Application of TIMM10 gene as target spot in resisting influenza A virus

Abstract

The invention discloses application of a TIMM10 gene as a target spot in resisting influenza A virus, and belongs to the technical field of biological medicine. Specifically, TIMM10 gene knock-down is carried out on A549 cells, and it is found that in the cells with knocked-down TIMM10, expression of main protein hemagglutinin and nucleoprotein of influenza viruses is remarkably improved, and virus RNA and virus titer in supernate are also remarkably increased; overexpression of TIMM10 in A549 cells inhibits replication and infectivity of IAV in the cells. A further in-vivo experiment is carried out through a TIMM10 whole body knockout heterozygote mouse, and a result shows that the lung of the TIMM10 heterozygote mouse shows more serious pulmonary infection, including pulmonary hemorrhage and increased inflammatory cell infiltration. Based on the effect of TIMM10 in the influenza virus infection process, the invention provides a new therapeutic target, and provides a new thought and direction for developing a therapeutic strategy for IAV in the future.

Description

Technical Field

[0001] The present invention relates to the application of TIMM10 gene as a target in anti-influenza A virus, belonging to the field of biomedical technology. Background Art

[0002] Influenza A virus [Influenza A virus, IAV, (A / Puerto Rico / 8 / 1934, H1N1)] is an RNA enveloped virus and an important zoonotic pathogen that can cause highly contagious respiratory infections. IAV causes annual seasonal epidemics and occasional global pandemics, leading to severe and life-threatening complications and even unprecedented death tolls in high-risk populations, posing a major threat to human and animal health.

[0003] The prevention and treatment methods of influenza A virus generally include vaccination and drug treatment. Most traditional vaccines are designed based on the antigenic proteins of influenza A virus, which are extremely prone to antigenic drift, resulting in the inability to ensure the protective efficacy of the vaccine against new variant infections. Moreover, due to the high variability of influenza virus, it is easy to develop drug resistance to existing antiviral drugs. Therefore, there is a need to find an antiviral therapy that can provide broad-spectrum protection and is not easily prone to drug resistance.

[0004] The TIMM10 gene encodes a translocase of the inner mitochondrial membrane (Translocase of Inner Mitochondrial Membrane 10), belonging to an evolutionarily conserved protein family. This protein exists in the form of a heterooligomeric complex in the mitochondrial intermembrane space, and its main function is to mediate the import and insertion of hydrophobic membrane proteins into the inner mitochondrial membrane. As a molecular chaperone in the intermembrane space, it helps the correct folding and transportation of highly insoluble carrier proteins. TIMM10 has been found to be closely related to neurodegenerative diseases. However, the role of TIMM10 in influenza A virus infection has not been explored. Summary of the Invention

[0005] To solve the above problems, the present invention conducts in-depth research and discovers that in A549 cells, TIMM10 is negatively correlated with the levels of IAV infection and replication. Partial deletion of TIMM10 in the host body causes more severe lung infections. Therefore, a new solution is provided that TIMM10 can provide a new target for the treatment of IAV by reducing the pathogenicity of influenza A virus.

[0006] The first object of the present invention is to provide the application of a reagent for increasing the expression level of TIMM10 gene in the preparation of anti-influenza A virus products.

[0007] Furthermore, the anti-influenza A virus product is a product for preventing influenza A virus or a product for treating influenza A virus.

[0008] Further, the reagent for increasing the expression level of the TIMM10 gene contains: the TIMM10 gene, a vector containing the TIMM10 gene sequence, or an activator for activating the expression of the TIMM10 gene.

[0009] Further, the vector containing the TIMM10 gene sequence includes, but is not limited to, a recombinant plasmid ligated with the TIMM10 gene sequence or a recombinant adenovirus ligated with the TIMM10 gene sequence. That is, the vector includes, but is not limited to, plasmids, AAVs, DNAs, RNAs, etc.

[0010] Further, the sequence of the TIMM10 gene is as shown in SEQ ID NO.1.

[0011] The second object of the present invention is to provide a product for preventing or treating influenza A virus, and the product contains a reagent for increasing the expression level of the TIMM10 gene.

[0012] Further, the product further contains a pharmaceutically acceptable carrier (such as for delivery) or excipient.

[0013] Further, the excipient includes one or more of a filler, an excipient, a stabilizer, a diluent, a binder, a disintegrant, a lubricant, a glidant, a wetting agent, an effervescent agent, a colorant, a sweetener, an aromatic, a preservative, a dispersant, a film-forming agent, a plasticizer, a pore-forming agent, a light-blocking agent, a retarder, and a solvent.

