HPIV-3 nano antibody as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to an HPIV-3 nano antibody as well as a preparation method and application thereof. The nano antibody specifically recognizes and binds to the human parainfluenza virus type 3 NP protein, has good affinity with the human parainfluenza virus type 3 NP protein, and can be used for preparing products for diagnosing, preventing and / or treating human parainfluenza virus type 3 infection or diseases caused by the human parainfluenza virus type 3 infection or detecting the existence or level of the human parainfluenza virus type 3 NP protein in a sample.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to HPIV-3 nanobodies and their preparation methods and applications. Background Art

[0002] Human parainfluenza viruses (HPIVs) are a class of enveloped single-stranded negative-strand RNA viruses in the Paramyxoviridae family that can infect humans and various mammals. According to genetics and antigenicity, they can be mainly divided into 4 serotypes (HPIV-1, 2, 3, 4), and HPIV-4 is further divided into two serosubtypes (4A, 4B). Although the main structures of HPIVs are similar, the clinical characteristics and epidemiological features of the diseases they cause are different. Compared with other subtypes of HPIVs, Human parainfluenza virus type 3 (hPIV3) has the highest infection rate, a longer infection duration, and more obvious clinical characteristics. Epidemiological studies have shown that hPIV3 mainly prevails in summer and spring, and is the second most important pathogen causing bronchiolitis and pneumonia in infants under six months old, second only to respiratory syncytial virus (RSV). So far, there are no effective vaccines and therapeutic drugs.

[0003] With the in-depth study of human parainfluenza virus type 3 (HPIV-3), researchers have a clearer understanding of its structure. The structure of HPIV-3 mainly includes a viral genome composed of single-stranded negative-sense RNA, an envelope, and a nucleoprotein (NP) that wraps the RNA and other related proteins. As a key component of the viral structure, NP plays an important role in the replication and transcription processes of the virus. Its main functions include binding to the negative-sense single-stranded RNA to form a ribonucleoprotein complex (RNP), thereby protecting the RNA from degradation. In addition, NP can help the viral RNA polymerase recognize and bind to the RNA template during the transcription and replication processes of the virus, promoting the transcription and replication of viral genes. During virus assembly, NP also participates in the formation of virus particles together with other structural proteins, ensuring the integrity and infectivity of the virus. In addition, as a highly immunogenic protein, NP can activate the host's immune system and induce the production of specific antibodies. Due to its high conservation, NP is relatively consistent among different types of human parainfluenza viruses. Therefore, the development of antibodies against the NP protein of HPIV-3 has become an important research direction in the field of public health, and is expected to provide new ideas for the prevention and detection of virus infections and their related complications. In summary, the nucleoprotein of human parainfluenza virus type 3 plays a crucial role in the virus life cycle, and the resulting antibodies are the key to detecting and resisting virus infections. In-depth understanding of the functions of nucleoproteins and the immune responses they induce helps to develop more effective vaccines and treatment strategies to address the challenges posed by human parainfluenza virus infections.

[0004] During the study of human parainfluenza virus type 3, antibodies are a very important research tool, especially for the prevention of human parainfluenza, which has great value and significance. Developing antibodies against human parainfluenza virus type 3 will provide a powerful tool for researchers, helping to deeply study the functions and regulatory mechanisms of human parainfluenza virus in multiple biological processes such as infection, immune escape, and pathological mechanisms. This will help to better understand the infection mechanism of human parainfluenza virus, provide new directions and targets for the prevention and treatment strategies of human parainfluenza virus type 3, and also provide rich materials for basic biological research. Through the study of antibodies against human parainfluenza virus type 3, scientists can identify and verify the antigenic characteristics of the virus, evaluate the neutralizing ability of the antibodies, and explore their application potential in vaccine development. In addition, antibodies against human parainfluenza virus can also be used for clinical diagnosis to help doctors quickly identify infection cases, thereby formulating more effective treatment plans. In summary, the development and application of antibodies against human parainfluenza virus type 3 not only promote the progress of human parainfluenza virus research, but also provide important support for prevention and control measures in the field of public health. Summary of the Invention

[0005] The purpose of the first aspect of the present invention is to provide a nanobody against human parainfluenza virus type 3 or an antigen-binding fragment thereof.

[0006] The object of the second aspect of the present invention is to provide a human parainfluenza virus type 3 heavy chain antibody or an antigen-binding fragment thereof.

[0007] The object of the third aspect of the present invention is to provide a chimeric antigen receptor.

[0008] The object of the fourth aspect of the present invention is to provide a multispecific antibody or an antigen-binding fragment thereof.

[0009] The object of the fifth aspect of the present invention is to provide an isolated nucleic acid molecule.

[0010] The object of the sixth aspect of the present invention is to provide a vector.

[0011] The object of the seventh aspect of the present invention is to provide a cell.

[0012] The object of the eighth aspect of the present invention is to provide a method for preparing the nanobody or antigen-binding fragment thereof according to the first aspect of the present invention, the heavy chain antibody or antigen-binding fragment thereof according to the second aspect, the chimeric antigen receptor according to the third aspect, or the multispecific antibody or antigen-binding fragment thereof according to the fourth aspect.

[0013] The object of the ninth aspect of the present invention is to provide a conjugate.

[0014] The object of the tenth aspect of the present invention is to provide a pharmaceutical composition.

[0015] The object of the eleventh aspect of the present invention is to provide a diagnostic or therapeutic kit.

