Salivary protein RP402 from the bee stink bug and its application as a target in controlling soybean greening disease
Through RNA interference technology, the silencing of the saliva protein RP402 gene of the silencing beetroot worm was targeted, which solved the problem of soybean disease caused by the silencing beetroot worm, achieved the effect of premature aging and high yield of soybean leaves, and provided a green, accurate and efficient prevention and treatment method.
Patent Information
- Application Number
- CN202510846533.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-06-24
AI Technical Summary
The existing technology is difficult to effectively prevent and control the soybean disease caused by bee worms. The effect of chemical pesticides is limited, and the application of biological control methods in large-scale agricultural production is limited, and traditional insect-resistant breeding is difficult to meet actual needs.
The RNA interference technology is used to target the saliva protein RP402 gene of the silencing point beetroot silencing point beetroot RP402 gene expression, and nanocarrier materials are used to improve the stability and efficiency of dsRNA. Microinjection of the silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot silencing point beetroot
Significantly eliminate the inhibition of soybean leaf aging, reduce the phenomenon of greenness, improve the maturity rate and yield of soybeans, reduce the risks of environmental pollution and pest resistance, and provide green, accurate and efficient prevention and control methods.
Smart Images

Figure CN120365399B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of agricultural pest control, and particularly relates to a salivary protein RP402 of the schizontid stink bug and its application as a target in preventing and controlling soybean greening disease. Background Art
[0002] Bee stink bug ( Riptortus pedestris ) is a polyphagous piercing-sucking pest widely distributed in East and Southeast Asia, with host plants from more than 13 families and 30 species, including soybean ( Glycine max ) is its most suitable host. When the bee-spotted stink bug feeds on soybeans, it pierces and sucks, preventing nutrients from being effectively transported to the sink organs in the leaves. This causes excessive accumulation of nutrients in the leaves, disrupting the source-sink relationship of the plant. This abnormal nutrient distribution inhibits the natural aging of the leaves, causing the plants to continue to maintain a state of vegetative growth, resulting in the typical "greening syndrome" phenomenon. In recent years, the population density of the bee-spotted stink bug has continued to rise in soybean-producing areas such as the Huanghuaihai area in my country. It has become one of the major pests, seriously threatening soybean yield and quality.
[0003] Leaf senescence is a key process in plants as they transition from nutrient assimilation to nutrient redistribution. Normal leaf senescence promotes nutrient transfer from leaves to seeds, enhancing reproductive success. However, the stinging feeding of the bee-margin bug inhibits leaf senescence, hindering nutrient transfer to seeds and causing the plant to become "green."
[0004] Further research revealed that the saliva of the bee stink bug contains multiple effector proteins, which play a key role in regulating plant defense responses and the aging process. Among them, effectors such as RpSP10.3, RpSP13.4, RpSP13.8, and RpSP17.8 inhibit jasmonic acid (JA) and salicylic acid (SA) signaling pathways, weakening plant defenses and reducing soybean insect resistance. Furthermore, the bee stink bug's effector RPH1 is recognized by soybeans and activates the plant's immune response, but variant effectors such as RPH1L2-5 increase the bee stink bug's feeding success by suppressing this immune response. Notably, the bee stink bug's effectors Rp614 and Rp2155, while inhibiting the JA and SA signaling pathways, also promote the occurrence of soybean "greening syndrome." Feeding by the bee-margin stink bug also significantly reduced the expression level of the aging-related gene GmFT2a in soybean leaves, and overexpression of GmFT2a can effectively alleviate the "greening" symptoms and enhance the plant's insect resistance.
[0005] At present, the main methods for controlling the bee stink bug include spraying chemical pesticides, breeding insect-resistant varieties, and biological control. Among them, chemical pesticides such as imidacloprid and other insecticides have a certain control effect on the bee stink bug, but due to the strong avoidance and pesticide resistance of this pest, the effectiveness of chemical control is limited, and the problem of pesticide residues may cause environmental pollution. The breeding of insect-resistant varieties is still in its early stages. There are currently no soybean varieties resistant to the bee stink bug, and traditional insect-resistant breeding methods are difficult to meet actual production needs. In terms of biological control, although some progress has been made in controlling the bee stink bug population using predatory natural enemies or parasitic wasps, its application in large-scale agricultural production is still limited.
