Use of ddx3x inhibitors in the preparation of a medicament for treating myocardial fibrosis
By using DDX3X inhibitors such as RK-33 or CRISPR-Cas9 systems to target and knock out the DDX3X gene, the lack of specific treatments for myocardial fibrosis has been addressed, significantly improving cardiac function and reducing fibrosis markers, thus providing an effective intervention for myocardial fibrosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE SEVENTH MEDICAL CENTER OF PLA GENERAL HOSPITAL
- Filing Date
- 2025-03-25
- Publication Date
- 2026-04-28
AI Technical Summary
There is a lack of specific treatments for myocardial fibrosis in current technologies. Myocardial fibrosis is widespread in various heart diseases, is associated with adverse cardiovascular events, seriously affects patients' health, and there are currently no effective interventions.
By using DDX3X inhibitors such as RK-33, small interfering RNA (siRNA), or CRISPR-Cas9 systems to target and knock out the DDX3X gene, the progression of cardiomyocyte fibrosis can be inhibited by silencing or knocking out DDX3X gene expression.
DDX3X inhibitors significantly improved cardiac function in mice, reduced the degree of myocardial fibrosis, decreased the expression of fibrosis markers, and improved cardiac function, providing a potential therapeutic target for anti-cardiac fibrosis drugs.
Smart Images

Figure CN120346327B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of a DDX3X inhibitor in the preparation of a drug for treating myocardial fibrosis. Background Technology
[0002] DDX3X (DEAD-box helicase 3X-linked) is an RNA helicase belonging to the DEAD-box protein family. It is ATP-dependent and widely involved in various biological processes. This protein possesses multiple conserved domains and is believed to function in both the nucleus and cytoplasm. Its nuclear functions include transcriptional regulation, mRNP assembly, pre-mRNA splicing, and mRNA export. In the cytoplasm, this protein is thought to be involved in translation, cell signaling, and viral replication. Due to its crucial role in various diseases, DDX3X has become a potential target for drug development. For example, inhibitors of DDX3X may be used in cancer treatment. Furthermore, the role of DDX3X in immune responses makes it a hot topic in immunotherapy research.
[0003] Myocardial fibrosis is a process of cardiac interstitial remodeling, characterized by abnormal proliferation of cardiac interstitial fibroblasts, excessive accumulation of collagen fibers, a significant increase in collagen concentration and volume fraction per unit mass of myocardium, and an imbalance and abnormal distribution of different types of collagen. Myocardial fibrosis is present to varying degrees in some common cardiovascular diseases, such as diabetic cardiomyopathy, viral myocarditis, ischemic cardiomyopathy, and hypertensive heart disease. Summary of the Invention
[0004] To address the technical problems existing in the prior art, this invention provides an application of a DDX3X inhibitor in the preparation of a drug for treating myocardial fibrosis. The technical solution is as follows:
[0005] Application of DDX3X inhibitors in the preparation of drugs for the treatment of myocardial fibrosis.
[0006] Optionally, the DDX3X inhibitor is RK-33, siRNA for silencing the DDX3X gene, or sgRNA for targeted knockout of the DDX3X gene.
[0007] A siRNA for silencing the DDX3X gene, wherein the siRNA is selected from any one of siRNA1, siRNA2, and siRNA3, wherein...
[0008] The sense strand sequence of siRNA1 is shown in SEQ ID No. 10, and the antisense strand sequence is shown in SEQ ID No. 11;
[0009] The sense strand sequence of siRNA2 is shown in SEQ ID No. 12, and the antisense strand sequence is shown in SEQ ID No. 13;
[0010] The sense strand sequence of siRNA3 is shown in SEQ ID No. 14, and the antisense strand sequence is shown in SEQ ID No. 15.
[0011] A kit for silencing the DDX3X gene, comprising the siRNA described above.
[0012] A sgRNA for targeting and knocking out the DDX3X gene, wherein the sgRNA is selected from any one of sgRNA1, sgRNA2, and sgRNA3, wherein the nucleotide sequence of sgRNA1 is shown in SEQ ID No.1, the nucleotide sequence of sgRNA2 is shown in SEQ ID No.2, and the nucleotide sequence of sgRNA3 is shown in SEQ ID No.3.
[0013] A CRISPR-Cas9 recombinant vector for targeted knockout of the DDX3X gene, wherein the CRISPR-Cas9 recombinant vector comprises the DNA sequence of the sgRNA.