[0014] Further, the product is composed of 0.1-100% of the active ingredient (the reagent for increasing the expression level of the TIMM10 gene) and 99.9-0% of the carrier or excipient.

[0015] The third object of the present invention is to provide an antiviral composition, and the antiviral composition contains a reagent for increasing the expression level of the TIMM10 gene.

[0016] Further, according to actual needs, it can be used in combination with other antiviral products for antiviral treatment.

[0017] The fourth object of the present invention is to provide the use of a reagent for detecting the expression level of the TIMM10 gene in the preparation of a product for detecting influenza A virus.

[0018] Further, the reagent for detecting the expression level of the TIMM10 gene contains primers for amplifying the TIMM10 gene.

[0019] The fifth object of the present invention is to provide a kit for evaluating the infection situation of influenza A virus, and the kit contains a reagent for detecting the expression level of the TIMM10 gene.

[0020] Furthermore, the detection step includes:

[0021] S1. Extract the genomic DNA of the sample to be tested and quantify the TIMM10 gene therein;

[0022] S2. Judge the influenza A virus infection situation according to the TIMM10 gene expression level.

[0023] Advantages of the present invention:

[0024] By comparing the differential genes between healthy individuals and influenza A patients in the database and genes related to mitochondrial function, the present invention obtains the significantly differential gene TIMM10 by taking the intersection, and confirms its influence on influenza A virus infection by knocking out this gene. In addition, in vivo experiments show that partial deletion of TIMM10 will exacerbate the severity of influenza A virus infection, which proves that TIMM10 can be used as a therapeutic target for influenza A virus. Finally, by overexpressing the gene TIMM10 in cells, the viral load of the cells is significantly reduced, indicating its great application prospects in the prevention and treatment of influenza A virus. Description of the Drawings

[0025] Figure 1 Results of screening key genes in host cells participating in IAV infection response. Among them, A is the screening strategy, genes in the MEturquoise module, the up-regulated DEGs are intersected with mitochondrial-related genes in the MitoCarta 3.0 database; B is the A549 cells infected with H1N1 virus, and the transcriptional levels of the intersecting genes are detected; C is the transcriptional level of TIMM10 in A549 cells at different time points after infection with H1N1 virus, *P<0.05, **P<0.01, ***P<0.001.

[0026] Figure 2 Shows the H1N1 virus infection situation after knocking down TIMM10 in A549 cells. Among them, A is knocking down TIMM10 in A549 cells, and detecting the proportion of NP-positive (NP + ) and M2-positive (M2 + ) cells after infecting with H1N1 virus; B is the protein levels of influenza virus HA and NP, *P<0.05, **P<0.01, ***P<0.001.

[0027] Figure 3 Shows the mechanism study on the influence of TIMM10 knockdown on H1N1 virus infection. Among them, A and B are respectively knocking down TIMM10 or overexpressing TIMM10 in A549 cells, and detecting the influenza virus IAV v-RNA level and virus titer in the supernatant after infecting with H1N1 virus, *P<0.05, **P<0.01, ***P<0.001.

[0028] Figure 4 Verification results of the effect of TIMM10 on IAV replication and infection in vivo. Six-week-old WT and TIMM10 + / - mice were infected with H1N1 (2000 PFU / mouse). On the 5th day after infection, the mRNA levels of NP and M1 in the lung tissues of mice were detected by qRT-PCR (A), and the H1N1 virus titer in the lung tissues of mice was detected by plaque assay (B), *P<0.05, **P<0.01, ***P<0.001.

[0029] Figure 5 For the changes in pulmonary inflammation after IAV virus infection. Six-week-old WT and TIMM10 + / - mice were infected with H1N1 (2000 PFU / mouse). On the 5th day after infection, the pulmonary inflammation level of mice was observed by PET-CT. The figure shows representative CT scans (left), PET scans (middle), and PET-CT fusion (right) images of each group of mice. The scatter plot is the maximum standardized uptake value SUVmax (A) in the ROI region (red circle). The pathological changes of the lung tissues of mice were observed by H&E section staining. The figure shows the histopathological score of lung lesions (B). Scale bar, 1000 μm.

[0030] Figure 6 For the effect of partial deletion of TIMM10 in vivo on the body weight and survival rate of IAV-infected mice. Among them, A is the IAV nasal drip infection and detection protocol for mice; B and C are six-week-old WT and TIMM10 + / - mice infected with H1N1 (1000 PFU / mouse), the body weight changes (B) and survival rate (C), *P<0.05, **P<0.01, ***P<0.001. Detailed implementation manners

[0031] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited are not intended to limit the present invention.