[0006] Therefore, there is an urgent need to find a green and effective prevention and control method for the agricultural pest bee-margin stink bug. Summary of the Invention
[0007] To address these technical issues, the present invention proposes a precise control strategy based on RNA interference (RNAi) technology. By silencing the key effector gene of the bee-edge bug, salivary protein RP402, the pest's feeding ability can be effectively reduced, thereby reducing the occurrence of soybean "greening syndrome."
[0008] In one aspect, the present invention provides a salivary protein RP402 of the bee-margin bug, wherein the salivary protein RP402 is as shown in any one of the following (1)-(3):
[0009] (1) A protein consisting of the amino acids shown in SEQ ID NO. 1;
[0010] (2) A protein derived from (1) having the same function as the amino acid represented by SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added;
[0011] (3) Proteins or their derivatives derived from other varieties of rice or other species that have at least 95% sequence identity and have the same function as (1).
[0012] On the other hand, the present invention also provides a gene encoding the salivary protein RP402 of the bee-margin bug, the nucleotide sequence of which is shown in any one of (4) to (6) below:
[0013] (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2;
[0014] (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function;
[0015] (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.
[0016] On the other hand, the present invention also provides the use of the salivary protein RP402 or the gene as a target, wherein the use is any of the following:
[0017] a) Alleviate the phenomenon of soybean greening;
[0018] b) Reduce the proportion of soybean abortion and empty pods;
[0019] c) Increase the 100-grain weight of soybean seeds.
[0020] On the other hand, the present invention also provides a substance capable of reducing the activity of the salivary protein RP402 or reducing the expression level of the gene, wherein the substance targets the sequence SEQ ID NO. 5 and reduces the activity of the salivary protein RP402 or reduces the expression level of the gene through RNA interference.
[0021] In certain embodiments, the agent includes but is not limited to miRNA, siRNA, dsRNA, or shRNA.
[0022] In certain embodiments, the substance is dsRNA, and the sense strand and antisense strand sequences of the dsRNA are shown as SEQ ID NO.10 and SEQ ID NO.11.
[0023] On the other hand, the present invention also provides a pesticide composition, wherein the active ingredient of the pesticide composition includes the aforementioned substance that reduces the activity of the salivary protein RP402 or reduces the expression level of the gene through RNA interference.
[0024] In certain embodiments, the agent includes but is not limited to miRNA, siRNA, dsRNA, or shRNA.
[0025] In certain embodiments, the substance is dsRNA, and the sense strand and antisense strand sequences of the dsRNA are shown as SEQ ID NO.10 and SEQ ID NO.11.
[0026] In certain embodiments, the pesticide composition further comprises a nanocarrier material, including chitosan nanoparticles, liposome nanoparticles, carbon-based nanomaterials, or polymer nanomaterials. The encapsulation effect of the nanomaterial can effectively improve the stability and environmental tolerance of dsRNA, prolong its field action time, and enhance the dsRNA absorption efficiency of the bee stink bug after feeding or contact, thereby improving the gene silencing effect.
[0027] On the other hand, the present invention also provides the use of the substance or the composition in the preparation of pesticides for preventing and treating soybean greening.
[0028] On the other hand, the present invention also provides a method for controlling the bee-spotted stink bug or a method for controlling soybean "green syndrome", which includes the steps of introducing any of the substances or the composition into the body of the bee-spotted stink bug or spraying it on the surface of the soybean plant.
[0029] In certain embodiments, the concentration of the substance or the composition is 400-600 ng / μl, preferably 500 ng / μl.
[0030] In certain embodiments, the introduction is performed by microinjection.