[0016] The object of the twelfth aspect of the present invention is to provide the use of the nanobody or antigen-binding fragment thereof according to the first aspect of the present invention, the heavy chain antibody or antigen-binding fragment thereof according to the second aspect, the chimeric antigen receptor according to the third aspect, the multispecific antibody or antigen-binding fragment thereof according to the fourth aspect, the nucleic acid molecule according to the fifth aspect, the vector according to the sixth aspect, the cell according to the seventh aspect, the conjugate according to the ninth aspect, or the pharmaceutical composition according to the tenth aspect.

[0017] In order to achieve the above object, the technical solution adopted by the present invention is:

[0018] The first aspect of the present invention provides a human parainfluenza virus type 3 nanobody or an antigen-binding fragment thereof, and the human parainfluenza virus type 3 nanobody or antigen-binding fragment thereof includes:

[0019] CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 12, 17, 22, 26, 31, 36, 41, 46, or 51.

[0020] Human parainfluenza virus type 3 nanobody or its antigen-binding fragment, wherein the human parainfluenza virus type 3 nanobody or its antigen-binding fragment comprises: a heavy chain variable region, and the heavy chain variable region comprises:

[0021] a1) CDR-H1 having the amino acid sequence shown in SEQ ID NO:9, CDR-H2 having the amino acid sequence shown in SEQ ID NO:10, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:11; or

[0022] a2) CDR-H1 having the amino acid sequence shown in SEQ ID NO:14, CDR-H2 having the amino acid sequence shown in SEQ ID NO:15, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:16; or

[0023] a3) CDR-H1 having the amino acid sequence shown in SEQ ID NO:19, CDR-H2 having the amino acid sequence shown in SEQ ID NO:20, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:21; or

[0024] a4) CDR-H1 having the amino acid sequence shown in SEQ ID NO:24, CDR-H2 having the amino acid sequence shown in SEQ ID NO:25, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:21; or

[0025] a5) CDR-H1 having the amino acid sequence shown in SEQ ID NO:28, CDR-H2 having the amino acid sequence shown in SEQ ID NO:29, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:30; or

[0026] a6) CDR-H1 having the amino acid sequence shown in SEQ ID NO:33, CDR-H2 having the amino acid sequence shown in SEQ ID NO:34, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:35; or

[0027] a7) CDR-H1 having the amino acid sequence shown in SEQ ID NO:38, CDR-H2 having the amino acid sequence shown in SEQ ID NO:39, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:40; or

[0028] a8) CDR-H1 having the amino acid sequence shown in SEQ ID NO:43, CDR-H2 having the amino acid sequence shown in SEQ ID NO:44, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:45; or

[0029] a9) CDR-H1 having the amino acid sequence shown in SEQ ID NO: 48, CDR-H2 having the amino acid sequence shown in SEQ ID NO: 49, and CDR-H3 having the amino acid sequence shown in SEQ ID NO: 50.

[0030] In some embodiments, the heavy chain variable region of the human parainfluenza virus type 3 nanobody or its antigen-binding fragment further comprises a framework region of the heavy chain variable region.

[0031] In some embodiments, the framework region of the heavy chain variable region comprises a framework region of the heavy chain variable region of an immunoglobulin derived from a mouse, primate, bovine, equine, porcine, ovine, caprine, canine, feline, rabbit, camel, donkey, deer, mink, chicken, duck, or goose, or a mutant thereof.

[0032] In some embodiments, the human parainfluenza virus type 3 nanobody or its antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 12, 17, 22, 26, 31, 36, 41, 46, or 51, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0033] In a second aspect of the present invention, there is provided a human parainfluenza virus type 3 heavy chain antibody or its antigen-binding fragment, which comprises an immunoglobulin Fc domain and the nanobody or its antigen-binding fragment of the first aspect of the present invention.

[0034] In some embodiments, the immunoglobulin Fc domain comprises an Fc domain of an immunoglobulin derived from a mouse, primate, bovine, equine, porcine, ovine, caprine, canine, feline, rabbit, camel, donkey, deer, mink, chicken, duck, or goose, or a mutant thereof.

[0035] In a third aspect of the present invention, there is provided a chimeric antigen receptor, which comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, and the antigen-binding domain comprises the nanobody or its antigen-binding fragment of the first aspect of the present invention or the heavy chain antibody or its antigen-binding fragment of the second aspect of the present invention.

[0036] In a fourth aspect of the present invention, there is provided a multispecific antibody or its antigen-binding fragment, which comprises two or more (e.g., three or four) antigen-binding domains, and one of the antigen-binding domains comprises the nanobody or its antigen-binding fragment of the first aspect of the present invention or the heavy chain antibody or its antigen-binding fragment of the second aspect of the present invention.

[0037] A fifth aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the nanobody of the first aspect of the present invention or an antigen-binding fragment thereof, the heavy-chain antibody of the second aspect of the present invention or an antigen-binding fragment thereof, the chimeric antigen receptor of the third aspect of the present invention, or the multispecific antibody of the fourth aspect of the present invention or an antigen-binding fragment thereof.

[0038] Those skilled in the art will understand that the nucleotides in the nucleic acid molecule can be replaced according to codon degeneracy. In some embodiments, the nucleotide sequence of the nucleic acid molecule is codon-optimized.

[0039] In some embodiments, the nucleotide sequence encoding the nanobody of the first aspect of the present invention or an antigen-binding fragment thereof comprises: SEQ ID NO: 13, 18, 23, 27, 32, 37, 42, 47, or 52, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity therewith.

[0040] A sixth aspect of the present invention provides a vector comprising the nucleic acid molecule of the fifth aspect of the present invention.

