis (UC antibody 1 prepared in Example 2) and 0.1 g of human serum albumin (SIGMA, A8549) was prepared. This antibody solution was circulated by a peristaltic pump through a column containing an agarose adsorbent material immobilized with biotinylated integrin αvβ6 (10 μg) prepared by the same method as in Example 12. The antibody solution was recovered every 30 minutes during the circulation. As a control, the same test was performed using an adsorbent material immobilized with 10 μg of biotinylated bovine serum albumin (SIGMA, A8549).
[0353] Determination of the anti-integrin αvβ6 antibody concentration:
[0354] The concentration of the anti-integrin αvβ6 antibody contained in the solution sampled during the circulation test and the solution after inversion and mixing reaction was determined by ELISA. After coating 2 μg / mL integrin αvβ6 at 100 μL / well in a microtiter plate overnight at 4°C, it was washed and blocked. After washing, the sample passed through the column was diluted 10-fold and added at 100 μL / well, and incubated at room temperature for 60 minutes. After washing, an HRP-labeled anti-human IgG antibody (diluted 40,000-fold; ab98535; Abcam) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, it was incubated with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and the human IgG bound to integrin αvβ6 on the solid phase was detected by measuring the absorbance at 450 nm (OD value).
[0355] Conversion of the anti-integrin αvβ6 antibody concentration:
[0356] To a microtiter plate immobilized with 2 μg / mL of integrin αvβ6, add the UC antibody 1 prepared in Example 2 (refer to Table 1) diluted at a three-fold ratio from 1 to 0.001 μg / mL, and incubate at room temperature for 60 minutes. After washing the plate, as a secondary antibody, add the HRP-labeled anti-human IgG antibody (diluted 40,000-fold; ab98535; Abcam) at 100 μL / well, incubate at room temperature for 60 minutes, then incubate with 3,3’,5,5’-tetramethylbenzidine for 7 minutes, and measure the absorbance at 450 nm (OD value). Subsequently, prepare a standard curve for calculating the concentration of the anti-integrin αvβ6 antibody based on the OD value. Apply this standard curve to determine the concentration of the anti-integrin αvβ6 antibody contained in the solution that has undergone the antibody adsorption reaction. Based on the following formula, divide the reduction amount of the autoantibody after passing through each column by the amount of the autoantibody after passing through a dummy column (a column without the packed adsorption material, recorded as pass through) to calculate the adsorption rate of the autoantibody.
[0357] Adsorption rate (%) = [((Antibody concentration of pass through) - (Antibody concentration of adsorbed sample)) / (Antibody concentration of pass through)] × 100
[0358] Results:
[0359] The results are shown in Figure 18-1 and Figure 18-2 . As shown in Figure 18-1 and Figure 18-2 , for the antibody solution sample of the cyclic integrin αvβ6-immobilized adsorption material, the antibody was adsorbed over time, and the adsorption rate was 50% at the 3-hour time point. For 10 μg of integrin αvβ6 immobilized on the carrier, approximately 5 μg of the anti-integrin αvβ6 antibody in the antibody solution was adsorbed. In the control (BSA), almost no adsorption of the anti-integrin αvβ6 antibody was observed during the 3-hour cycle. Therefore, it is known that the anti-integrin αvβ6 antibody was specifically removed by the integrin αvβ6-immobilized adsorption material in the column.
[0360] <Example 14. Determination of the amount of anti-integrin αvβ6 antibody in patient serum>
[0361] Based on the anti-integrin αvβ6 antibody concentration measurement and conversion method described in Example 7, quantify the anti-integrin αvβ6 antibody concentration contained in the sera of UC (n = 8) and PSC (n = 13) patients. As a result, the average values of the anti-integrin αvβ6 antibody in the sera of UC or PSC patients were approximately 5.8 μg / mL or 8.0 μg / mL, respectively (Table 9). Among the sera of all 21 patients measured, 17 patients had a concentration of 10 μg / mL or less.