[0031] Compared with the prior art, the present invention has discovered and verified for the first time the important role of the RP402 gene of the bee stink bug in inhibiting the normal aging of soybean leaves and aggravating the "greening" phenomenon of soybeans. By specifically targeting and silencing the RP402 gene, the inhibition of the soybean aging process can be significantly relieved, the normal aging of leaves can be accelerated, the occurrence of the greening phenomenon can be reduced, and the normal maturity rate and yield of soybeans can be effectively improved. In addition, the present invention also provides an efficient preparation method of RP402 gene-specific dsRNA and a microinjection silencing technology, which has the advantages of simple operation, high efficiency, good stability, and easy promotion. Therefore, the method for preventing and controlling bee stink bugs or the method for preventing and controlling soybean greening provided by the present invention has the characteristics of precision, high efficiency, and environmental protection. It not only makes up for the shortcomings of existing prevention and control measures, but also reduces the use of chemical pesticides, reduces environmental pollution and the risk of pest resistance, and its promotion and application will provide a strong guarantee for the green and sustainable development of my country's soybean industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the specific embodiments.
[0033] Figure 1 is the relative expression level of RP402 after gene interference.
[0034] Figure 2 Effects of feeding by dsRNA-treated schizontids on the senescence process of soybean leaves under greenhouse conditions.
[0035] Figure 3 Effects of feeding by dsRNA-treated bee-margin stink bugs on soybean growth under field conditions.
[0036] Figure 4 Figures AD show the effects of feeding by dsRNA-treated bee stink bugs on the "green phenotype" of soybean under field conditions; Figures AD show the effects of feeding by dsRNA-treated bee stink bugs on the green stem rate, empty pod rate, abortion rate and 100-grain weight of soybean under field conditions. DETAILED DESCRIPTION
[0037] Example 1
[0038] 1. Extraction of total RNA from the bee-margin stink bug.
[0039] (1) Place a healthy adult of the bee-edge bug in a sterile 2.0 mL EP tube and add sterile grinding beads to facilitate sufficient crushing.
[0040] (2) Grind the tissue using a liquid nitrogen pre-cooled grinder. Set the grinding conditions to 50 Hz, 30 s, and repeat several times until the sample is ground into a fine powder.
[0041] (3) RNA was extracted using the RNA simple Total RNA Kit (Tiangen, China). First, 1 mL of lysis buffer RZ was quickly added to the ground sample, mixed thoroughly using a vortexer, and allowed to stand at room temperature for 5 min to fully lyse the cells.
[0042] (4) After lysis, centrifuge the sample at 12,000 rpm and 4°C for 5 min, take 800 μL of the supernatant into a new centrifuge tube, and add 200 μL of pre-cooled chloroform.
[0043] (5) Shake vigorously for 15 s and then let it stand at room temperature for 3 min to promote phase separation.
[0044] (6) The sample was centrifuged at 12,000 rpm and 4°C for 10 min. After centrifugation, three layers were formed. About 400 μL of the upper aqueous phase was transferred to a new centrifuge tube. Then 200 μL of pre-cooled anhydrous ethanol was added, pipetted to mix, and quickly transferred to the adsorption column CR3.
[0045] (7) Centrifuge at 12,000 rpm and 4°C for 30 s, discard the flow-through, and return the adsorption column to the collection tube.
[0046] (8) Add 500 μL of rinse buffer RW to the adsorption column CR3, place at room temperature for 2 min, centrifuge at 12000 rpm, 4°C for 30 s, discard the effluent, and repeat this step once to enhance RNA purity.
[0047] (9) Add 500 μL of rinse solution RW to the adsorption column CR3, place at room temperature for 2 min, centrifuge at 12000 rpm, 4°C for 30 s, discard the effluent, and repeat this step once to enhance RNA purity.
[0048] (10) Centrifuge at 12,000 rpm and 4°C for 2 min. After removing the residual liquid, transfer the adsorption column CR3 to a new centrifuge tube and blow dry on ice in a clean bench for 8 min.
[0049] (11) Add 30-50 μL of RNase-Free ddH2O to the center of the adsorption column, incubate at room temperature for 2 min, and then centrifuge at 12,000 rpm and 4°C for 2 min to elute the RNA.
