SNP (Single Nucleotide Polymorphism) molecular marker related to major quantitative trait site of epididymis weight of Hu sheep and application of SNP molecular marker
Through genome-wide association studies, the SNP molecular markers of chromosome 9 of Huyang chromosome 9 were screened, which solved the problem of lack of weight-related markers in the epididymis, and achieved efficient assessment of fertility of Huyang fertility and accelerated breeding process.
Patent Information
- Application Number
- CN202510745752.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-06-05
AI Technical Summary
The lack of effective molecular markers in the prior art is used to screen SNP sites related to the weight of the epididymis of the lake sheep, which leads to difficulty in assessing the fertility of the lake sheep and affects the breeding process and efficiency.
Genome-wide association study (GWAS) was used to screen out the SNP molecular markers located in chromosome 9 of Huyang, with polymorphic bases of C/T. Significant correlation sites were screened through univariate linear mixing model analysis, and detection kits were designed for genotype detection to achieve early selection of Huyang individuals with excellent epididymis weight traits.
It provides a fast and accurate method to screen out individuals of high-fertility lake sheep, improve breeding efficiency, meet market demand, and achieve genetic improvement of epididymis weight and breeding accuracy.
Smart Images

Figure CN120350139A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of genetic breeding and molecular biology, and particularly relates to an SNP molecular marker related to a major quantitative trait locus (QTL) of the epididymal weight of Hu sheep and its application. Background Art
[0002] Hu sheep is a unique sheep breed in China, with advantages such as estrus throughout the year, early sexual maturity, multiple births, and fast growth and development, and is widely distributed throughout the country. In recent years, the phenomenon of "emphasizing introduction and neglecting cultivation" has become increasingly prominent, resulting in the mixing of Hu sheep breed resources, the loss of excellent genes, and a downward trend in reproductive performance, seriously restricting the sustainable development of the Hu sheep industry.
[0003] Fertility is one of the important economic traits in livestock production. Improving livestock fertility can not only reduce the production cost of animal husbandry and improve production economic benefits, but also accelerate the livestock breeding process, promote the cultivation of new breeds, and improve the quality of livestock breeds. In the modern meat sheep production system, improving the utilization rate and coverage of excellent breeding rams can quickly improve the reproductive efficiency, production capacity, and genetic improvement speed of the flock, while reducing the disease risk and maximizing the breeding benefits of meat sheep. There are many indicators for evaluating the fertility of male animals, and the common ones are ejaculate volume and semen quality, such as fresh sperm motility, post-thaw motility, sperm density, and sperm malformation rate. However, due to the complex operation and low repeatability of semen quality evaluation, and most semen quality traits have low heritability and are easily affected by factors such as age, temperature, nutritional level, and season, it is difficult to objectively and accurately evaluate them. The epididymis is one of the important organs in the male reproductive system, responsible for sperm maturation and storage, and consists of a long and curved tubule, including four anatomical regions: the initial segment, head, body, and tail. Immature sperm produced in the testis must undergo the transport process in the epididymis to obtain mature sperm with the ability to move and fertilize. Research shows that rams with high fertility can produce more sperm, and transport the sperm through the epididymal duct to the tail of the epididymis for storage, resulting in an increase in the diameter of the epididymal duct, an increase in the number of sperm in the tail of the epididymis, and a corresponding increase in epididymal weight. In addition, in individuals with a large epididymal weight, the content of n-3 polyunsaturated fatty acids in the tail of the epididymis is higher, the level of reactive oxygen species is lower, and the antioxidant capacity is stronger. Therefore, screening molecular markers related to the epididymal weight of rams and applying molecular marker-assisted selection (MAS) can rapidly improve the fertility of rams.