[0014] Optionally, the plasmid used to construct the CRISPR-Cas9 recombinant vector is the lentiCRISPR V2 vector.
[0015] A kit for targeted knockout of the DDX3X gene, comprising the sgRNA or the CRISPR-Cas9 recombinant vector.
[0016] A drug for treating myocardial fibrosis includes a DDX3X inhibitor as the active pharmaceutical ingredient.
[0017] Optionally, the DDX3X inhibitor is RK-33, siRNA for silencing the DDX3X gene, or sgRNA for targeted knockout of the DDX3X gene.
[0018] Optionally, the DDX3X inhibitor is the siRNA for silencing the DDX3X gene or the sgRNA for targeting and knocking out the DDX3X gene.
[0019] The beneficial effects of the technical solutions provided in the embodiments of the present invention include at least the following:
[0020] This study found that DDX3X is closely related to the pathogenesis of myocardial fibrosis, and the DDX3X inhibitor RK-33 significantly improved cardiac function in a mouse model. However, there are currently no reports of a link between DDX3X and myocardial fibrosis. Myocardial fibrosis is widespread in various heart diseases and is associated with adverse cardiovascular events, seriously affecting patients' health. Early diagnosis and intervention can reduce the occurrence of adverse cardiovascular events, but there is currently no specific treatment for myocardial fibrosis. This study reveals the potential therapeutic role of DDX3X as a novel target for inhibiting the progression of myocardial fibrosis. This invention demonstrates that knockdown or knockout of DDX3X can inhibit myocardial cell fibrosis, and that DDX3X inhibitors can intervene in the development and progression of myocardial fibrosis in mice and improve cardiac function. This suggests that targeting DDX3X as an anti-fibrotic drug has good medical translational prospects, thus providing a research basis for the preparation of anti-cardiac fibrosis drugs. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1A This is a Western blot image of the DDX3X knockout cell line constructed using CRISPR-Cas9, as provided in Example 1 of this invention, after lysis. Figure 1B This is a graph showing the level of COL1, a marker of cardiomyocyte fibrosis induced by angiotensin II (ANG), after DDX3X was knocked out, as provided in Embodiment 1 of the present invention.
[0023] Figure 2 This is a graph showing the level of angiotensin II (ANG)-induced cardiomyocyte fibrosis marker (α-SMA) after DDX3X knockdown provided in Example 2 of the present invention.
[0024] Figure 3A This is a graph showing the improvement of cardiac function in an animal model of fibrosis by the DDX3X inhibitor RK-33 provided in Example 3 of this invention. Figure 3B This is a graph showing how the DDX3X inhibitor RK-33 reduces the levels of fibrosis markers in the heart tissue of an animal model of fibrosis. Detailed Implementation
[0025] The technical solution of the present invention will now be described with reference to the accompanying drawings.
[0026] abbreviation:
[0027] EF: Ejection fraction
[0028] FS: Left ventricular fractional shortening
[0029] LVIDs: Left ventricular diameter at end-systole
[0030] LVIDd: Left ventricular end-diastolic diameter
[0031] COL1A2:Collagen Type I Alpha 2Chain
[0032] ANP: Natriuretic peptides A
[0033] FN1: Fibronectin
[0034] SMA: α-smooth muscle actin
[0035] The DDX3X gene, short for DEAD-box helicase 3X-linked, is located on the short arm of chromosome X, region 11.4 (Xp11.4). This gene encodes a protein belonging to the DEAD-box helicases family. Proteins in this family are named for their distinctive "DEAD" (Asp-Glu-Ala-Asp) amino acid sequences, which confer helicase activity. The sequence of the DDX3X gene can be found in NCBI Reference Sequence: NM_001356.5.
[0036] Unless otherwise specified, in the context of this invention, DDX3X includes components such as DDX3X nucleotides and DDX3X protein encoded by DDX3X nucleotides.
[0037] The DDX3X inhibitor refers to a substance that can specifically downregulate the expression level of DDX3X and / or the transcriptional level of its mature mRNA and / or the expression level or activity of DDX3X protein. For example, it can be downregulated by using antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA erasers, target masking and / or multiple targets. Any method that can reduce the level and / or activity of DDX3X is acceptable.
[0038] RK-33 is a small molecule inhibitor of DDX3X (RNA helicase), which inhibits the activity of DDX3X. CAS: 1070773-09-9.
