Method for breeding rabbit variety with increased growth speed

Abstract

The invention is suitable for the technical field of rabbit breeding, and provides a method for breeding a rabbit variety with an improved growth speed. According to the invention, a rabbit variety with an improved growth rate is cultivated by using an SpRY-CBE gene editing technology, a specific sgRNA sequence is designed aiming at a CEP104 gene sequence of a New Zealand rabbit, base mutation is carried out on a C site at the sixth site of the sequence, embryo transplantation is carried out after embryo injection, and a new rabbit variety with an improved growth rate is successfully obtained. According to the method, a new thought of animal genetic breeding is developed, a new rabbit model or strain is created, the growth speed of rabbits is effectively increased, and significant improvement of genetic characters is achieved. The achievement is of great significance for promoting the development of the livestock breeding industry in China and improving the economic benefits of the animal industry, and meanwhile, a new way is provided for improving the economic value of animals.

Description

Technical Field

[0001] The present invention belongs to the technical field of rabbit breeding, and particularly relates to a method for cultivating rabbit breeds with improved growth rate. Background Art

[0002] The proportion of the breeding industry in China's economy is gradually increasing, and the development of the rabbit industry has received extensive attention. With the rapid development of modern biotechnology, the continuous in-depth research on animal genetic breeding technology, and the growth of industrialization demand, the cultivation of animal improved breeds is undergoing a transformation from traditional breeding methods mainly based on quantitative traits to molecular breeding technology based on rapid genotype changes. The application of the new CRISPR / Cas9 gene editing technology SpRY-CBE has achieved unrestricted PAM mutations, thus accelerating the genetic breeding program of important production traits in rabbits and being beneficial to improving the economic value of animals. Many studies have adopted the candidate gene method to identify DNA markers related to economically relevant traits (such as meat quality and carcass traits, reproductive and growth traits) in meat animals. It is worth noting that in the clinical cases of human non-syndromic familial tall stature, a common heterozygous mutation p.G18S was found in the ciliary gene family CEP104 in tall members during the identification of family genetic candidate variant genes, which provides a clue for the identification of genetic candidate variant genes.

[0003] China has rich local rabbit breed resources, but these breeds generally face problems such as slow growth and low meat production capacity. Therefore, the present invention proposes a method for cultivating rabbit breeds with improved growth rate. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for cultivating rabbit breeds with improved growth rate, aiming to solve the problems raised in the above background art.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] A method for cultivating rabbit breeds with improved growth rate includes the following steps:

[0007] Step 1: Construction of the sgRNA expression vector;

[0008] Design a sgRNA target sequence for CEP104 p.Gly25Ser of New Zealand rabbits, synthesize a pair of oligonucleotide chains. The oligonucleotide chains are annealed at 95 °C for 5 min and cooled to room temperature to form double-stranded sgRNA. Use the BbsI restriction endonuclease to linearize the PUC57 vector, and after agarose gel electrophoresis of the linearized vector, recover the gel. Finally, ligate the double-stranded sgRNA with the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, then digest with enzymes overnight at 37 °C, after electrophoresis, use an ordinary DNA agarose gel recovery kit for recovery;

[0009] The sequences of the oligonucleotide chains are as follows:

[0010] sgRNA-F: GAAGCCGTCTTCATGTCCAG;

[0011] sgRNA-R: CTGGACATGAAGACGGCTTC;

[0012] Step 2: Transcription and synthesis of SpRY-CBE mRNA;

[0013] The SpRY-CBE plasmid is digested with enzymes overnight at 37 °C to form linear DNA, and recovered by agarose gel electrophoresis. The recovered product is purified by chloroform extraction, and then the transcription and synthesis of SpRY-CBE are carried out according to the instructions of the in vitro transcription kit;

[0014] Step 3: Preparation of CEP104 gene-edited rabbits by embryo microinjection technology;

[0015] After mixing the synthesized sgRNA and SpRY-CBE, aspirate them into the injection needle for embryonic nucleus injection. The injected fertilized eggs are transplanted into the oviducts of synchronized recipient female rabbits. After the female rabbits are pregnant for 25 days, they are transferred to the delivery room until the due date, and finally CEP104 gene-edited rabbits are obtained;

[0016] Step 4: Identification of rabbit genomes;

[0017] Extract DNA from the ear tissues of the obtained CEP104 gene-edited rabbits, perform PCR using the designed PCR primers. After completing PCR, carry out electrophoresis identification. If the PCR amplification is successful, sequence the PCR product to obtain the genotype identification result;

[0018] The designed PCR primers are as follows:

[0019] Forward primer: GGATCCACAACGCTGGTTA;

[0020] Reverse primer: ACCCTCTGGGACACAATTTC.