[0041] In some embodiments, the vector can be an expression vector. In some embodiments, the expression vector can include eukaryotic cell expression vectors and / or prokaryotic cell expression vectors. In some embodiments, the eukaryotic expression vectors include, for example, but are not limited to yeast expression vectors, mammalian expression vectors, and insect expression vectors. For example, the expression vector can include, but is not limited to, plasmids, retroviral vectors, lentiviral vectors, phage vectors, adenoviral vectors, adeno-associated vectors, or herpes simplex vectors.

[0042] In some embodiments, the vector can be selected from nanoparticles, liposomes, exosomes, microvesicles, or gene guns.

[0043] A seventh aspect of the present invention provides a cell comprising the nanobody of the first aspect of the present invention or an antigen-binding fragment thereof, the heavy-chain antibody of the second aspect of the present invention or an antigen-binding fragment thereof, the chimeric antigen receptor of the third aspect of the present invention, the multispecific antibody of the fourth aspect of the present invention or an antigen-binding fragment thereof, the nucleic acid molecule of the fifth aspect of the present invention, or the vector of the sixth aspect of the present invention.

[0044] In some embodiments, the cell does not relate to propagating materials.

[0045] In some embodiments, the cell can be a host cell conventionally used in the art, as long as it can stably express the nucleic acid molecule carried by the expression vector as the above-mentioned nanobody or its antigen-binding fragment, heavy-chain antibody or its antigen-binding fragment, chimeric antigen receptor or multispecific antibody or its antigen-binding fragment of the present disclosure. In some embodiments, the host cell can be a prokaryotic cell and / or a eukaryotic cell. The prokaryotic cell can include, for example, Escherichia coli, and the eukaryotic cell can include, for example, CHO cells, HEK293 cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, HeLa cells, Vero cells, Expi293 cells, hybridoma cells, yeast cells, and insect cells.

[0046] In some embodiments, the cell can be an immune cell. In some embodiments, the immune cell can include, but is not limited to, T cells, NK cells, DC cells, and macrophages. In these embodiments, the immune cell can express the above-mentioned chimeric antigen receptor of the present disclosure (i.e., a modified immune cell).

[0047] The eighth aspect of the present invention provides a method for preparing the nanobody or its antigen-binding fragment according to the first aspect of the present invention, the heavy-chain antibody or its antigen-binding fragment according to the second aspect, the chimeric antigen receptor according to the third aspect, or the multispecific antibody or its antigen-binding fragment according to the fourth aspect, which is obtained by culturing the cell according to the seventh aspect of the present invention.

[0048] The ninth aspect of the present invention provides a conjugate, which includes the nanobody or its antigen-binding fragment according to the first aspect of the present invention, or the heavy-chain antibody or its antigen-binding fragment according to the second aspect; and a conjugate part.

[0049] In some embodiments, the conjugate part can include, but is not limited to, a detectable marker or a therapeutic agent.

[0050] In some embodiments, the detectable label may be any substance that can be detected by means such as fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electrochemistry, optics, chemistry, etc. Such labels are well known in the art, and examples thereof include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, β-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g., 3H, 125I, 35S, 14C or 32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas red, rhodamine, quantum dots or cyanine dye derivatives (e.g., Cy7, Alexa 750)), acridinium ester compounds, magnetic beads, calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) microbeads, and biotin for binding avidin (e.g., streptavidin) modified with the above labels. In some embodiments, such labels are applicable to immunoassays (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescent immunoassay, etc.). In some embodiments, the detectable label is selected from radioactive isotopes, fluorescent substances, luminescent substances, colored substances or enzymes. In some embodiments, the detectable label as described above can be linked to the nanobody or its antigen-binding fragment, or heavy-chain antibody or its antigen-binding fragment of the present disclosure through linkers of different lengths to reduce potential steric hindrance.

[0051] In some embodiments, the detectable label may include, but is not limited to, enzymes (e.g., horseradish peroxidase), radionuclides, fluorescent dyes, luminescent substances (e.g., chemiluminescent substances), colored substances, biotin, etc.

[0052] In some embodiments, the therapeutic agent may include, for example, but is not limited to, drugs for preventing and / or treating human parainfluenza virus type 3 infection or diseases caused thereby.

[0053] In some embodiments, the coupling moiety is selected from substances that can improve the biological properties of the antibody (e.g., increase serum half-life), and may be, for example, chemical groups such as polyethylene glycol (PEG), methyl, ethyl or glycosyl.

[0054] The tenth aspect of the present invention provides a pharmaceutical composition, which includes: the nanobody or its antigen-binding fragment of the first aspect of the present invention, the heavy-chain antibody or its antigen-binding fragment of the second aspect, the chimeric antigen receptor of the third aspect, the multispecific antibody or its antigen-binding fragment of the fourth aspect, the nucleic acid molecule of the fifth aspect, the vector of the sixth aspect, the cell of the seventh aspect or the conjugate of the ninth aspect; and a pharmaceutically acceptable carrier.

[0055] In some embodiments, the pharmaceutical composition may further comprise an additional pharmaceutically active agent.

[0056] In some embodiments, the additional pharmaceutically active agent may be a biologically active drug, such as a drug capable of preventing and / or treating human parainfluenza virus type 3 infection or a disease caused thereby.

[0057] In some embodiments, the antibody or its antigen-binding fragment and the additional pharmaceutically active agent are provided as separate components or as a mixed component.

[0058] In some embodiments, the pharmaceutical composition can be administered by, for example, parenteral, subcutaneous injection, sublingual, rectal, nasal, intravenous injection, intramuscular injection, oral, ocular, topical and other means.

[0059] In some embodiments, the pharmaceutical composition is in the form of, for example, an aqueous solution, suspension, powder, tablet, capsule, granule, powder, pill, disintegrant, syrup, spray, gel, emulsion, injection, elixir, lozenge, suppository, etc.