[0004] Compared with traditional breeding methods, MAS can effectively improve the accuracy of selecting complex economic traits, reduce breeding costs, and improve breeding efficiency. However, the candidate genes and molecular markers related to the epididymal weight of livestock reported so far are very limited. Screening SNPs and candidate genes significantly related to epididymal weight and developing molecular markers for assisted selection and breeding design will accelerate the process and precision of breeding high-reproductive Hu sheep. Genome-wide association study (GWAS) is a research method that uses gene chips or high-throughput genotyping technologies to genotype the entire genome of a population and, through statistical methods, associates the phenotypes of complex traits with the genotypes of each genetic variant, thereby identifying genetic variants significantly related to the phenotypes. In recent years, GWAS has become the mainstream method internationally for screening genetic markers significantly associated with complex traits, providing strong support for analyzing the genetic mechanisms of complex traits and precision breeding. Currently, researchers have conducted GWAS on various important economic traits in sheep and identified molecular markers and candidate genes related to traits such as coat color, growth and development, reproduction, and diseases, but there is a lack of research on genetic markers and candidate genes related to the epididymal weight of Hu sheep. Summary of the Invention
[0005] In view of the difficult evaluation of semen quality in male livestock and its susceptibility to multiple factors, and the fact that epididymal weight is related to the fertility of rams, and the current limited technical status of candidate genes and molecular markers related to the epididymal weight of livestock. The purpose of the present invention is to provide an SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight and its application.
[0006] To achieve the above object, the present invention adopts the following technical solutions to be realized:
[0007] The present invention provides an SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight, and the SNP molecular marker is located in the intergenic region between the PPDPF and SNTG1 genes on chromosome 9 of Hu sheep, and the polymorphic base is C / T.
[0008] The SNP molecular marker is located at the 151bp position in the nucleotide sequence shown in SEQ ID NO.1.
[0009] A screening method for the SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight, comprising:
[0010] (1) Collect testicular and epididymal molecular samples of Hu sheep, measure and record the traits related to the major QTL of Hu sheep testicular weight;
[0011] (2) Extract DNA from the samples in step (1) by jugular vein blood collection;
[0012] (3) constructing a library based on the DNA extracted in step (2), and performing library quality detection and sequencing;
[0013] (4) Mutation detection and SNP site screening;
[0014] (5) Whole-genome association analysis, screening of significant association loci, functional annotation, and obtaining SNP molecular markers associated with the major quantitative trait loci of epididymal weight in Hu sheep.
[0015] The method screens significant association sites based on whole genome association analysis, and uses a univariate linear mixed model to perform correlation analysis between SNP sites and phenotypes.
[0016] The univariate linear mixed model formula is: y=Wα+xβ+g+e, where y is the individual phenotypic value, W is the fixed effect matrix, α is the fixed effect vector; x is the genotype of the SNP, β is the effect value of the SNP additive effect, g is the random effect, and e is the random residual.
[0017] The application of the SNP molecular marker associated with the main quantitative trait locus of Hu sheep epididymis weight in Hu sheep molecular marker assisted breeding.
[0018] The application of the SNP molecular marker associated with the main quantitative trait locus of Hu sheep epididymis weight in the assisted selection breeding of Hu sheep total epididymis weight.
[0019] The application of the SNP molecular marker associated with the major quantitative trait locus of Hu sheep epididymis weight in the preparation of a detection kit.
[0020] The detection kit comprises primers designed using nucleotide sequences on both sides of the SNP molecular marker site related to the main quantitative trait site of Hu sheep epididymis weight, and a reagent for detecting the genotype of the SNP molecular marker in Hu sheep individuals.
[0021] A method for detecting the genotype of Hu sheep, comprising designing primers according to the nucleotide sequences on both sides of the SNP molecular marker site related to the major quantitative trait site QTL of Hu sheep epididymis weight, collecting blood from the Hu sheep lamb to be tested after birth and extracting genomic DNA, using the primers to perform genotyping on the Hu sheep material to be tested, and determining the genotype of the Hu sheep to be tested at the SNP site.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] The SNP molecular marker associated with the major quantitative trait locus (QTL) of epididymis weight of Hu sheep provided by the present invention provides an important genetic marker for genetic research and molecular breeding of epididymis weight of Hu sheep, helps to more accurately locate and analyze the relationship between the marker and epididymis weight of Hu sheep, and also provides a more accurate target for subsequent gene editing and breeding operations.