[0050] The RNA concentration was determined using a spectrophotometer and the samples were snap-frozen in liquid nitrogen and stored at −80°C for long-term storage.
[0051] 2. Cloning of the RP402 gene of the bee-shaped stink bug
[0052] (1) Reverse transcription was performed using HiScript II Reverse Transcriptase (Novozymes, China) to obtain cDNA. First, genomic DNA removal was performed: 4 μL of 4×gDNA wiper mix was added to 800 ng of total RNA, and the volume was made up to 16 μL with RNase-free ddH2O. The mixture was pipetted and mixed, and the reaction was incubated at 42°C for 2 min. Then, a reverse transcription reaction system was prepared: 4 μL of 5×HiScript II qRT SuperMix was added to the above reaction system, the mixture was gently pipetted and mixed, and the reaction was incubated at 50°C for 15 min and 85°C for 5 s to obtain cDNA.
[0053] (2) Using the obtained cDNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.3 and SEQ ID NO.4 and the super-fidelity enzyme Phanta Super-Fidelity DNA Polymerase (Novozymes, China) to obtain the CDS sequence of the salivary protein RP402 of the bee-edge bug (SEQ ID NO.2), and the amino acid sequence encoded by it is shown in SEQ ID NO.1.
[0054] Upstream primer: 5'-GACGAGCTGTACAAGGGTACCCCAGTCCAGGAAGACGATACCCA-3' (SEQ ID NO. 3)
[0055] Downstream primer: 5′-GCGGACTCTAGTTCATCTAGATTCCCATCCCAGCACTTCCTCCA-3′ (SEQ ID NO. 4).
[0056] The reaction system included 25 μL of 2× Phanta Max Buffer, 1 μL of dNTP Mix (10 mM each), 2 μL of upstream and downstream primers (10 mM each), 1 μL of Phanta DNA Polymerase, 2 μL of template cDNA, and ddH2O to a final volume of 50 μL. PCR amplification was performed using a pre-denaturation step at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1.5 min, followed by an extension step at 72°C at 1 kb / min.
[0057] (3) The target gene fragment obtained by PCR amplification was recovered and purified, and ligated into the cloning vector pBinGFP2. It was then transformed into Escherichia coli DH5α competent cells and plated on LB solid medium containing kanamycin to screen for monoclonal colonies containing the recombinant plasmid.
[0058] (4) Positive monoclonal colonies were picked and inoculated into LB liquid medium containing kanamycin for expansion culture, and the recombinant plasmid was extracted. The recombinant plasmid was subjected to Sanger sequencing using sequencing technology to confirm whether the RP402 target gene was successfully inserted. Finally, the recombinant plasmid pBinGFP2-RP402 containing the sequence shown in SEQ ID NO.1 was obtained, laying the foundation for subsequent functional verification experiments.
[0059] Example 2
[0060] (1) The designed dsRNA targets a highly conserved region of the RP402 gene. The target sequence is shown in SEQ ID NO. 5. The recombinant plasmid pBinGFP2-RP402 obtained in Example 1 was used as a template. The sense strand was amplified using the primers shown in SEQ ID NO. 6 and SEQ ID NO. 7, and the antisense strand was amplified using the primers shown in SEQ ID NO. 8 and SEQ ID NO. 9. The PCR amplification procedure was the same as in Example 1. After the PCR amplification, the products were detected by agarose gel electrophoresis to confirm whether the band sizes of the sense and antisense strands were correct, and the correct PCR products were purified.
[0061] Upstream primer for positive chain amplification: 5'- TAATACGACTCACTATAGGG CAGTCCAGGAAGACGATACC-3' (SEQ ID NO.6), downstream primer for sense chain amplification: 5'-TGGGGGACGCTTTCCTGGGC-3' (SEQ ID NO.7), upstream primer for antisense chain amplification: 5'-CAGTCCAGGAAGACGATACC-3' (SEQ ID NO.8) downstream primer for antisense chain amplification: 5'- TAATACGACTCACTATAGGGTGGGGGACGCTTTCCTGGGC-3' (SEQ ID NO. 9), the T7 promoter is underlined, the amplified sense chain sequence is shown in SEQ ID NO. 10, and the antisense chain sequence is shown in SEQ ID NO. 11.