[0021] Further, in step 1, the digestion system is: 20 μL of PUC57 plasmid, 20 μL of 10× Buffer, 1 μL of BbsⅠ, and 159 μL of ddH2O; the gel recovery process is: digest overnight at 37°C, after agarose gel electrophoresis, use a common DNA agarose gel recovery kit for recovery.

[0022] Further, in step 2, the digestion system is: 1 μL of AgeI, 1 μL of xBaI, 20 μL of SpRY-CBE plasmid, 10 μL of rCut Smart Buffer, and 18 μL of ddH2O;

[0023] The transcription synthesis system is: 1 μg of linear SpRY-CBE, 10 μL of NTP Buffer, 2 μL of T7 RNApolymerase, and 5 μL of ddH2O;

[0024] The transcription synthesis process is: after mixing, incubate at 37°C for 1 h; after transcription is completed, add 1 μL of DNaseI to digest the transcription template, react at 37°C for 15 min, and then add a polyA tail.

[0025] Further, the specific process of step 3 is: using a microinjector, mix the synthesized sgRNA at 12 ng / μL and SpRY-CBE at 70 ng / μL, aspirate 2.5 μL into the injection needle, perform embryonic cell nuclear injection, transfer the injected fertilized eggs into the oviduct of synchronized recipient female rabbits, after the female rabbits are pregnant for 25 days, transfer them to the delivery room until the due date, and finally obtain CEP104 gene-edited rabbits.

[0026] Further, in step 4, the PCR reaction system is: 1.5 μL of template DNA, 2 μL of upstream primer, 2 μL of downstream primer, 12.5 μL of 2× Taqplus, and 7 μL of ddH2O; the PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0027] Further, in step 4, if the C at the 6th position of the sgRNA sequence mutates to T, it proves that a single-base mutation is obtained.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] The present invention discloses a method for cultivating rabbit breeds with improved growth rate by using the SpRY-CBE gene editing technology. The advantage of this technology is that there is no sequence recognition restriction on the PAM region. The design inspiration comes from the design mutation of the tall stature locus in the human non-syndromic family. The present invention designs a specific sgRNA sequence for the CEP104 gene sequence of New Zealand rabbits, realizes the base mutation of the C site at the 6th position of the sequence, and after embryo injection, embryo transfer is carried out, and a new rabbit breed with improved growth rate is successfully obtained. The present invention not only opens up a new idea for animal genetic breeding, but also creates a new rabbit model or strain, effectively improves the growth rate of rabbits, and realizes the significant improvement of genetic traits. This achievement is of great significance for promoting the development of China's livestock and poultry breeding industry and enhancing the economic benefits of the animal industry, and also provides a new way to improve the economic value of animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a schematic diagram of the design of sgRNA.

[0031] Figure 2 It is a sanger sequencing map of the CEP104 gene mutation in newborn rabbits.

[0032] Figure 3 It is a comparison of the body lengths of normal rabbits at 3 months old and CEP104 gene-edited rabbits.

[0033] Figure 4 It is a comparison of the body lengths of normal rabbits and CEP104 gene-edited rabbits at 100 days old.

[0034] Figure 5 It is a statistical chart of the weight changes of normal rabbits and CEP104 gene-edited rabbits within 100 days. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0035] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will be described in detail below, but it should not be construed as a limitation on the scope of implementation of the present invention.

[0036] The following describes the specific implementation of the present invention in detail in combination with specific embodiments.

[0037] The present invention provides a method for cultivating rabbit breeds with improved growth rate, and the method includes the following steps:

[0038] Step 1: Construction of the sgRNA expression vector (PUC57-sgRNA);

[0039] Figure 1It is a schematic diagram of sgRNA design. A sgRNA sequence targeting the CEP104 p.Gly25Ser of New Zealand rabbits was designed as the target, and a pair of oligonucleotide chains were synthesized. The sequences of the oligonucleotide chains are as follows:

[0040] sgRNA-F: GAAGCCGTCTTCATGTCCAG (as shown in SEQ ID NO.1);

[0041] sgRNA-R: CTGGACATGAAGACGGCTTC (as shown in SEQ ID NO.2);

[0042] The selection principle of this sgRNA oligonucleotide chain: The selection principle of these two oligonucleotide chains is to ensure that the position of the mutated base is at the 6th position paired with the target DNA sequence.

[0043] The oligonucleotide chain was annealed at 95°C for 5 min and cooled to room temperature to form double-stranded sgRNA. At the same time, the PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was recovered by agarose gel electrophoresis. Finally, the double-stranded sgRNA was ligated with the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, and then digested with enzymes at 37°C overnight. After electrophoresis, it was recovered using a common DNA agarose gel recovery kit.

[0044] Enzyme digestion system: 20 μL of PUC57 plasmid; 20 μL of 10× Buffer; 1 μL of BbsⅠ; 159 μL of ddH2O.