[0024] The screening method of SNP molecular markers related to the major quantitative trait locus (QTL) of the epididymis weight in Hu sheep provided by the present invention provides an effective tool for discovering new genetic markers. This method includes steps such as sample collection, DNA extraction, library construction, whole-genome resequencing, variant detection, SNP locus screening, genome-wide association analysis, and functional annotation, and can systematically screen out SNP molecular markers related to the epididymis weight of Hu sheep.
[0025] The application of the SNP molecular markers provided by the present invention, through the application of specific SNP molecular markers (located at position 33127527 on chromosome 9 of Hu sheep, with polymorphic bases C / T), by using this marker for early selection, can more effectively screen out Hu sheep individuals with excellent epididymis weight traits, accelerate the breeding process, and improve breeding efficiency; by using this marker for assistant selection of the total epididymis weight, can more effectively improve the genetic level of the total epididymis weight of Hu sheep and meet market demand; applying the SNP molecular markers to the preparation of detection kits provides a rapid and accurate method for the genetic detection of the epididymis weight of Hu sheep.
[0026] The present invention proposes a method for detecting the genotype of Hu sheep, a method for detecting the genotype of Hu sheep based on SNP molecular markers, which provides an effective tool for the genetic research and breeding work of Hu sheep, can accurately determine the genotype of Hu sheep at the SNP locus, and provides basic data for subsequent genetic analysis and breeding operations. Brief Description of the Drawings
[0027] Figure 1 It is for the linkage disequilibrium analysis of candidate SNPs within the major QTL interval related to the epididymis weight of the present invention;
[0028] Figure 2 It is for the comparison of the differences in epididymis weight among different genotypes of the SNP molecular marker rs419414147 of the present invention. Detailed Embodiments
[0029] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0030] Definition Explanation
[0031] Linkage disequilibrium (LD): It refers to the phenomenon that alleles at two or more loci in the genome co-occur in the population at a frequency higher than random combination.
[0032] Gene Annotation: It refers to the process of identifying, locating, and functionally describing genes and their related functional elements in the genomic sequence. Its core goal is to analyze the biological significance of the genomic sequence and provide basic data for subsequent genetic research, functional genomics analysis, and molecular breeding, etc.
[0033] ANNOVAR: A tool for gene annotation, used for variant annotation and functional prediction, and can integrate multiple databases for gene annotation.
[0034] Quantitative Trait Locus (QTL): It is a chromosomal region in the genome that is significantly associated with quantitative trait variation and usually contains one or more genes (or regulatory elements) affecting this trait.
[0035] Quantitative trait: It refers to a complex trait affected by multiple genes and environmental factors, such as the yield of crops, the weight of livestock, the height or blood pressure of humans, etc. These traits show continuous distribution in the population and cannot be simply classified.
[0036] The present invention will be further described in detail below with reference to the accompanying drawings:
[0037] Example 1
[0038] The present invention provides an SNP molecular marker related to the major quantitative trait locus (QTL) of the epididymal weight of Hu sheep, and the screening method specifically includes the following steps:
[0039] 1. Selection and feeding management of experimental animals
[0040] During the period from 2018 to 2022, a total of 3028 Hu sheep male lambs were selected as experimental animals from 8 large-scale Hu sheep farms in 9 batches in this study. All experimental animals were weaned and received standardized disease immunization at 56 ± 8.4 d, and then transported to Defu Agricultural Science and Technology Co., Ltd. in Minqin County (Meat Sheep Performance Testing Center of Lanzhou University, Minqin, China). Each lamb was transferred to a fattening pen (0.8 m × 1.0 m) in the sheep house for single pen feeding. All batches of sheep were fed under the same nutritional and feeding management conditions. The nutritional ratio was prepared according to the nutritional requirement standard of fattening sheep in NRC (2007) and made into total mixed ration pellet feed.