[0060] The eleventh aspect of the present invention provides a diagnostic or therapeutic kit, which comprises: the nanobody or its antigen-binding fragment of the first aspect of the present invention, the heavy-chain antibody or its antigen-binding fragment of the second aspect, the chimeric antigen receptor of the third aspect, the multispecific antibody or its antigen-binding fragment of the fourth aspect, the nucleic acid molecule of the fifth aspect, the vector of the sixth aspect, the cell of the seventh aspect, the conjugate of the ninth aspect, or the pharmaceutical composition of the tenth aspect.

[0061] In some embodiments, the kit may further comprise instructions and / or a dosing device.

[0062] In some embodiments, the kit can be used for diagnosing human parainfluenza virus type 3 infection or a disease caused thereby.

[0063] In some embodiments, the kit can be used for preventing and / or treating human parainfluenza virus type 3 infection or a disease caused thereby.

[0064] The twelfth aspect of the present invention provides the use of the nanobody or its antigen-binding fragment of the first aspect of the present invention, the heavy-chain antibody or its antigen-binding fragment of the second aspect, the chimeric antigen receptor of the third aspect, the multispecific antibody or its antigen-binding fragment of the fourth aspect, the nucleic acid molecule of the fifth aspect, the vector of the sixth aspect, the cell of the seventh aspect, the conjugate of the ninth aspect, or the pharmaceutical composition of the tenth aspect in the preparation of a product for any one of c1)-c3):

[0065] c1) Diagnosing human parainfluenza virus type 3 infection or diseases caused thereby;

[0066] c2) Preventing and / or treating human parainfluenza virus type 3 infection or diseases caused thereby;

[0067] c3) Detecting the presence or level of human parainfluenza virus type 3 NP protein in a sample.

[0068] In some embodiments, the sample is selected from at least one of body fluids, tissues, cells, and excreta of a subject to be tested.

[0069] In some embodiments, the body fluid comprises at least one of blood and lymph fluid.

[0070] In some embodiments, the blood includes at least one of serum, plasma, dried blood spot, and whole blood.

[0071] In some embodiments, the excreta comprises at least one of urine, feces, and tears.

[0072] In some embodiments, the subject to be tested includes mammals, such as humans, non-human primates (such as orangutans, apes), rodents (such as rats, mice, guinea pigs), pets (such as cats, dogs), and livestock (such as horses, cows, sheep, pigs, rabbits).

[0073] In some embodiments, the subject to be tested includes humans.

[0074] In some embodiments, the amino acid sequence of the human parainfluenza virus type 3 NP protein comprises SEQ ID NO:1.

[0075] In the present invention, the diseases caused by human parainfluenza virus type 3 infection include at least one of pneumonia and bronchiolitis.

[0076] The beneficial effects of the present invention are:

[0077] The present invention provides a nanobody against human parainfluenza virus type 3 or an antigen-binding fragment thereof, which can specifically recognize and bind to the human parainfluenza virus type 3 NP protein, and has good affinity with it, and can be used to prepare products for diagnosing, preventing and / or treating human parainfluenza virus type 3 infection or diseases caused thereby, or detecting the presence or level of human parainfluenza virus type 3 NP protein in a sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 Shows a schematic diagram of the detection result of the affinity between nanobody 2A8 and the antigen.

[0079] Figure 2 Shows a schematic diagram of the detection result of the affinity between nanobody 1H2 and the antigen.

[0080] Figure 3 The schematic diagram of the detection result of the affinity between nanobody 3C9 and the antigen is shown.

[0081] Figure 4 The schematic diagram of the detection result of the affinity between nanobody 3G5 and the antigen is shown.

[0082] Figure 5 The schematic diagram of the detection result of the affinity between nanobody 2C4 and the antigen is shown.

[0083] Figure 6 The schematic diagram of the detection result of the affinity between nanobody 4D12 and the antigen is shown.

[0084] Figure 7 The schematic diagram of the detection result of the affinity between nanobody 3F8 and the antigen is shown.

[0085] Figure 8 The schematic diagram of the detection result of the affinity between nanobody 4B3 and the antigen is shown.

[0086] Figure 9 The schematic diagram of the detection result of the affinity between nanobody 4A12 and the antigen is shown. Detailed implementation manners

[0087] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in combination with embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0088] Definition

[0089] Unless otherwise defined, all technical terms and scientific and technical terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of explaining this specification, the following definitions will be applied, and where appropriate, terms used in the singular form will also include the plural form, and vice versa.

[0090] Unless the context clearly indicates otherwise, the expressions "a" and "an" used herein include plural referents. For example, referring to "a cell" includes multiple such cells and equivalents known to those skilled in the art and the like.

[0091] The term "about" used herein represents a range of ±20% of the value following it. In some embodiments, the term "about" represents a range of ±10% of the value following it. In some embodiments, the term "about" represents a range of ±5% of the value following it.

[0092] K D Value : The dissociation constant (K D ) is a specific type of equilibrium constant that measures the tendency of a larger object to separate (dissociate) from a smaller component and is the reciprocal of the association constant, with units of mol / L (M) or nmol / L (nM). K D The smaller the value, the stronger the binding ability of the two substances.

[0093] Nanobody : Antibodies lacking light chains that are naturally present in the peripheral blood of camelids. This antibody contains only one variable heavy chain region (VHH) and two conventional CH2 and CH3 regions, but it is not as prone to sticking to each other or even aggregating into clumps as artificially engineered single-chain antibody fragments; the VHH structure cloned and expressed alone has structural stability equivalent to that of the original heavy-chain antibody and binding activity to antigens and is the smallest known unit capable of binding to target antigens; the VHH crystal is 2.5 nm in size, 4 nm in length, and has a molecular weight of only about 15 kD, so it is also called a nanobody (Nb). Compared with traditional animals such as mice and rabbits that can only recognize flat polypeptides on the antigen surface, the immune system in camelids can recognize complex spatial structures on the antigen surface and can produce highly specific and high-affinity nanobodies.