[0039] Example 1
[0040] 1. sgRNA upstream and downstream annealing
[0041] The designed sgRNA sequence is shown in Table 1. The upstream and downstream primers of the sgRNA (10 μM, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) were dissolved using a nuclease-free method. The primer sequences are shown in Table 2. Each primer was dissolved in 5 μL, for a total volume of 10 μL. After dissolving at 95℃ for 5 minutes, the temperature was slowly reduced at 2℃ / min until annealing at 25℃.
[0042] Table 1. Nucleotide sequence information of sgRNA
[0043] DDX3X sgRNA sequence sgRNA1 AGTGGAAAATGCGCTCGGGC(SEQ ID No.1) sgRNA2 TGGTCCCGGAGAGGCTCTGA(SEQ ID No.2) sgRNA3 TGGTGTTAGATGAAGCTGAC(SEQ ID No.3)
[0044] Table 2 sgRNA primer information
[0045] sgRNA1F CACCG AGTGGAAAATGCGCTCGGGC(SEQ ID No.4) sgRNA1R AAAC GCCCGAGCGCATTTTCCACT C(SEQ ID No.5) sgRNA2F CACCGTGGTCCCGGAGAGGCTCTGA(SEQ ID No.6) sgRNA2R AAACTCAGAGCCTCTCCGGGACCA C(SEQ ID No.7) sgRNA3F CACCG TGGTGTTAGATGAAGCTGAC(SEQ ID No.8) sgRNA3R AAAC GTCAGCTTCATCTAACACCA C(SEQ ID No.9)
[0046] 2. Enzyme digestion of lentiCRISPRV2 vector
[0047] A single-enzyme digestion sample was prepared using 500 ng (0.5 μL) of the lentiCRISPRV2 vector (Addgene, 52961), BsmBI (NEB) (20 units / μL) (1 μL), 3.1 μL of 3×NEB Buffer (3 μL), and ddH2O (25.5 μL). The vector lentiCRISPR V2 was digested with the restriction endonuclease BsmbI (conditions: 37℃ for 2 hours / overnight).
[0048] The enzyme-digested samples were separated by electrophoresis using 1% agarose (120V for 30 minutes). The target fragment was identified and cut off on the electrophoresis display. The target fragment was recovered using a gel recovery kit (AXYGEN, AP-GX-50) and following the kit's instructions. The recovered product was used for the next ligation reaction.
[0049] Ligation of annealed sgRNA to the digested vector: Annealing primer (1 μL), digested lentiCRISPRV2 vector (4 μL), T4 ligation buffer, 10× (1 μL), T4 DNA ligase (NEB, MO202) (400 units / μL) (1 μL), ddH2O (3 μL) were added and ligated at 16°C for 2 h / night.
[0050] Transformation: Transform 5 μl of the ligation product into DH5α competent cells (-80°C freezer). Thaw the DH5α competent cells on ice, aliquot the appropriate amount into pre-chilled sterile centrifuge tubes (1.5 mL), add 5 μL of the ligation product, and incubate on ice for 30 minutes. Then heat shock the DH5α competent cells for 60 seconds (42°C), and immediately place them on ice for 2 minutes. Add 600 μL of antibiotic-free LB medium, shake for 45 min–1 h at 37°C and 220 rpm. Centrifuge to allow the bacteria to settle to the bottom of the tube, discard the supernatant, and spread the precipitate onto LB agar plates containing ampicillin (Solepro, A1170, 100 μg / mL). Incubate in an inverted incubator overnight (37°C).
[0051] 2. Colony sequencing identification of recombinant plasmids
[0052] Three colonies were picked from the plate, and positive clones were identified by sequencing from each recombinant plasmid.
[0053] 3. Large-scale extraction of recombinant plasmids
[0054] Inoculate the correctly sequenced bacterial culture at a 1:100 ratio into 250 mL of LB liquid medium supplemented with ampicillin (Solepro, A1170, 100 μg / mL), and incubate with shaking for 16–20 hours (37°C, 220 rpm). Centrifuge for 20 minutes (4°C, 6000 rpm), discard the supernatant to obtain the bacterial precipitate. Extract plasmids using the ZYMO plasmid extraction kit, following these steps:
[0055] 1) Add 105ml of 95% anhydrous ethanol to a final volume of 28ml ZymoPURE. TM Wash in 2 bottles.