[0032] The solutions involved in the present invention are as follows:

[0033] Currently, for the prevention and treatment of influenza A virus, it is usually designed according to the specific antigen of the virus. However, the virus mutates rapidly and the mutation direction is uncertain, which greatly increases the development difficulty of influenza A vaccines and drugs and limits the clinical use.

[0034] Based on the above problems, in the present invention:

[0035] Genes showing differences in the expression matrices of healthy individuals and influenza A patients were screened through the GSE dataset. Subsequently, combined with the discovery of the relationship between mitochondria and antiviral effects, the gene TIMM10 with the most significant differential expression was obtained by taking the intersection.

[0036] To verify whether the gene TIMM10 affects IAV infection, A549 cells were subjected to TIMM10 gene knockdown. It was found that in the cells with TIMM10 knockdown, the expression of the main proteins of influenza virus, hemagglutinin and nucleoprotein, was significantly increased, and the viral RNA and virus titer in the supernatant were also significantly increased.

[0037] To verify whether the gene TIMM10 can be used as a therapeutic target and explore the mechanism by which the gene TIMM10 affects IAV infection, TIMM10 was overexpressed in A549 cells. It was found that the increase in the level of the TIMM10 gene inhibited the replication and infectivity of IAV in the cells, thus showing promise for use in antiviral infections.

[0038] Finally, in vivo experiments were verified using TIMM10 systemic knockout heterozygous mice. The results showed that TIMM10 heterozygous mice exhibited more severe lung infections, including increased pulmonary hemorrhage and inflammatory cell infiltration.

[0039] The strains used for discovery and verification in the present invention are all A / Puerto Rico / 8 / 1934, H1N1.

[0040] The present invention provides a composition for antiviral use. Preferably, the composition is a pharmaceutical composition, which contains a substance that increases the expression of the TIMM10 gene or contains the TIMM10 gene, and may also contain other active ingredients, as well as a pharmaceutically acceptable carrier. Generally, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, where the pH is usually about 5 - 8, preferably about 6 - 8. The pH value can vary depending on the nature of the substances being formulated, and those skilled in the art can adjust it as needed. The formulated pharmaceutical composition can be administered through conventional routes, including (but not limited to): intravenous, topical administration.

[0041] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001 - 99 wt%, preferably 0.01 - 90 wt%, more preferably 0.1 - 80 wt%) of the above-mentioned substance for increasing the expression of TIMM10 gene or TIMM10 gene, and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): fillers, excipients, stabilizers, diluents, binders, lubricants, surfactants or combinations thereof. The pharmaceutical preparation should be matched with the administration method. The pharmaceutical composition of the present invention can be made into an injection form, for example, prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections and solutions should be manufactured under aseptic conditions. The dosage of the active ingredient is a therapeutically effective amount. In addition, the preparations of the present invention can also be used together with other therapeutic agents.

[0042] When using the pharmaceutical composition, a safe and effective amount of the drug is administered to an individual, and the specific dosage should also consider factors such as the administration route and the patient's health status, which are all within the scope of the skills of a skilled physician.

[0043] In summary, the present invention has demonstrated the use of TIMM10 as a therapeutic target for influenza A virus through discovery - verification tests. Targetedly increasing the expression of TIMM10 gene in cells can reduce the viral load in cells, and since the drug is not designed against viral antigens, it is expected to improve drug resistance in the treatment of influenza A virus.

[0044] The treatment means of the present invention has at least the following advantages:

[0045] (1) The method of the present invention can introduce a therapeutic gene into cells or the body, enabling it to continuously express a therapeutic molecule, thereby achieving a long - term antiviral effect. Compared with traditional antiviral drugs, this therapy may only require one treatment to inhibit virus replication for a long time, avoiding the inconvenience of frequent drug administration.

[0046] (2) The method of the present invention can use viral vectors or non - viral vectors to precisely deliver genes to specific cells or tissues, achieving tissue - specific expression. This precision can reduce the distribution of drugs in non - target sites, reduce side effects, and improve the therapeutic effect at the same time.

[0047] (3) Influenza A virus has a high degree of variability, and traditional antiviral drugs may become ineffective due to virus mutations. The method of the present invention can act through different mechanisms, directly interfering with the virus replication process, and thus has a certain tolerance to virus mutations.

[0048] (4) The method of the present invention can not only be used to treat infected patients, but also enhance the body's resistance to influenza virus by increasing the expression of the target, thus playing a preventive role.