[0094] Different from traditional technologies that rely on classical model animals such as mice, rabbits, monkeys, and sheep, the technical solution of the present invention relies on antibodies produced by the immune system of alpacas and is called "nanobodies". Nanobodies are tiny antibody fragments isolated from immunoglobulins in animals such as camels. It has the same antigen-binding ability and structural stability as intact antibodies and is the smallest existing unit capable of binding to target antigens, with a relative molecular mass of only about 15 kD. Compared with traditional animals such as mice and rabbits that can only recognize flat polypeptides on the antigen surface, the immune system in animals such as alpacas can recognize complex spatial structures on the antigen surface and can produce highly specific and high-affinity nanobodies.

[0095] According to the technical solution of the present invention, certain amino acids in the amino acid sequence can be conservatively substituted without changing the activity or function of the protein, as shown in Table 1 below.

[0096] Table 1

[0097] Residue Conservative substitution Residue Conservative substitution Ala Ser Leu Ile; Val Arg Lys Lys Arg; Gln Asn Gln; His Met Leu; Ile Asp Glu Phe Met; Leu; Tyr Gln Asn Ser Thr; Gly Cys Ser Thr Ser; Val Glu Asp Trp Tyr Gly Pro Tyr Trp; Phe His Asn; Gln Val Ile; Leu Ile Leu; Val

[0098] In addition, due to the degeneracy of bases, the bases in the polynucleotide sequence can be substituted without changing the activity or function of the polynucleotide sequence, as shown in Table 2 below.

[0099] Table 2

[0100]

[0101]

[0102] Examples and accompanying drawings are provided below to assist in understanding the present invention. It should be understood that these examples and drawings are only for illustrating the present invention and do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0103] Example 1. Preparation of antigen

[0104] (1) Construct a DNA sequence encoding the human parainfluenza virus type 3 NP protein into the pET-28a Escherichia coli expression vector to form a recombinant expression plasmid of human parainfluenza virus type 3 NP;

[0105] (2) Transfect the recombinant expression plasmid of human parainfluenza virus type 3 NP into BL21(DE3) competent cells, and culture to obtain a monoclonal strain expressing the human parainfluenza virus type 3 NP protein;

[0106] (3) Culture the strain in large quantities at 37 °C, and then add 0.4 mM inducer (IPTG, isopropyl-β-D-thiogalactoside) at 16 °C to induce the expression of the human parainfluenza virus type 3 NP protein.

[0107] (4) Collect all the bacteria, and after processes such as lysis, centrifugation, affinity chromatography, and gel filtration chromatography, obtain the recombinant human parainfluenza virus type 3 NP protein.

[0108] The amino acid sequence of recombinant human parainfluenza virus type 3 NP protein is as follows: MLSLFDTFNARRQENITKSAGGAIIPGQKNTVSIFALGPTITDDNEKMTLALLFLSHSLDNEKQHAQRAGFLVSLLSMAYANPELYLTTNGSNADVKYVIYMIEKDLKRQKYGGFVVKTREMIYEKTTEWIFGSDLDYDQETMLQNGRNNSTIEDLVHTFGYPSCLGALIIQIWIVLVKAITSISGLRKGFFTRLEAFRQDGTVQAGLVLSGDTVDQIGSIMRSQQSLVTLMVETLITMNTSRNDLTTIEKNIQIVGNYIRDAGLASFFNTIRYGIETRMAALTLSTLRPDINRLKALMELYLSKGPRAPFICILRDPIHGEFAPGNYPAIWSYAMGVAVVQNRAMQQYVTGRSYLDIDMFQLGQAVARDAEAQMSSTLEDELGVTHEAKESLKRHIRNINSSETSFHKPTGGSAIEMAIDEEPEQFEHRADQEQDGEPQSSIIQYAWAEGNRSDDRTEQATESDNIKTEQQNIRDRLNKRLNDKKKQGSQPSTNPTNRTNQDEIDDLFNAFGSN (SEQ ID NO:1).

[0109] Its corresponding nucleotide sequence is as follows:

[0110] ATGCTGTCCCTGTTTGACACTTTCAACGCACGCCGTCAGGAAAACATTACCAAGTCTGCTGGTG

[0111] GCGCTATTATCCCGGGCCAGAAAAACACTGTCAGCATCTTTGCACTGGGCCCGACCATCACGGATG

[0112] ACAATGAAAAAATGACGCTGGCGCTGCTGTTTCTGTCTCACTCCCTGGATAACGAAAAACAGCATG

[0113] CTCAGCGCGCAGGCTTCCTGGTAAGCCTGCTGTCTATGGCATATGCCAACCCGGAACTGTATCTGAC

[0114] CACCAACGGCTCCAACGCTGACGTGAAATACGTCATCTACATGATTGAGAAGGACCTGAAACGTCA

[0115] AAAATACGGTGGTTTCGTGGTGAAAACCCGCGAAATGATCTACGAAAAGACCACCGAATGGATCTT

[0116] CGGCTCCGATCTGGACTATGATCAAGAAACCATGCTGCAGAACGGTCGTAATAACTCTACCATCGA

[0117] AGATCTGGTTCACACTTTCGGCTATCCATCCTGTCTGGGTGCACTGATTATCCAGATTTGGATCGTG

[0118] CTGGTGAAGGCTATTACGTCTATCTCTGGTCTGCGTAAAGGTTTTTTCACTCGTCTGGAGGCGTTTC

[0119] GTCAGGATGGTACTGTCCAGGCGGGCCTGGTTCTGTCCGGTGATACTGTTGACCAGATTGGTTCTAT

[0120] TATGCGTTCCCAGCAGTCCCTGGTAACTCTGATGGTTGAAACTCTGATCACCATGAACACTTCTCGC

[0121] AACGATCTGACCACTATCGAAAAGAACATCCAGATCGTGGGCAACTACATCCGTGATGCTGGTCTG

[0122] GCATCCTTCTTTAATACCATCCGTTATGGTATCGAAACCCGCATGGCTGCTCTGACCCTGTCCACTC

[0123] TGCGTCCAGACATCAATCGTCTGAAAGCGCTGATGGAACTGTACCTGAGCAAAGGCCCGCGCGCGC

[0124] CATTTATCTGCATCCTGCGCGATCCGATTCACGGCGAGTTCGCTCCGGGCAACTATCCGGCGATTTG

[0125] GAGCTACGCGATGGGCGTTGCGGTTGTTCAGAACCGCGCTATGCAACAGTACGTCACTGGTCGCTC

[0126] CTACCTGGACATCGACATGTTCCAACTGGGTCAGGCTGTAGCACGTGATGCAGAAGCCCAGATGTC

[0127] CAGCACTCTGGAAGATGAACTGGGCGTTACCCACGAAGCGAAAGAGTCTCTGAAACGCCACATCC

[0128] GTAACATCAACTCTTCCGAAACTAGCTTCCATAAACCTACCGGTGGTTCCGCAATCGAAATGGCCA

[0129] TCGACGAGGAACCTGAACAGTTCGAGCATCGTGCGGACCAGGAACAGGATGGTGAACCTCAGTCTT

[0130] CCATTATCCAGTACGCTTGGGCTGAAGGTAACCGCTCCGACGACCGCACTGAACAGGCTACCGAGT

[0131] CCGATAACATCAAAACCGAACAGCAGAATATCCGCGATCGTCTGAACAAACGTCTGAACGACAAA

[0132] AAAAAACAGGGTTCTCAGCCGTCCACCAACCCAACCAACCGTACTAACCAGGATGAGATCGATGA

[0133] CCTGTTCAACGCATTCGGTTCTAAT(SEQ ID NO:2)。

[0134] Example 2. Alpaca Immunization Injection

[0135] In this example, the recombinant human parainfluenza virus type 3 NP protein of Example 1 was used to immunize alpacas. The specific steps are as follows:

[0136] (1) The antigen in Example 1 (recombinant human parainfluenza virus type 3 NP protein) was evenly divided into 4 portions, each portion being approximately 0.5 mg; the alpaca was immunized 4 times in total. The antigen was subcutaneously injected into the animal body. The first immunization was on the 1st day, and the subsequent immunizations were on the 11th day, 21st day, and 31st day respectively.

[0137] (2) On the 30th day, before the fourth immunization injection, approximately 200 mL of peripheral venous blood of the alpaca was collected.

[0138] (3) On the 45th day, that is, 14 days after the fourth immunization, approximately 200 mL of peripheral venous blood of the alpaca was collected.

[0139] Compared with the traditional immunization technical solutions for antibodies of animals such as mice and rabbits, the technical advantage of the present invention lies in collecting a large amount of peripheral venous blood of alpacas, which is beneficial to subsequent screening for highly diverse nanobodies.

[0140] Example 3. Construction of a nanobody library of alpacas

[0141] Using the two batches of peripheral venous blood of alpacas collected in Example 2 as raw materials, a highly diverse nanobody library was constructed. The processing methods of the two batches of peripheral venous blood of alpacas were the same, and the specific steps were as follows:

[0142] (1) Lymphocytes were isolated from the peripheral venous blood of alpacas by methods such as density gradient centrifugation.

[0143] (2) The total mRNA of lymphocytes was extracted and reverse transcribed into cDNA.

[0144] (3) Using appropriate DNA primers (see Table 3 below), with the above cDNA as a template, the VHH fragments of alpaca immunoglobulin IgG2 and IgG3, that is, the DNA fragments of nanobodies, were amplified by polymerase chain reaction (PCR).

[0145] Table 3. Primers used for constructing the nanobody library

[0146]

[0147]

[0148] (4) The DNA of VHH was ligated to the phage surface display screening vector phen1 to form a plasmid library of VHH-pIII fusion protein expression vectors; among them, pIII is a protein present on the flagellum on the surface of the phage.

[0149] (5) The DNA ligation product was transformed into TG1 competent Escherichia coli by electrotransformation method. After appropriate culture, all the colonies were collected, which was the nanobody library of alpacas.

[0150] Compared with the traditional method of isolating antibodies from the sera or lymphocytes of animals such as mice and rabbits, the present invention can long-term preserve the entire nanobody fragments (i.e., the library) of alpacas and can continuously support the subsequent screening and development of nanobodies.

[0151] Example 4. Screening of specific nanobodies by phage display

[0152] In this example, the nanobody library obtained in Example 3 was used as the source, and antigen-specific nanobodies were obtained by phage display screening. The specific steps are as follows:

[0153] (1) Take an appropriate amount of the cryopreserved nanobody library, inoculate it into a bacterial medium, and after appropriate culture, add an appropriate amount of helper phage (M13KO7 helper phage, NEB, N0315S), and continue to culture under appropriate conditions;

[0154] (2) Extract the phages amplified in the bacterial culture supernatant by the PEG-NaC method;

[0155] (3) Incubate the phages with the antigen (the recombinant human parainfluenza virus type 3 NP protein in Example 1), and the antigen is pre-fixed in an immunotube (Maxisorp immunotube, ThermoFisher Scientific);

[0156] (4) Washing: Discard the phages, and then wash the antigen with PBS buffer for an appropriate number of times (3-5 times) to wash away and remove the phages that non-specifically bind to the antigen, and retain the phages that specifically bind to the antigen;

[0157] (5) Elution: Treat the phages that specifically bind to the antigen with an acidic glycine solution to dissociate and retain the phages from the antigen.