[0056] 2) All the following operations are performed at room temperature. Except for P1, which is placed in a 4°C refrigerator and returned to the 4°C refrigerator after use, all other reagents and materials are placed at room temperature.
[0057] The operation steps are as follows:
[0058] 1) Collect bacteria: Pour 50ml of bacterial culture into a 50ml centrifuge tube and centrifuge at 4500rpm for 10 minutes.
[0059] 2) To discard the supernatant, you can press the centrifuge tube opening against absorbent paper;
[0060] 3) Add 8ml of P1, use a 1ml pipette tip to break up the precipitate, and mix thoroughly with vortex;
[0061] 4) Add 8ml of P2, immediately invert and mix 6 times, then let stand at room temperature for 2-3 minutes;
[0062] 5) Add 8ml of P3, invert and mix 5 times or more until the color turns yellow;
[0063] 6) Take out ZymoPURE TM Syringe Filter-X: Pour in the sample from the previous step, let stand at room temperature for 5-8 minutes, allowing the precipitate to float to the top.
[0064] 7) Remove ZymoPURE TM Insert the stopper at the bottom of the Syringe Filter-X, insert the piston, and dispense the supernatant into a new 50 ml centrifuge tube (or more than 20 ml).
[0065] 8) Add 8 ml of ZymoPURE TM Binding Buffer, invert and mix 8 times;
[0066] 9) Zymo-Spin TM V-PS is installed and placed on the vacuum pump;
[0067] 10) Add the clarified liquid from the previous step, turn on the vacuum pump, and suck away the liquid;
[0068] 11) Add 5 ml of ZymoPURE TM Wash 1: Open the vacuum and suck away the liquid;
[0069] 12) Add 5 ml of ZymoPURE TM Wash 2, turn on the vacuum and remove the liquid. Repeat once;
[0070] 13) Remove the small tube with the filter membrane and place it in the collection tube provided with the kit. Incubate at 16000g for 1 minute to remove any residual washing solution. Mark this step with a marker.
[0071] 14) Remove the small tube and place it in a new 1.5 ml centrifuge tube, then add 200 μL of ZymoPURE. TM Elution Buffer, incubate at room temperature for 2 minutes, then centrifuge at 16000g for 1 minute. Elute at room temperature.
[0072] 15) Remove EndoZero TM II. Spin-Column: Place in a new 1.5 mL centrifuge tube, add all 200 μL of elution buffer from the previous step, incubate at room temperature for 2 minutes, then centrifuge at 10000 g for 1 minute.
[0073] 16) Measure the concentration and preserve the plasmid.
[0074] 5. Lentiviral packaging
[0075] 1) 18-20 hours before transfection, seed 293T cells (American Type Culture Collection, ATCC) at approximately 5 × 10⁶ cells per well. 5 When transfecting cells at a confluence of 30%-40%, the confluence should not exceed 60%. Culture in 2 ml of complete DMEM medium per well.
[0076] 2) 1-2 hours before transfection, replace with fresh 1×DMEM and incubate at 37℃ in a 5% CO2 incubator.
[0077] 3) Take 2 micrograms of plasmid, mix it in 300 microliters of 1×DMEM, mix gently, and let it stand at room temperature for 5 minutes;
[0078] 4) Take 4 μL of PEI (branched polyethyleneimine, Sigma-Aldrich, 408727), mix it with 300 μL of 1×DMEM, mix gently, and let stand at room temperature for 5 minutes.
[0079] 5) Gently mix the above plasmid mixture with the PEI mixture and let it stand at room temperature for 20-25 minutes;
[0080] 6) Aspirate the culture medium from the six-well plate, gently add the transfection mixture, shake gently, and incubate in a 5% carbon dioxide incubator at 37°C.
[0081] 7) After 4-6 hours, aspirate the transfection mixture, replace it with 2 ml of fresh complete culture medium, and incubate in a 5% carbon dioxide incubator for 48 hours at 37°C.
[0082] 6) The cell culture supernatant was collected by filtration at 0.45 μm to obtain the packaged virus.
[0083] 6. Viral infection
[0084] Add 1 mL of virus stock solution to 0.5 mL of complete culture medium in a six-well plate. Infect H9c2(2-1) (rat cardiomyocytes) (EallBio) cells for 48-72 hours. Then replace the medium with 2 mL of complete culture medium (Thermofisher C11995, 10% FBS) containing puromycin (invivogen, ant-pr-1, 600 ng / mL) in each well. Use puromycin-containing medium to screen for stable cell lines for further experiments.