[0041] 2. Trait measurement and sample collection
[0042] When feeding to 180 days, slaughter according to the sheep slaughter operating procedures. After slaughter, quickly dissect and separate the testicular and epididymal tissues of each individual. Use a thousandth single pan balance to weigh the left epididymal weight (LEW) and right epididymal weight (REW), and calculate the total epididymal weight (TEW). Exclude the stunted sheep, and those with cryptorchidism and testicular inflammation in the experimental population, and then exclude outliers in the phenotypic data of each batch by drawing box plots. Use SPSS Statistics 25.0 to perform descriptive statistics on the epididymal weight data, and the results are shown in Table 1.
[0043] Table 1: Descriptive statistics of epididymal weight
[0044]
[0045] 3. Genomic DNA extraction and sequencing
[0046] (1) Sample collection and DNA extraction
[0047] Before slaughtering all sheep at 180 days, collect about 5 mL of jugular venous blood samples using a vacuum blood collection tube containing EDTA anticoagulant. Invert the blood collection tube to fully mix the anticoagulant with the blood and store it in a -20 °C refrigerator for subsequent genomic DNA extraction. According to the steps for extracting blood genomic DNA in the Blood Genomic DNA Kit, extract the blood genomic DNA.
[0048] (2) DNA quality detection
[0049] Use 1% agarose gel and NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) to detect the integrity and concentration of the extracted DNA respectively. The NanoDrop OD 260 / 280 value of the DNA sample is between 1.8 and 2.0, and the concentration is greater than 50 ng / μL for qualified quality inspection.
[0050] (3) Library construction
[0051] DNA library construction and genome resequencing were completed by Novogene Co., Ltd. The DNA library construction process includes DNA fragmentation, end repair, addition of A tail, adapter ligation, and PCR enrichment.
[0052] (4) Library quality detection
[0053] Use Qubit2.0 and Agilent 2100 to detect the concentration and insert fragment size of the constructed library respectively. Use quantitative polymerase chain reaction (Q-PCR) to accurately quantify the effective concentration of the library.
[0054] (5) Sequencing and data processing
[0055] On the Illumina NovaSeq 6000 sequencing platform, the qualified libraries were subjected to whole-genome resequencing using a 150bp paired-end (PE150) sequencing strategy. The Trimmomatic software was used to quality-control the raw data obtained from sequencing, deleting adapter sequences in Illumina library construction, reads containing more than 10% unknown bases, reads containing more than 40% low-quality bases (base quality value < 15), and potential PCR duplicate sequences.
[0056] 4. Variant detection and SNP site screening
[0057] (1) Aligning clean reads to the reference genome
[0058] The Burrows-Wheeler Alignment - Maximal Exact Match (BWA-MEM) algorithm was used to align the quality-controlled clean reads to the sheep reference genome (ARS-UI Ramb v2.0, GCA 016772045.1).
[0059] (2) Sorting and deduplicating bam files
[0060] SAMtools (v 1.10) and PicardTools (http: / / broadinstitute.github.io / picard) were used to sort and deduplicate the bam files.
[0061] (3) Variant detection
[0062] The GATK (v 4.1.8) software was used for variant detection, which specifically included the following steps: ① Using HaplotypeCaller to generate gVCF files for each sample; ② Using the CombineGVCFs module to merge multiple GVCF files into a large GVCF file; ③ Using the GenotypeGVCFs module to perform joint genotype analysis on the merged GVCF file and output the final VCF file.
[0063] (4) Variant hard filtering
[0064] The bcftools (v 1.18) software was used to perform hard filtering on the identified variant set, with the specific parameters as follows: INFO / DP<10311|INFO / DP>92802|QD < 2.0|QUAL < 30.0|MQ < 40.0|FS > 60.0|ReadPosRankSum < -8.0|MQRankSum < -12.5|SOR > 3.0. A total of 51,750,417 SNP sites were obtained after hard filtering.
[0065] (5) Further filter SNP sites
[0066] Use PLINK software to filter out low-quality SNP sites with SNP call rate < 80% and Minor allele frequency (MAF) < 0.05. Finally, 23,168,716 high-quality autosomal SNPs were retained for subsequent analysis.