[0062] (2) RP402 gene-specific double-stranded RNA (dsRNA) was synthesized using the RiboMAX™ Express RNAi System (Promega) kit. The synthesis system consisted of 10 μL of RiboMAX™ Express T7 2× Buffer, 1 μg of sense / antisense ssRNA, 2 μL of Enzyme mix, and ddH2O to a total of 20 μL. After mixing, the mixture was incubated at 37°C for 4 h to ensure sufficient RNA synthesis.
[0063] (3) Equal amounts of the obtained positive and antisense ssRNA were mixed, incubated in a 70°C water bath for 10 min, and then placed at room temperature for 20 min to complete the annealing reaction. Subsequently, 2 μL of RQ1 RNase-Free DNase and 2 μL of RNase Asolution were added and incubated in a 37°C water bath for 30 min to remove any residual DNA and single-stranded RNA and ensure the purity of the double-stranded RNA.
[0064] (4) Add 4.4 μL of sodium acetate (NaOAc) and 110 μL of 95% ethanol to the reaction solution, mix thoroughly, and let it stand on ice for 5 min. After a cloudy precipitate appears in the solution, place the reaction tube in a pre-cooled centrifuge and centrifuge at 16,000 g for 10 min to recover the dsRNA precipitate.
[0065] (5) After centrifugation, discard the supernatant and add 500 μL of pre-cooled 70% ethanol to the centrifuge tube. Centrifuge at 4°C and 16,000 g for 10 min. After centrifugation, discard the supernatant again and ventilate in a clean bench for 4 min to remove residual ethanol to ensure the purity and stability of the dsRNA precipitate.
[0066] (6) Add 50 μL of Nuclease-Free water to the centrifuge tube to resuspend the dsRNA pellet and gently pipette or briefly vortex to completely dissolve the dsRNA.
[0067] 5 μL of dsRNA was subjected to agarose gel electrophoresis to confirm that the dsRNA band size was consistent with the expected value. The dsRNA concentration was determined using a nucleic acid protein analyzer. The dsRNA product was aliquoted and stored at -80°C for long-term use in subsequent experiments.
[0068] Example 3
[0069] (1) Take a fourth- or fifth-instar nymph of the bee-shaped beetle, place it in a 50 mL centrifuge tube, and anesthetize it with CO2 to ensure that the insect remains motionless during the experimental operation. After anesthesia, place the bee-shaped beetle with its abdomen facing upward on a pre-prepared 1% agarose plate to facilitate subsequent microinjection. (2) Use a capillary (model: WPI 504949) to draw up 500 ng / μL of dsRP402 solution and use an NL-type microinjector (capacity 4.5 μL, needle length 25.0 mm) for microinjection. The injection volume is set to 100 nL, the injection speed is 30 nL / s, and the injection site is selected between the second and third segments of the thorax of the bee-shaped beetle to ensure effective delivery of dsRNA. At the same time, dsGFP (green fluorescent protein, GFP) injection is used as a negative control to exclude the possible effects of nonspecific dsRNA treatment.
[0070] (3) After the injection is completed, the awakened bee-margined stink bugs are transferred to marked insect cages for breeding to ensure individual survival and used for feeding experiments in subsequent greenhouse insect inoculation experiments and field insect inoculation experiments.
[0071] (4) One week after injection, randomly capture the injected individuals of the experimental cage, extract total RNA, and obtain cDNA by reverse transcription. Fluorescence quantitative PCR (RT-qPCR) was performed using ChamQ SYBR qPCR Master Mix (Vazyme, China), and the specific primers shown in SEQ ID NO.11 and SEQ ID NO.12 were used to detect the expression level of the RP402 gene, and RPactin was used as the internal reference gene. The RT-qPCR reaction system was 20 μL, including 10 μL of 2× ChamQ SYBR qPCRMaster Mix, 0.4 μL of upstream and downstream primers (10 μM), 2 μL of template cDNA, and ddH2O was added to 20 μL. The RT-qPCR reaction program was pre-denaturation at 95℃ for 30 s, 95℃ for 10 s, and 60℃ for 30 s, for a total of 40 cycles. The experiment used 2 -ΔΔCt The relative expression level of RP402 gene was calculated by dsRNA to evaluate the silencing efficiency of dsRNA treatment.