[0045] Gel recovery process: After digestion with enzymes overnight at 37°C and agarose gel electrophoresis, it was recovered using a common DNA agarose gel recovery kit (purchased from Sangon Biotech Co., Ltd., Shanghai, China), and the specific operation was carried out according to the instructions.

[0046] Step 2: Transcription synthesis of SpRY-CBE mRNA;

[0047] The SpRY-CBE plasmid (preserved in our laboratory) was digested with enzymes overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis, and the recovered product was purified by chloroform extraction.

[0048] The enzyme digestion system is: 1 μL of AgeI; 1 μL of xBaI; 20 μL of SpRY-CBE plasmid; 10 μL of rCut Smart Buffer; 18 μL of ddH2O.

[0049] The transcription synthesis system is as follows: 1 μg of linear SpRY-CBE; 10 μL of NTP Buffer; 2 μL of T7 RNA polymerase; 5 μL of ddH2O.

[0050] The transcription synthesis process is as follows: After mixing, incubate at 37 °C for 1 h. After transcription is completed, add 1 μL of DNase I to digest the transcription template, react at 37 °C for 15 min, and then add the polyA tail.

[0051] Step 3: Prepare CEP104 gene-edited rabbits using embryo microinjection technology;

[0052] Using a microinjector, after mixing 12 ng / μL of synthesized sgRNA and 70 ng / μL of SpRY-CBE, aspirate 2.5 μL into the injection needle, perform embryo nucleus injection, and transfer the injected fertilized eggs into the oviduct of synchronized recipient female rabbits. The surrogate female rabbits are provided with sufficient water and food. After 25 days of pregnancy, transfer them to the delivery room until the due date, and finally obtain CEP104 gene-edited rabbits.

[0053] Step 4: Identification of rabbit genomes;

[0054] Extract DNA from the ear tissues of the obtained CEP104 gene-edited rabbits. The extraction method is operated according to the kit instructions (purchased from Tiangen Biotech Co., Ltd., Beijing, China). Then, perform PCR using the designed PCR primers. After completing PCR, perform electrophoresis identification. If the PCR amplification is successful, perform DNA sequencing on the PCR product to obtain the genotype identification result.

[0055] The designed PCR primers are as follows:

[0056] Forward primer: GGATCCACAACGCTGGTTA (as shown in SEQ ID NO.3);

[0057] Reverse primer: ACCCTCTGGGACACAATTTC (as shown in SEQ ID NO.4);

[0058] The PCR reaction system: 1.5 μL of template DNA; 2 μL of forward primer; 2 μL of reverse primer; 12.5 μL of 2×Taqplus; 7 μL of ddH2O.

[0059] Reaction conditions: Pre-denature at 95 °C for 5 min; Denature at 95 °C for 30 s, anneal at 58 °C for 30 s, extend at 72 °C for 40 s; 38 cycles; Extend at 72 °C for 5 min.

[0060] The PCR products were sent to Sangon Biotech for sequencing. If the base sequence GGC of the 25th amino acid of the rabbit CEP104 gene (GeneID: 100340818) was changed to AGC (the 6th C in the reverse sequence was mutated to T in the sgRNA sequence), it was proved that a single-base mutation was obtained. As Figure 2 shown, a heterozygous mutation indicated by the arrow occurred at the corresponding position of the rabbit CEP104 gene. Therefore, the CEP104 gene-edited rabbits were obtained in the present invention.

[0061] Example 1: Phenotypic analysis of CEP104 gene-edited rabbits;

[0062] 1) Comparison of body lengths between normal 3-month-old rabbits (WT) and CEP104 gene-edited rabbits;

[0063] At 3 months after birth, the body lengths of normal rabbits and CEP104 gene-edited rabbits were observed. As Figure 3 shown, it was found that the body length of the 3-month-old CEP104 gene-edited rabbits was significantly greater than that of normal rabbits; where WT were normal rabbits, and F0-3 and F0-5 were CEP104 gene-edited rabbits numbered 3 and 5 respectively obtained after embryo transfer.

[0064] 2) Comparison of body lengths between normal rabbits (WT) and CEP104 gene-edited rabbits at 100 days;

[0065] At 100 days, the body lengths of normal rabbits and CEP104 gene-edited rabbits were measured. As Figure 4 shown, it was found that when the rabbits continued to grow to 100 days, the body length of the CEP104 gene-edited rabbits was significantly greater than that of normal rabbits.

[0066] 3) Statistical analysis of the weight changes of normal rabbits (WT) and CEP104 gene-edited rabbits within 100 days;

[0067] The weights of normal rabbits and CEP104 gene-edited rabbits were recorded from birth for 100 days. As Figure 5 shown, it was found that both the weight and growth rate of the CEP104 gene-edited rabbits were greater than those of normal rabbits.