[0067] 5. Genome-wide association study
[0068] (1) Prune the autosomal SNPs obtained from quality control to obtain independent SNP sites
[0069] Perform linkage disequilibrium (LD) pruning on the SNPs obtained from quality control using --indep-pairwise 1000 50 0.2 in PLINK. Finally, 521,215 independent SNP sites were obtained. The significance threshold at the genome level was determined to be 9.59e-08 (0.05 / 521215) by the Bonferroni correction method, and the suggestive threshold was set at 1e-06. Use PLINK software for principal component analysis (PCA).
[0070] (2) Use GCTA software to perform univariate linear mixed model analysis to screen for significantly associated SNP sites
[0071] GWAS analysis was performed using the fastGWA method in the GCTA software. This method uses a sparse GRM to accelerate calculations and is a fast genome-wide association study (GWAS) method based on the linear mixed model (LMM). Its basic formula is: y = Wα + xβ + g + e, where y is the individual phenotype value, W is the fixed effect matrix, α is the fixed effect vector; x is the genotype of the SNP, β is the effect value of the SNP additive effect, g is the random effect, and e is the random residual. The GRM calculated for all SNPs was used as the independent variable; the farm-year-season effects of the experimental animals were integrated into the batch fixed effects (a total of 9 batches); the first 3 principal components of the PCA were added as covariates to the GWAS model to minimize the influence of population stratification. In addition, to exclude the bias caused by the live weight before slaughter on the analysis results, the live weight before slaughter was added as a numerical covariate to the GWAS model.
[0072] (3) Linkage disequilibrium analysis and gene annotation
[0073] LD analysis was performed on the identified significant SNPs using the HaploView software. Gene annotation was performed on the significant SNP loci obtained from GWAS using ANNOVAR. The sheep reference genome version used was ARS-UI Ramb v2.0 (GCA016772045.1). The GWAS results showed that the signal strongly associated with epididymis weight was located within a 235.92 kb region on Chr9: 33,001,025 - 33,236,946. This major QTL contained 8 significant SNP loci, all located in the intergenic region of the candidate genes PPDPFL and SNTG1. Haplotype analysis showed that among the 8 candidate SNPs, 2 of them formed 1 LD block (attached Figure 1 ). 9_33127527 was selected from the LD block as the SNP molecular marker tightly linked to the QTL, and its detailed information is shown in Table 2.
[0074] Table 2: Detailed information of SNP molecular markers
[0075]
[0076] The 150 bp base sequences before and after the SNP molecular marker are shown as SEQ: NC_056062.1|:33127377 - 33127677 Ovis aries strain OAR_USU_Benz2616 breed Rambouillet chromosome 9, ARS-UI_Ramb_v3.0, whole genome shotgun sequence
[0077] CTTAAAAGTAGCCAGCTTAAAATCACTCTGCGTCTAGCACAAAAGAACTGTACAAAAAAGATCTTGATGACCCAGATAATCGTGATGGTGTGATCACTCACCTAGAGCCAGACATCCTGGAATGTGAAGTCAAGTGGGCCTGAATTCCAG[C / T]TGAGCTCTTTCAAATCCTGAAAGATGATGCTGTGAAAGTGCTGCA CTCAACATGCCAGCAAATTTGGAATACTCACCAGTGGCCACAGGACTGGA AAAGGTCAGGTTTCATTCCAGTCCCAAAGAAAGGCAATGCTAAAGAATGC TCAAA (as shown in SEQ ID NO.1)
[0078] (4) Verification of the association between SNP locus and phenotype
[0079] Use PLINK software to extract the genotyping results of all sequenced individuals at 33,127,527 bp on chromosome 9, and use the non-parametric Kruskal-Wallis test to analyze the differences in epididymis weight among different genotypes of rs419414147. P < 0.05 is considered statistically significant. The results are shown in Figure 2 and Table 3 below.