[0362] [Table 9]
[0363]
[0364] <Example 15. Verification 1 of the direct pathological effect by anti-integrin αvβ6 antibody>
[0365] Using sera from UC patients or PSC patients, it was verified whether the characteristics of the disease could be reproduced by passive transfer of anti-integrin αvβ6 antibody to animals. In addition, the amounts of anti-integrin αvβ6 antibody contained in the sera from UC patients, sera from PSC patients, and control (healthy individuals) sera used in this example are shown in the following table.
[0366] [Table 10]
[0367]
[0368] In 1-week-old mice (Balb / c, C57BL / 6), UC patient sera, PSC patient sera, or sera from healthy controls (healthy control) were administered subcutaneously at 2 ml / animal from the back. The mice were sacrificed 24 hours later, and the large intestine and bile ducts of the mice were observed by hematoxylin / eosin (HE) staining. As a result, by administering UC patient sera, disorder of crypts and cell infiltration were seen in the large intestine ( Figure 19 ). In addition, by administering PSC patient sera, cell infiltration was seen in a part around the bile ducts ( Figure 20 ).
[0369] After administering 1% DSS to 8-week-old mice (Balb / c, C57BL / 6) for 3 weeks, the administration was stopped for 3 weeks. The above amount of DSS was the amount that caused mild inflammation in the intestine, and it was considered that the inflammation was completely cured after about 3 weeks of stopping the administration. Subsequently, UC patient sera, PSC patient sera, or sera from healthy controls (healthy control) were administered subcutaneously at 1 ml / animal from the back, 3 times every 24 hours. The mice were sacrificed 24 hours after the final administration, and the large intestine and bile ducts of the mice were observed by HE staining. As a result, in both the administration of UC patient sera and the administration of PSC patient sera, compared with the control, obvious cell infiltration was seen in the submucosa of the large intestine, and disorder of crypts was also seen ( Figure 21 ). In addition, by administering PSC patient sera, obvious fibrosis was seen around the bile ducts ( Figure 22 ).
[0370] Thus, it is shown that the presence of anti-integrin αvβ6 antibodies in the sera of UC patients and PSC patients causes the pathological onset of UC and PSC. Further, it is known that model animals showing the symptoms of UC or PSC can be prepared by administering the sera of UC patients or PSC patients.
[0371] <Example 16. Verification of the direct pathological effect of anti-integrin αvβ6 antibody 2>
[0372] By passively transferring anti-integrin αvβ6 monoclonal antibodies derived from human UC patients to animals, it was verified whether the characteristics of UC could be reproduced.
[0373] In mice (B6 wild type), the UC antibody 3 or UC antibody 4 prepared in Example 2 (refer to Table 1) or healthy human IgG as a control (FUJIFILM Wako Pure Chemical 149-09503) was administered subcutaneously in the back at 10 mg / animal twice a week for 3 weeks. The mice were sacrificed 24 hours after the final administration, and the large intestine of the mice was observed by HE staining. As a result, cell infiltration was observed in the large intestine of the mice administered with anti-integrin αvβ6 monoclonal antibody. The results in the case of administering UC antibody 4 are shown in Figure 23 . On the other hand, no abnormality was observed in the large intestine of the mice administered with the control antibody ( Figure 23 ).
[0374] After administering 1% DSS to mice (B6 wild type) for 3 weeks, the administration was stopped for 6 weeks. Subsequently, both UC antibody 3 and UC antibody 4 prepared in Example 2, or UC antibody 3 or UC antibody 4 (refer to Table 1), or healthy human IgG as a control (FUJIFILM Wako Pure Chemical 149-09503) was administered subcutaneously in the back at 0.1 mg / animal twice a week for 3 weeks. The mice were sacrificed 24 hours after the final administration, and the large intestine of the mice was observed by HE staining. As a result, obvious cell infiltration and crypt torsion were observed in the large intestine of the mice administered with anti-integrin αvβ6 monoclonal antibody (the same was true for either both or one of UC antibody 3 and UC antibody 4). The results in the case of administering both UC antibody 3 and UC antibody 4 are shown in Figure 24 . On the other hand, no abnormality was observed in the large intestine of the mice administered with the control antibody ( Figure 24 ).