[0068] In summary, the present invention successfully cultivated a new variety of CEP104 gene-edited rabbits, which have the characteristics that their growth traits such as body length and weight are significantly superior to those of normal rabbits, and it is of great significance for improving the growth ability of rabbit breeds and promoting the sound development of the animal breeding industry in China.

[0069] The above is only the preferred implementation mode of the present invention. It should be noted that for those skilled in the art, without departing from the concept of the present invention, several deformations and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicability of the patent.

Claims

1. A method for cultivating a rabbit breed with improved growth rate, characterized in that, It includes the following steps: Step 1: Construction of sgRNA expression vector; Design a sgRNA target sequence for CEP104 p.Gly25Ser of New Zealand rabbits, synthesize a pair of oligonucleotide chains. The oligonucleotide chains are annealed at 95°C for 5 min and cooled to room temperature to form double-stranded sgRNA. Use BbsI restriction endonuclease to linearize the PUC57 vector, and after agarose gel electrophoresis of the linearized vector, recover the gel. Finally, ligate the double-stranded sgRNA with the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector. Then, digest with enzymes at 37°C overnight, run gel electrophoresis, and use a common DNA agarose gel recovery kit for recovery; The sequences of the oligonucleotide chains are as follows: sgRNA-F: GAAGCCGTCTTCATGTCCAG; sgRNA-R: CTGGACATGAAGACGGCTTC; Step 2: Transcriptional synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid is digested with enzymes at 37°C overnight to form linear DNA, and recovered by agarose gel electrophoresis. The recovered product is purified by chloroform extraction, and then the transcriptional synthesis of SpRY-CBE is carried out according to the instructions of the in vitro transcription kit; Step 3: Preparation of CEP104 gene-edited rabbits by embryo microinjection technology; Mix the synthesized sgRNA and SpRY-CBE, aspirate it into the injection needle, and perform nuclear injection into the embryo. The fertilized eggs after injection are transplanted into the oviducts of synchronized recipient female rabbits. After the female rabbits are pregnant for 25 days, they are transferred to the delivery room until the expected due date, and finally CEP104 gene-edited rabbits are obtained; Step 4: Identification of rabbit genome; Extract DNA from the ear tissues of the obtained CEP104 gene-edited rabbits, perform PCR using the designed PCR primers. After completing PCR, perform electrophoresis identification. If the PCR amplification is successful, sequence the PCR product to obtain the genotype identification result; The designed PCR primers are as follows: Forward primer: GGATCCACAACGCTGGTTA; Reverse primer: ACCCTCTGGGACACAATTTC.

2. The method for cultivating a rabbit breed with improved growth rate according to claim 1, characterized in that, In the said Step 1, the enzyme digestion system is: 20 μL of PUC57 plasmid, 20 μL of 10× Buffer, 1 μL of BbsⅠ, and 159 μL of ddH2O; the gel recovery process is: digest with enzymes at 37°C overnight, run agarose gel electrophoresis, and use a common DNA agarose gel recovery kit for recovery.

3. The method for cultivating a rabbit breed with improved growth rate according to claim 1, characterized in that, In the said Step 2, the enzyme digestion system is: 1 μL of AgeI, 1 μL of xBaI, 20 μL of SpRY-CBE plasmid, 10 μL of rCut Smart Buffer, and 18 μL of ddH2O; The transcriptional synthesis system is: 1 μg of linear SpRY-CBE, 10 μL of NTP Buffer, 2 μL of T7 RNApolymerase, and 5 μL of ddH2O; The transcription synthesis process is as follows: After mixing evenly, incubate at 37 °C for 1 h; after transcription is completed, add 1 μL of DNase I to digest the transcription template, react at 37 °C for 15 min, and then add a polyA tail.

4. The method for cultivating a rabbit breed with increased growth rate according to claim 1, characterized in that, The specific process of step 3 is as follows: Using a microinjector, mix the synthesized sgRNA at 12 ng / μL and SpRY-CBE at 70 ng / μL, aspirate 2.5 μL into the injection needle, perform embryonic cell nucleus injection, and transfer the fertilized eggs after injection into the oviduct of synchronized recipient female rabbits. After the female rabbits are pregnant for 25 days, transfer them to the delivery room until the due date, and finally obtain CEP104 gene-edited rabbits.

5. The method for cultivating a rabbit breed with increased growth rate according to claim 1, characterized in that, In step 4, the PCR reaction system is: 1.5 μL of template DNA, 2 μL of upstream primer, 2 μL of downstream primer, 12.5 μL of 2×Taqplus, and 7 μL of ddH2O; the PCR reaction conditions are: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 40 s; 38 cycles; extension at 72 °C for 5 min.

6. The method for cultivating a rabbit breed with improved growth rate according to claim 1, characterized in that, In step 4, if the C at the 6th position of the sgRNA sequence is mutated to T, it proves that a single-base mutation is obtained.

Images