[0080] Table 3: Association between different SNP genotypes and TEW, LEW, and REW
[0081]
[0082] The above results indicate that the SNP molecular marker significantly affects the epididymis weight. Among them, the TEW (36.66 g) of individuals with the CC genotype is significantly lower than that of the TC (40.42 g) and TT genotypes (42.52 g) (P < 0.01) ( Figure 2 ). This indicates that there is a significant association between rs419414147 C>T and the epididymis weight, and individuals with the T allele have a greater epididymis weight. Therefore, in the breeding of Hu sheep, the above SNP molecular marker can be used to design primers on the nucleotide sequences on both sides of it. After the male lambs of Hu sheep are born, blood is collected and genomic DNA is extracted. The primers are used to genotype the male lambs to be tested to determine whether the individual carries the T allele, and individuals with the T allele are selected and retained, which can achieve the early selection of rams with high fertility.
[0083] The above content is only for explaining the technical idea of the present invention, and the protection scope of the present invention cannot be limited thereby. Any modification made on the basis of the technical solution according to the technical idea proposed by the present invention falls within the protection scope of the claims of the present invention.
Claims
1. A SNP molecular marker related to the major quantitative trait locus of the epididymis weight of Hu sheep, characterized in that, The SNP molecular marker is located on chromosome 9 of Hu sheep, in the intergenic region between the PPDPF and SNTG1 genes, and the polymorphic base is C / T.
2. The SNP molecular marker related to the major effective quantitative trait locus of the epididymis weight of Hu sheep according to claim 1, wherein The SNP molecular marker is located within a 235.92 kb region on Chr9: 33001025-33236946.
3. The SNP molecular marker related to the major effective quantitative trait locus of the epididymis weight of Hu sheep according to claim 1, characterized in that, The SNP molecular marker is located at the 151bp position in the nucleotide sequence shown in SEQ ID NO.
1.
4. A screening method for SNP molecular markers related to the major quantitative trait locus of the epididymal weight of Hu sheep according to any one of claims 1 to 3, characterized in that It includes: (1) Collect testicular and epididymal molecular samples of Hu sheep, measure and record the traits related to the major QTL of Hu sheep testicular weight. (2) Extract DNA from the samples in step (1) by jugular vein blood collection. (3) Based on the DNA extracted in step (2), construct a library, and perform library quality detection and sequencing. (4) Variant detection and SNP locus screening. (5) Genome-wide association analysis, screen for significantly associated loci, perform functional annotation, and obtain SNP molecular markers related to the major quantitative trait locus of Hu sheep epididymal weight.
5. The screening method of SNP molecular markers related to the major quantitative trait locus of the epididymis weight of Hu sheep according to claim 4, characterized in that For screening significantly associated loci based on genome-wide association analysis, a univariate linear mixed model is used to analyze the correlation between SNP loci and phenotypes.
6. The screening method of SNP molecular markers related to the major effective quantitative trait locus of the epididymal weight of Hu sheep according to claim 5, characterized in that The formula of the univariate linear mixed model is: y = Wα + xβ + g + e, where y is the individual phenotype value, W is the fixed effect matrix, α is the fixed effect vector; x is the genotype of the SNP, β is the effect value of the SNP additive effect, g is the random effect, and e is the random residual.
7. The application of the SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight described in any one of claims 1 to 3 in Hu sheep molecular marker-assisted breeding.
8. The application of the SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight described in any one of claims 1 to 3 in Hu sheep epididymal total weight-assisted selection breeding.
9. The application of the SNP molecular marker related to the major quantitative trait locus of Hu sheep epididymal weight described in any one of claims 1 to 3 in the preparation of a detection kit.
10. The application according to claim 9, characterized in that The detection kit includes primers designed using the nucleotide sequences flanking the SNP molecular marker locus related to the major quantitative trait locus of Hu sheep epididymal weight, and reagents for detecting the genotype of this SNP molecular marker in Hu sheep individuals.
Citation Information
Patent Citations
FAM151B gene molecular marker related to testis traits of Hu sheep and application of FAM151B gene molecular marker
CN116144786A
SNP (Single Nucleotide Polymorphism) molecular marker related to Hu sheep testis size character as well as screening method and application of SNP molecular marker
CN119410794A
Sheep single nucleotide polymorphism (SNP) molecular marker and use thereof in detecting resistance to brucellosis in sheep
US20250122583A1