[0085] 7. Cell lysis
[0086] 1) Wash twice with PBS (1 ml each time);
[0087] 2) Add 100-200 μL of pre-chilled RIPA cell lysis buffer containing protease inhibitors (LABLEAD, C0101, 1X) ([0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate, 150 mM NaCl, 10 mM Tris (pH 7.5), and 1 mM EDTA]), pipette, and place in a 1.5 ml centrifuge tube;
[0088] 3) Place on ice for 15 minutes, shake for about 10 seconds every 5 minutes, shake 3 times to fully lyse the cells;
[0089] 4) Centrifuge at 12000g for 10 minutes (4℃), and transfer the supernatant to a new centrifuge tube.
[0090] 8. Glue making
[0091] 1) Install the glue-making device: First clean the glass plate and the glue-making device, then install and fix the glass plate.
[0092] 2) Preparation of separating gel: Add the lower gel solution and lower gel buffer solution separately according to the instructions, mix them, and then add the modified coagulant;
[0093] 3) After laying the board, seal it completely with anhydrous ethanol;
[0094] 4) After gelation, pour off the anhydrous ethanol, rinse thoroughly with ddH2O, and then blot dry.
[0095] 5) After preparing the concentrated glue according to the instructions, apply the glue and insert the comb (be careful to be level and quick, and avoid small air bubbles);
[0096] 6) After the concentrated gel is fixed, remove the glass plate, rinse it clean, immerse it in the electrophoresis solution, and store it in a refrigerator at 4°C for later use.
[0097] 9. Coating and Development
[0098] 1) Take the quantified protein sample out of the -20℃ freezer, then put it in a metal bath and boil for 5 minutes. Centrifuge at 6000 rpm for 1 minute at 4℃ for subsequent experiments.
[0099] 2) Proteins are separated using SDS-PAGE gel electrophoresis. Typically, the voltage in the stacking gel is 80V, and the voltage in the separating gel is 180V.
[0100] 3) When the bromophenol blue reaches the specific position, stop the electrophoresis. Following the order of filter paper-gel-NC membrane-filter paper, place the clamp into the electroporation tank and electroporate at 200mA for 2 hours on ice. The electroporation time can be appropriately extended or shortened depending on the size of the protein.
[0101] 4) After electroporation, place the NC membrane in Ponceau S staining solution, cut the target band according to the protein size, and then elute with TBST until no red liquid precipitates.
[0102] 5) Seal with 5% skim milk for 1 hour at room temperature;
[0103] 6) Incubate with primary antibody overnight at 4°C, and wash the membrane three times with TBST for 10 minutes each time;
[0104] Antibody list:
[0105] DDX3X, Proteintech, 81903-1-RR;
[0106] Actin, Proteintech, 60008-1-Ig;
[0107] 7) Add secondary antibodies (Anti-mouse IgG, HRP-linked Antibody, CST, 7076; Anti-rabbit IgG, HRP-linked Antibody, CST, 7074), incubate at room temperature for 1 hour, then wash the membrane 3 times with TBST for 10 minutes each time;
[0108] 8) Add the chemiluminescent solution, develop the solution using a developer, and analyze the Western blot results;
[0109] 10. Add 5 μM Angiotensin II human (Angiotensin II) to the selected stable cell line obtained in step 6 and treat for one day (add 1 μl of angiotensin II to 2 ml of culture medium). Then perform Western blot detection of COL1. The Western blot detection method is the same as in steps 7 to 9. The primary antibody information is as follows: COL1, abcam, ab260043.
[0110] Experimental results
[0111] 1. Results of Western blot analysis of the DDX3X knockout cell line constructed using CRISPR-Cas9 after lysis are shown in [reference]. Figure 1A .from Figure 1A As can be seen, the DDX3X knockout cells constructed using CRISPR-Cas9 successfully knocked out DDX3X.
[0112] 2. Using Ang2 (5μM) to stimulate and induce cardiomyocyte fibrosis, it was found that knocking out endogenous DDX3X in H9C2 cells (rat cardiomyocytes) with CRISPR-Cas9 significantly reduced the degree of cardiomyocyte fibrosis.