[0158] So far, phages expressing specific nanobodies have been obtained, and these phages can be subjected to the following technical operations:

[0159] (6) Transform into a specific nanobody library: Infect the phages into TG1 competent Escherichia coli again for culture, but no helper phage is added. After the phages are completely infected, the specific nanobodies exist in the form of DNA plasmids in Escherichia coli. Collect all these Escherichia coli, which becomes an antigen-specific nanobody library. Using this library as the raw material, return to step (1) for the next round of phage display screening;

[0160] (7) Transformation into monoclonal nanobody colonies: Take a small amount of the phage obtained in step (5) (such as 0.5%), dilute it and then infect the TG1 competent Escherichia coli cultured again, but no helper phage is added. After the phage infection is complete, spread these Escherichia coli evenly on a bacterial culture dish and culture it appropriately to obtain monoclonal colonies containing nanobody DNA plasmids. Using these monoclonal colonies as raw materials, positive monoclonal nanobodies are identified.

[0161] Example 5. Identification of positive monoclonal nanobodies and nanobody sequencing

[0162] In this example, the bacterial culture dish with monoclonal colonies obtained in step (7) of Example 4 is used for the identification of positive monoclonal nanobodies. The specific steps are as follows:

[0163] (1) Pick monoclonal colonies and culture them in a microplate;

[0164] (2) Add IPTG to induce the expression of VHH-pIII (i.e., the fusion protein containing the nanobody);

[0165] (3) Collect the bacterial culture supernatant containing the nanobody and incubate it with the antigen (the recombinant human parainfluenza virus type 3 NP protein in Example 1). The antigen is pre-fixed on a 96-well microplate (Maxisorp transparent microplate, ThermoFisher Scientific). Using enzyme-linked immunosorbent assay (ELISA), detect whether the monoclonal nanobody binds to the antigen. The main experimental steps are as follows:

[0166] 1) Coating: Dilute the antigen with PBS to 5 μg / mL, 50 μL / well, and incubate it with shaking at 4 °C overnight;

[0167] 2) Blocking: The next day, discard the antigen and add 100 μL / well of PBS-2% BSA and incubate it with shaking at room temperature for 1 hour;

[0168] 3) Washing: Wash 3 times with PBST and 3 times with PBS, 150 μL / well;

[0169] 4) Add the culture supernatant, 50 μL / well, and incubate it with shaking at room temperature for 1 - 2 hours;

[0170] 5) Washing: Wash 3 times with PBST and 3 times with PBS, 150 μL / well;

[0171] 6) Add diluted anti-myc HRP and incubate it at room temperature for 1 hour;

[0172] 7) Washing: Wash 3 times with PBST and 3 times with PBS, 150 μL / well;

[0173] 8) Add the ELISA chromogenic substrate and incubate in the dark at room temperature for 30 min;

[0174] 9) Read OD450nm;

[0175] (4) For the monoclonal nanobodies (2A8, 1H2, 3C9, 3G5, 2C4, 4D12, 3F8, 4B3, 4A12) that can specifically recognize and bind to the antigen, after the TG1 strain expressing the relevant monoclonal nanobody is cultured overnight at 37 °C, extract the DNA plasmid and perform Sanger sequencing to obtain the nucleotide sequence of the nanobody, and then obtain the amino acid sequence of the nanobody after translation, as shown in Table 4-12 specifically.

[0176] Table 4: Amino acid sequence and nucleotide sequence of 2A8

[0177]

[0178] Table 5: Amino acid sequence and nucleotide sequence of 1H2

[0179]

[0180] Table 6: Amino acid sequence and nucleotide sequence of 3C9

[0181]

[0182]

[0183] Table 7: Amino acid sequence and nucleotide sequence of 3G5

[0184]

[0185] Table 8: Amino acid sequence and nucleotide sequence of 2C4

[0186]

[0187]

[0188] Table 9: Amino acid sequence and nucleotide sequence of 4D12

[0189]

[0190] Table 10: Amino acid sequence and nucleotide sequence of 3F8

[0191]

[0192] Table 11: Amino acid sequence and nucleotide sequence of 4B3

[0193]

[0194]

[0195] Table 12: Amino acid sequence and nucleotide sequence of 4A12

[0196]

[0197] Example 6. Small-scale recombinant expression and purification of monoclonal nanobodies

[0198] (1) Monoclonal nanobodies capable of specifically recognizing and binding to antigens were obtained in Example 5. The DNA plasmids encoding the above nanobodies (2A8, 1H2, 3C9, 3G5, 2C4, 4D12, 3F8, 4B3, 4A12) were transformed into BL21(DE3) competent cells, and the nanobodies were recombinantly expressed and purified by Escherichia coli, with a batch production capacity of about several milligrams.

[0199] (2) Using the ELISA method, different concentrations of nanobodies were incubated, and the affinity between the nanobodies and the antigen (recombinant human parainfluenza virus type 3 NP protein in Example 1) was measured according to the binding ability of the nanobodies to the antigen.