[0375] Thus, by administering an anti-integrin αvβ6 monoclonal antibody derived from a UC patient to a mouse, a pathology similar to UC was shown. Thus, the pathogenicity of the anti-integrin αvβ6 monoclonal antibody derived from a UC patient was shown, indicating that the presence of this antibody leads to the morbid onset of UC. Further, it was found that by administering an anti-integrin αvβ6 monoclonal antibody derived from a UC patient, a model animal showing the symptoms of UC could be prepared. Further, based on the results of this example and the results of Example 14, regarding the anti-integrin αvβ6 antibody derived from a PSC patient as well, it was found that it leads to the morbid onset of PSC, and that by administering this antibody, a PSC model animal could be prepared.
Claims
1. A system for the treatment of ulcerative colitis or primary sclerosing cholangitis, comprising a unit for removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, wherein, The anti-integrin αvβ6 antibody has the activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject with ulcerative colitis or primary sclerosing cholangitis.
2. The system according to claim 1, wherein The unit contains a substance that specifically binds to an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cell.
3. The system according to claim 2, wherein, The substance is a fragment or the whole of the integrin αvβ6 protein.
4. The system according to claim 3, which comprises a column loaded with a fragment or the whole of the integrin αvβ6 protein.
5. A solid carrier for treating ulcerative colitis or primary sclerosing cholangitis, which is loaded with a fragment or all of the integrin αvβ6 protein that can specifically bind to an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cell that produces the anti-integrin αvβ6 antibody, whereby the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody B cell can be adsorbed, wherein, The anti-integrin αvβ6 antibody has the activity of competing with fibronectin in binding to integrin αvβ6 and is specifically produced in a subject with ulcerative colitis or primary sclerosing cholangitis.
6. The solid carrier according to claim 5, wherein In the case of the anti-integrin αvβ6 antibody containing any one of the amino acid sequences of RGD, RGRD, or RGSGD in CDR2 or CDR3 of the heavy chain, the binding dissociation constant (KD value) of the fragment or the whole of the integrin αvβ6 protein is 100 nM or less.
7. The solid carrier according to claim 5 or 6, wherein, The integrin αvβ6 protein is immobilized in an amount of 2-fold weight or more of the amount of the capture antibody, or the fragment of the αvβ6 protein is immobilized in an amount of 2-fold weight of the capture antibody multiplied by the ratio of the molecular weight of the fragment to the whole of the integrin αvβ6 protein.
8. A column, which comprises the solid carrier according to any one of claims 5 to 7.
9. The column according to claim 8, which comprises the solid carrier in such a manner that the amount of the fragment or the whole of the integrin αvβ6 protein per column satisfies the following: the amount of the integrin αvβ6 protein is 2-fold weight or more of the amount of the capture antibody, or the amount of the fragment of the αvβ6 protein is 2-fold weight of the capture antibody multiplied by the ratio of the molecular weight of the fragment to the whole of the integrin αvβ6 protein.
10. The column according to claim 8 or 9, which is used for blood component separation.
11. A method for preparing a primary sclerosing cholangitis model animal, which comprises the step of immunizing a non-human animal with a fragment or the whole of the integrin αvβ6 protein.
12. A method for preparing a primary sclerosing cholangitis model animal, which comprises the step of knocking out the integrin β6 gene in a non-human animal.
13. A method for preparing an ulcerative colitis or primary sclerosing cholangitis model animal, which comprises the step of administering an anti-integrin αvβ6 antibody derived from a patient with ulcerative colitis or primary sclerosing cholangitis to a non-human animal.
14. The preparation method according to claim 13, wherein, The antibody is a serum or a monoclonal antibody.
15. An ulcerative colitis model animal, which has the symptoms of ulcerative colitis.
16. A primary sclerosing cholangitis model animal, which has the symptoms of primary sclerosing cholangitis.
17. The primary sclerosing cholangitis model animal according to claim 16, which is a knockout mouse lacking the function of integrin αvβ6.
Citation Information
Patent Citations
Test method for ulcerative colitis and primary sclerosing cholangitis
WO2020141608A1