[0072] Upstream primer: 5'-AGGACCACCTCCCTTCTCAA-3' (SEQ ID NO. 12)
[0073] Downstream primer: 5′-GAGTTCACGGGCTTCTTCCA-3′ (SEQ ID NO. 13).
[0074] The experimental results are as follows Figure 1 As shown in the figure, one week after the injection of dsRP402, fluorescence quantitative PCR (qRT-PCR) detection found that the relative expression level of the RP402 gene of the dotted bee stink bug dropped to 0.14798, which was significantly decreased compared with the control group, indicating that the RP402 gene silencing efficiency was high.
[0075] Example 4
[0076] 1. Greenhouse Inoculation Experiment
[0077] (1) Experimental materials and planting conditions: Williams 82 soybean varieties were selected as experimental materials and planted in a plant culture room to ensure controllable experimental conditions. The planting environment was set as follows: temperature 26 ± 2°C, relative humidity 50 ± 2%, and photoperiod 16:8 (L:D). Only one soybean plant was planted in each pot. When the soybean entered the initial grain stage (R5), each plant was enclosed with a 20-mesh 30 × 30 × 60 cm insect-proof net to prevent interference from non-experimental insects.
[0078] (2) Four- or five-instar schizonts were selected as experimental subjects and divided into three groups, with three biological replicates in each group. The schizonts were injected with dsRP402 (experimental group) and dsGFP (control group) via microinjection. A blank control group (no schizonts) was also set up. A pot of soybeans was placed in each experimental cage, and three dsRNA-injected schizonts were placed on each soybean plant to observe the effects of their feeding on soybean growth. Insects were replaced every three weeks to ensure the continuity of the experiment.
[0079] (3) During the experiment, the growth status of soybeans was observed at any time, including leaf color changes, growth momentum, aging process, etc., and data at key time points were recorded.
[0080] The experimental results are as follows Figure 2 As shown, feeding by the bee stink bug significantly affects the senescence process of soybean leaves. Seventeen days after inoculation, the lowermost leaves of soybean plants that had not been fed by the bee stink bug only slightly yellowed, showing signs of natural senescence. Soybean plants fed by the bee stink bug injected with dsGFP remained green, with no obvious signs of premature senescence. However, the lower leaves of soybean plants fed by the bee stink bug injected with dsRP402 quickly turned yellow, and senescence was significantly accelerated. The experimental results show that RP402 is the main effector protein that inhibits soybean leaf senescence. dsRP402 treatment causes premature senescence of soybean leaves, indicating that RP402 is a key effector protein that regulates soybean growth and development and causes "greening syndrome."
[0081] 2. Field Inoculation Experiment
[0082] (1) Experimental materials and planting conditions: The soybean variety Sucheng No. 2 was selected as the experimental material for this experiment. The experimental site was located in the field environment of the Baima Teaching and Research Base of Nanjing Agricultural University (119.19°E, 31.62°N). To prevent interference from non-experimental insects, a U-shaped insect-proof net (length × width × height = 170 cm × 85 cm × 150 cm) was constructed in the experimental field and covered with a 60-mesh insect-proof net. When the soybeans entered the initial grain stage (R5), 10-12 soybean plants were planted in each insect-proof cage, and 20 bee-edge stink bugs were inoculated in each cage until the soybeans matured. Four treatments were set up in the experiment, including the Mock group (soybean plants not fed by the bee stink bug), the CK group (fed by the bee stink bug without RNA interference injection), the dsGFP group (fed by the bee stink bug injected with dsGFP), and the dsRP402 group (fed by the bee stink bug injected with dsRP402), with three biological replicates in each group.