[0200] The detection results are as Figures 1-9 shown. The affinity values K of the monoclonal nanobodies 2A8, 1H2, 3C9, 3G5, 2C4, 4D12, 3F8, 4B3, 4A12 are D 2.212 nM, 7.464 nM, 7.692 nM, 8.373 nM, 77.24 nM, 17.80 nM, 18.06 nM, 28.78 nM, 33.24 nM, respectively.

[0201] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. A human parainfluenza virus type 3 nanobody or an antigen-binding fragment thereof, wherein the human parainfluenza virus type 3 nanobody or an antigen-binding fragment thereof comprises: CDR-H1, CDR-H2, and CDR-H3 included in a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 12, 17, 22, 26, 31, 36, 41, 46, or 51.

2. The nanobody or an antigen-binding fragment thereof according to claim 1, wherein the human parainfluenza virus type 3 nanobody or an antigen-binding fragment thereof comprises: a heavy chain variable region, and the heavy chain variable region comprises: a1) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 9, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 10, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 11; or a2) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 14, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 15, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 16; or a3) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 19, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 20, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 21; or a4) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 24, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 25, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 21; or a5) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 28, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 29, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 30; or a6) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 33, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 34, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 35; or a7) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 38, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 39, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 40; or a8) CDR-H1 having an amino acid sequence as shown in SEQ ID NO: 43, CDR-H2 having an amino acid sequence as shown in SEQ ID NO: 44, and CDR-H3 having an amino acid sequence as shown in SEQ ID NO: 45; or a9) CDR-H1 having the amino acid sequence shown in SEQ ID NO: 48, CDR-H2 having the amino acid sequence shown in SEQ ID NO: 49, and CDR-H3 having the amino acid sequence shown in SEQ ID NO: 50; Preferably, the heavy chain variable region of the human parainfluenza virus type 3 nanobody or its antigen-binding fragment further comprises a framework region of the heavy chain variable region; Preferably, the framework region of the heavy chain variable region comprises a framework region of the heavy chain variable region of an immunoglobulin derived from a mouse, a primate, a bovine, a horse, a bovine, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck or a goose or a mutant thereof; Preferably, the human parainfluenza virus type 3 nanobody or its antigen-binding fragment comprises a heavy chain variable region, which comprises the amino acid sequence shown in SEQ ID NO: 12, 17, 22, 26, 31, 36, 41, 46, or 51, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity therewith.

3. A human parainfluenza virus type 3 heavy chain antibody or its antigen-binding fragment, which comprises an immunoglobulin Fc domain and the nanobody or its antigen-binding fragment according to any one of claims 1-2.

4. A chimeric antigen receptor, which comprises an antigen-binding domain, a transmembrane domain and an intracellular signaling domain, and the antigen-binding domain comprises the nanobody or its antigen-binding fragment according to any one of claims 1-2 or the heavy chain antibody or its antigen-binding fragment according to claim 3.

5. A multispecific antibody or its antigen-binding fragment, which comprises two or more antigen-binding domains, and one of the antigen-binding domains comprises the nanobody or its antigen-binding fragment according to any one of claims 1-2 or the heavy chain antibody or its antigen-binding fragment according to claim 3.

6. An isolated nucleic acid molecule, which comprises a nucleotide sequence encoding the nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, or the multispecific antibody or its antigen-binding fragment according to claim 5.

7. A vector, which comprises the nucleic acid molecule according to claim 6.

8. A cell, which comprises the nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, the multispecific antibody or its antigen-binding fragment according to claim 5, the nucleic acid molecule according to claim 6, or the vector according to claim 7.

9. The method for preparing the nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy-chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, or the multispecific antibody or its antigen-binding fragment according to claim 5 is obtained by culturing the cell according to claim 8.

10. A conjugate, which comprises the nanobody or its antigen-binding fragment according to any one of claims 1-2, or the heavy-chain antibody or its antigen-binding fragment according to claim 3; and a conjugation moiety; Preferably, the conjugation moiety comprises a detectable label or a therapeutic agent; Preferably, the detectable label comprises an enzyme, a radionuclide, a fluorescent dye, a luminescent substance, a colored substance, and / or biotin; Preferably, the therapeutic agent comprises a drug for preventing and / or treating human parainfluenza virus type 3 infection or a disease caused thereby.

11. Pharmaceutical composition, comprising: The nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy-chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, the multispecific antibody or its antigen-binding fragment according to claim 5, the nucleic acid molecule according to claim 6, the vector according to claim 7, the cell according to claim 8, or the conjugate according to claim 10; and a pharmaceutically acceptable carrier; Preferably, the pharmaceutical composition further comprises an additional pharmaceutically active agent.

12. Diagnostic or therapeutic kit, comprising: The nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy-chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, the multispecific antibody or its antigen-binding fragment according to claim 5, the nucleic acid molecule according to claim 6, the vector according to claim 7, the cell according to claim 8, the conjugate according to claim 10, or the pharmaceutical composition according to claim 11; Preferably, the kit further comprises an instruction manual and / or a dosing device.

13. Use of the nanobody or its antigen-binding fragment according to any one of claims 1-2, the heavy-chain antibody or its antigen-binding fragment according to claim 3, the chimeric antigen receptor according to claim 4, the multispecific antibody or its antigen-binding fragment according to claim 5, the nucleic acid molecule according to claim 6, the vector according to claim 7, the cell according to claim 8, the conjugate according to claim 10, or the pharmaceutical composition according to claim 11 in the preparation of a product for any one of c1)-c3): c1) Diagnosing human parainfluenza virus type 3 infection or a disease caused thereby; c2) Preventing and / or treating human parainfluenza virus type 3 infection or a disease caused thereby; c3) Detecting the presence or level of human parainfluenza virus type 3 NP protein in a sample.

Images