[0113] Using Ang2 to induce H9C2 fibrosis, it was found that the fibrosis marker Collagen I (COL-1) was significantly reduced in H9C2 cells with DDX3X knockout. Related results are as follows: Figure 1B As shown. From Figure 1B It can be seen that after knocking out the endogenous DDX3X gene in H9C2 with sgRNA and then inducing with ANG2, the cell fibrosis marker Collagen I (COL1) in H9C2 with the endogenous DDX3X gene knocked out was significantly reduced.
[0114] Example 2
[0115] 1. Cell culture:
[0116] H9c2(2-1) (rat cardiomyocytes) (EallBio), growth medium: DMEM + 10% FBS + 1% P / S (Thermofisher, C11995). Culture conditions: CO2, 5%, temperature: 37℃;
[0117] 2. siRNA knockdown of endogenous DDX3X in H9c2 cells:
[0118] 1) siRNA (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) was transfected using LipofectamineRNAiMAX (Thermofisher, 13778150). The siRNA sequence is shown in Table 3.
[0119] Table 3 siRNA sequence information
[0120] DDX3X siRNA sequence siRNA1-Justice Chain GAUGAAGAUGACUGGUCAA(SEQ ID No.10) siRNA1-antisense strand UUGACCAGUCAUCUUCAUC(SEQ ID No.11) siRNA2-Justice Chain GGAACAGAGAAGCUACUAA(SEQ ID No.12) siRNA2-antisense strand UUAGUAGCUUCUCUGUUCC(SEQ ID No.13) siRNA3-Justice Chain GACCUGAACUCUUCAGAUA(SEQ ID No.14) siRNA3-antisense strand UAUCUGAAGAGUUCAGGUC(SEQ ID No.15)
[0121] 2) Mix 2 μl of siRNA (40 nM) and 6 μl of Lipofectamine RNAiMAX, then add the mixture to a six-well plate of H9c2(2-1) (rat cardiomyocytes). The cell count in the six-well plate is 2.5 * 10-1. 5 ;
[0122] 3) Two days after transfection, add 5 μM of Angiotensin II human (Angiotensin II) (1 μl of angiotensin II is added to 2 ml of culture medium) for one day, and then perform western blot detection of α-SMA.
[0123] The Western blot detection method is the same as steps 7 to 9 in Example 1. The primary antibody information is as follows: SMA, Proteintech, 14395-1-AP.
[0124] Experimental results
[0125] Knockdown of endogenous DDX3X protein levels in H9C2 using siRNA significantly reduced the fibrosis marker α-smooth muscle actin (α-SMA) in H9C2. Related results are as follows: Figure 2 As shown.
[0126] from Figure 2 It can be seen that knocking down the endogenous DDX3X protein level in H9C2 using siRNA significantly reduced the expression level of DDX3X protein. Induction with ANG2 significantly reduced the cellular fibrosis marker α-smooth muscle actin (α-SMA), which was associated with the knockdown of endogenous DDX3X protein in H9C2.
[0127] Example 3 Animal Experiment
[0128] 1. C57BL / 6J mice (Speford (Beijing) Biotechnology Co., Ltd.), male, 8 weeks old;
[0129] 2. Intraperitoneal injection of RK-33 (MCE, HY-100455) (25 mg / kg) three times a week;
[0130] 3. Two weeks later, cardiac fibrosis was induced in mice by subcutaneous injection of isoproterenol hydrochloride (ISO) (MCE, HY-B0468) for 7 days (5 mg / kg);
[0131] 4. Perform echocardiography on mice to measure ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular end-systolic diameter (LVIDs), and left ventricular end-diastolic diameter (LVIDd). The specific steps are as follows:
[0132] (1) Hair was removed from the chest of mice with depilatory cream. After anesthesia with isoflurane at a flow rate of 1.5 ml / min, the mice were placed on an electrode platform at 37°C and the heart rate was controlled between 450-650 bp with continuous administration of isoflurane.
[0133] (2) Apply coupling agent to the upper chest, use a 23MHz ultrasound probe to take the long axis section of the left ventricle, and record the heart function of the mouse in B-Mode and M-Mode respectively. Then rotate the probe 90 degrees and take the short axis section of the left ventricle. Record the heart function of the mouse in B-Mode and M-Mode respectively.
[0134] 5. After echocardiography of the mouse heart, the mice were sacrificed, and the hearts were isolated. RNA was extracted for qPCR. The mRNA levels of fibrosis markers, including COL1A2, ANP, Fibronectin, and α-smooth muscle actin (α-SMA), were detected. The specific steps are as follows:
[0135] a) After the heart tissue was ground in a grinder, RNA was extracted from the tissue according to the instructions of the RNA extraction kit (Novizan, RC112-01), and the concentration of the extracted RNA was detected. The tissue was then stored at -80℃.