[0049] (5) The method of the present invention has a certain generality and can be adapted to different application scenarios by adjusting the carrier design.

[0050] Based on the above findings, there are significant differences in the expression levels of the TIMM10 gene between healthy individuals and patients. Therefore, it also has certain potential in the detection of influenza A virus. TIMM10 is expected to be a new indicator for the evaluation and diagnosis of influenza A.

[0051] Therefore, the present invention provides a kit for evaluating the severity of influenza A infection or predicting the risk of influenza A infection, and the kit can detect the expression level of the TIMM10 gene. The lower its level in the body, the higher the infection risk or the more severe the infection. Clinically, corresponding preventive and treatment measures can be taken for patients with low TIMM10 expression levels.

[0052] Preferably, the kit contains substances necessary for quantifying the TIMM10 gene, such as primers for amplifying the TIMM10 gene.

[0053] Preferably, the detection steps include but are not limited to:

[0054] S1. Extract the genomic DNA of the sample and quantify the TIMM10 gene therein;

[0055] S2. Judge the risk of influenza A infection or the degree of infection according to the expression level of the TIMM10 gene.

[0056] Preferably, the quantification method includes but is not limited to real-time fluorescence quantitative PCR (qPCR), etc.

[0057] Preferably, the kit or primers of the present invention can detect the TIMM10 gene in different species as needed, preferably humans, and the Gene ID of human TIMM10 is 26519. When it is necessary to use the kit or primers of the present invention to detect other target species, those skilled in the art can find the sequence homologous to the gene listed in the present invention in the target species and set the primers according to the conventional method to achieve detection.

[0058] Example 1 Screening of key genes involved in IAV infection response

[0059] We performed weighted gene co-expression network (WGCNA) analysis on the peripheral blood RNA expression dataset (GSE157240) of healthy individuals and influenza A virus (IAV) patients. The results showed that the Turquoise module was significantly positively correlated with IAV infection (cor = 0.6, p < 0.001). Subsequently, we intersected the MitoCarta 3.0 database of genes related to mitochondrial function, the genes in the Turquoise module, and the differentially expressed genes (DEGs) in the GSE157240 dataset, and finally obtained 8 related genes predicted to play a key role in IAV infection ( Figure 1 A). We used IAV to infect A549 cells in vitro to verify the selected genes, and the results showed that the TIM gene TIMM10 was found to be the most significantly upregulated ( Figure 1 B). During IAV infection, the mRNA level of TIMM10 increased over time, indicating that this effect was time-dependent, and the peak appeared 12 hours after infection ( Figure 1 C). We speculated that the TIM gene TIMM10 might play an important role in IAV infection.

[0060] Example 2 Infection of H1N1 virus in A549 cells after knocking down TIMM10

[0061] Flow cytometry results showed that the proportions of NP-positive (NP + ) and M2-positive (M2 + ) cells were significantly increased in TIMM10-knockdown cells ( Figure 2 A, where NP is the nucleoprotein of influenza A virus and M2 is matrix protein 2, an ion channel protein with a non-glycosylated transmembrane structure on the viral envelope). Western blot results showed that significantly higher levels of influenza virus HA and NP proteins were detected in TIMM10-knockdown cells compared with control cells (cells transfected with negative control siRNA and then infected with influenza A virus) ( Figure 2 B, where HA is the glycoprotein antigen on the surface of influenza virus). This indicated that knocking down TIMM10 led to an increase in protein synthesis and viral particle assembly of IAV in host cells.

[0062] Example 3 Study on the mechanism by which TIMM10 knockdown affects H1N1 virus infection

[0063] qPCR results showed that the copy number of IAV v-RNA in TIMM10-knockdown cells was significantly higher than that in control cells, indicating that knocking down TIMM10 promoted the early replication of IAV in host cells; virus plaque assay results showed that the virus titer in the supernatant of TIMM10-knockdown cells increased compared with control cells, suggesting that knocking down TIMM10 led to an increase in IAV infectivity ( Figure 3A). After overexpressing TIMM10 in A549 cells and infecting them with H1N1 virus, the results showed that overexpression of TIMM10 inhibited the replication and infectivity of IAV in host cells ( Figure 3 B. Among them, in the Flag-TIMM10 group, the TIMM10 gene was overexpressed using the pcDNA3.0 vector plasmid, the EV group was transfected with the empty plasmid pcDNA3.0 vector, the NC group was not treated with anything, and the remaining operations were the same. That is, 24 hours after A549 cells were transfected with the empty vector or Flag-TIMM10 plasmid or not treated, they were then infected with an equal amount of H1N1. After 12 hours, the cells and supernatant were collected, and the influenza virus IAV v-RNA level and the virus titer in the supernatant were detected).