[0083] (2) At the soybean maturity stage, the main agronomic traits of the plants in each experimental group were counted, including green stem rate (GreenStem Rate), abortion rate (Abortion Rate), empty pod rate (Empty Pod Rate) and 100-seed weight (100-SeedWeight), to evaluate the effects of different treatments on soybean fruit set.
[0084] The experimental results are as follows Figure 3 As shown, soybean plants under different treatments showed significant differences. In the Mock group, soybean plants were healthy and had no obvious stay-green phenomenon, while soybean plants in the CK and dsGFP groups showed significant stay-green phenomenon, and their green stem rate increased significantly ( Figure 4 In contrast, the greening phenomenon in the dsRP402 group was significantly alleviated, and the rate of green stems was significantly reduced, approaching the level of the Mock group ( Figure 4 In addition, in terms of seed setting, the empty pod rate of the CK and dsGFP groups was significantly higher than that of the Mock group, while the empty pod rate of the dsRP402 group was significantly reduced, approaching the level of the Mock group ( Figure 4 B); the abortion rates of the CK and dsGFP groups were significantly higher than those of the Mock group, while the abortion rates of the dsRP402 group were significantly lower than those of the CK and dsGFP groups ( Figure 4 C in the figure); The 100-grain weight of the Mock group was significantly higher than that of the CK and dsGFP groups, while the 100-grain weight of the dsRP402 group was significantly higher than that of the CK and dsGFP groups, and was close to that of the Mock group ( Figure 4 D in the figure).
[0085] Results showed that feeding by the bee stink bug significantly induced soybean greening, characterized by increased green stem percentage, seed abortion, increased empty pod rates, and decreased 100-grain weight. Silencing the RP402 gene of the bee stink bug (dsRP402 treatment) significantly alleviated the greening phenomenon, reducing the abortion and empty pod rates and increasing seed weight. This study further confirmed the key role of RP402 in the bee stink bug's induction of soybean greening, and silencing this gene provides an effective strategy for reducing damage to soybeans caused by the bee stink bug.
[0086] Unless otherwise specified, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments can have different values.
Claims
1. A salivary protein RP402 of the bee stink bug, characterized in that: The salivary protein RP402 is a protein composed of amino acids shown in SEQ ID NO.
1.
2. A gene encoding the salivary protein RP402 of the bee-edge bug, characterized in that: The CDS sequence of the gene is shown in SEQ ID NO.
2.
3. A substance capable of reducing the activity of the salivary protein RP402 according to claim 1 or the expression level of the gene according to claim 2, characterized in that: The substance is dsRNA, and the sequences of the sense strand and antisense strand of the dsRNA are shown as SEQ ID NO.10 and SEQ ID NO.
11.
4. The use of the substance according to claim 3, characterized in that The application is any of the following, a) Alleviate the phenomenon of soybean greening; b) Reduce the proportion of soybean abortion and empty pods; c) Increase 100-grain weight of soybean seeds; d) preparing a pesticide composition for preventing and controlling soybean greening.
5. A pesticide composition, characterized in that The active ingredient of the pesticide composition includes the substance according to claim 3.
6. Use of the pesticide composition according to claim 5 in preventing and treating soybean greening.
7. A method for controlling the bee-margin stink bug or the soybean "green disease" method, characterized in that: The method comprises the steps of introducing the substance according to claim 3 or the composition according to claim 5 into the body of the bee-edge stink bug or spraying it on the surface of the soybean plant.
8. The method according to claim 7, characterized in that The concentration of the substance according to claim 3 is 400-600 ng / μl.
9. The method according to claim 8, characterized in that The concentration of the substance according to claim 3 is 500 ng / μl.
Citation Information
Patent Citations
Emblycoris indica secretory protein RpSP4043 and application thereof in prevention and control of soybean'disease green '
CN115927357A
Small heat shock protein RpHsp22.6 of apis cerana and application of small heat shock protein RpHsp22.6
CN120118907A