[0136] b) Following the reverse transcription kit (TOYOBO, FSQ-301), the RNA sample from the previous step was placed into a PCR instrument for reverse transcription: maintained at 37℃ for 15 minutes, 50℃ for 5 minutes, 98℃ for 5 minutes, and finally stored at 4℃.
[0137] c) The expression level of the target gene mRNA was detected by real-time PCR. The reaction conditions and time were as follows: 94℃ pre-deformation for 30s, followed by 94℃ denaturation for 5s + 60℃ annealing extension for 30s (repeated 40 cycles), then 95℃ for 15s, then 60℃ for 1min, and finally 95℃ for 15s.
[0138] d) Calculate the relative expression levels of each gene: then obtain the CT values of the target gene and the internal reference, and finally compare whether there are differences in gene expression between the two groups.
[0139] Experimental results
[0140] In an isoproterenol (ISO)-induced mouse model of cardiac fibrosis, administration of the DDX3X inhibitor RK-33 significantly improved cardiac fibrosis in mice, resulting in significant improvements in cardiac function (ejection fraction, fractional shortening, end-systolic volume, end-diastolic volume, left ventricular end-systolic dimension, and end-diastolic dimension). The levels of mRNA markers of cardiac fibrosis in mouse tissue were also significantly reduced.
[0141] A. In a mouse model of cardiac fibrosis, administration of RK-33 resulted in significant improvements in cardiac function parameters, including ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular end-systolic diameter (LVIDs), and left ventricular end-diastolic diameter (LVIDd), as observed by echocardiography. Related results are as follows... Figure 3A As shown. From Figure 3AAs can be seen, in the mouse model of cardiac fibrosis, administration of RK-33 significantly improved cardiac function indicators, including ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular end-systolic diameter (LVIDs), and left ventricular end-diastolic diameter (LVIDd), as observed by echocardiography. The "mock" group refers to the negative control group, the "ISO" group refers to the mouse model of cardiac fibrosis, and the "ISO+RK-33" group refers to the mouse model of cardiac fibrosis plus RK-33 treatment.
[0142] B. In a mouse model of cardiac fibrosis, after administration of RK-33, mouse heart tissue was collected, and fibrosis markers were detected. The mRNA levels of COL1A2, ANP, Fibronectin, and α-smooth muscle actin (α-SMA) were found to be significantly reduced. Related results are as follows: Figure 3B As shown. From Figure 3B As can be seen, after administration of RK-33 to the mouse cardiac fibrosis model, the mRNA levels of COL1A2, ANP, Fibronectin, and α-smoothmuscle actin (α-SMA) were significantly reduced when fibrosis markers were detected in the collected mouse heart tissue. The mock group refers to the negative control group, the ISO group refers to the mouse cardiac fibrosis model group, and the ISO+RK-33 group refers to the mouse cardiac fibrosis model group plus the RK-33 treatment group.
[0143] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. The application of DDX3X inhibitors in the preparation of drugs for treating myocardial fibrosis, characterized in that, The DDX3X inhibitor is RK-33, siRNA for silencing the DDX3X gene, or sgRNA for targeted knockout of the DDX3X gene. The siRNA used to silence the DDX3X gene is selected from any one of siRNA1, siRNA2, and siRNA3. The sense strand sequence of siRNA1 is shown in SEQ ID No. 10, and the antisense strand sequence is shown in SEQ ID No. 11; the sense strand sequence of siRNA2 is shown in SEQ ID No. 12, and the antisense strand sequence is shown in SEQ ID No. 13; the sense strand sequence of siRNA3 is shown in SEQ ID No. 14, and the antisense strand sequence is shown in SEQ ID No.
15. The sgRNA used for targeting and knocking out the DDX3X gene is selected from any one of sgRNA1, sgRNA2, and sgRNA3, wherein the nucleotide sequence of sgRNA1 is shown in SEQ ID No.1, the nucleotide sequence of sgRNA2 is shown in SEQ ID No.2, and the nucleotide sequence of sgRNA3 is shown in SEQ ID No.3.
Citation Information
Patent Citations
Potential therapeutics for fibrosis by blocking the increase of a key enzyme
WO2024081018A1