[0064] The gene sequence of overexpressed TIMM10 is shown below (SEQ ID NO.1):

[0065] ATGGATCCTCTCAGGGCCCAACAGCTGGCTGCGGAGCTGGAGGTGGAGATGATGGCCGATATGTACAACAGAATGACCAGTGCCTGCCACCGGAAGTGTGTGCCTCCTCACTACAAGGAAGCAGAGCTCTCCAAGGGCGAGTCTGTGTGCCTGGACCGATGTGTCTCTAAGTACCTGGACATCCATGAGCGGATGGGCAAAAAGTTGACAGAGTTGTCTATGCAGGATGAAGAGCTGATGAAGAGGGTGCAGCAGAGCTCTGGGCCTGCATGA.

[0066] Example 4 Verifying the Effect of TIMM10 on IAV Replication and Infection in Vivo

[0067] Using TIMM10 heterozygous mice (TIMM10 + / - ) were infected with IAV by nasal drip. On the 5th day after infection, the lung tissues of the mice were dissected, and the viral RNA level and virus titer in the lungs were detected. The results showed that compared with wild-type (WT) mice, the IAV mRNA level and viral load in TIMM10 + / - mice were significantly higher ( Figure 4 A, B, where M1 is a structural protein encoded by IAV with a size of 252 residues), indicating that partial deletion of TIMM10 in vivo led to more obvious IAV replication and infection in the lungs of mice.

[0068] Inflammatory responses in the lungs are usually associated with increased cellular metabolic activities, which are reflected as enhanced glucose uptake. FDG-PET / CT using the glucose analog 18F-FDG as a tracer can evaluate the severity of pulmonary inflammation caused by infection. The results showed that after infection, the enhancement of PET signals was more obvious in TIMM10 + / - mice ( Figure 5 A). Histopathological results showed that compared with WT mice, the pulmonary infection injury in TIMM10 + / - mice was more severe after infection ( Figure 5 B). This indicates that partial deletion of TIMM10 in vivo exacerbates the inflammatory response induced by IAV in the lungs of mice.

[0069] To further evaluate the role of TIMM10 in host defense against IAV infection, we intranasally infected littermate TIMM10 + / - and WT mice and monitored their survival rate and body weight changes for 10 consecutive days. The strategy is shown in Figure (6A). The results showed that compared with WT mice, TIMM10 + / - mice infected with IAV showed more significant weight loss ( Figure 6 B) and reduced survival rate ( Figure 6 C).

[0070] In summary, these results indicate that TIMM10 prevents IAV in vivo by inhibiting viral replication and reducing its pathogenicity. The discovery of TIMM10 in this invention will provide a new therapeutic target for IAV.

[0071] Obviously, the above embodiments are only examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of this invention.

Claims

1. Use of a reagent for increasing the expression level of TIMM10 gene in the preparation of an anti-influenza A virus product.

2. The application according to claim 1, wherein The anti-influenza A virus product is a product for preventing influenza A virus or a product for treating influenza A virus.

3. The application according to claim 1, wherein The reagent for increasing the expression level of TIMM10 gene contains one or several of the following: TIMM10 gene, a vector containing the TIMM10 gene sequence, and an activator for activating the expression of TIMM10 gene.

4. The application according to claim 3, characterized in that, The vector includes plasmid, adenovirus vector, DNA vector or RNA vector.

5. The application according to claim 1, wherein The sequence of the TIMM10 gene is as shown in SEQ ID NO.

1.

6. A product for preventing or treating influenza A virus, characterized in that, The product contains a reagent for increasing the expression level of TIMM10 gene.

7. The product according to claim 6, characterized in that, The product also contains a pharmaceutically acceptable carrier and / or excipient.

8. An antiviral composition, characterized in that, The antiviral composition contains a reagent for increasing the expression level of TIMM10 gene.

9. Use of a reagent for detecting the expression level of TIMM10 gene in the preparation of an influenza A virus detection product.

10. The application according to claim 9, characterized in that, The reagent for detecting the expression level of TIMM10 gene contains primers for amplifying the TIMM10 gene; The application includes: S1. Extract genomic DNA from the sample to be tested and quantify the TIMM10 gene therein; S2. Judge the influenza A virus infection risk or infection degree according to the expression level of TIMM10 gene.

Images