Polypeptide with cancer inhibition effect and application thereof
By designing the polypeptide TAT-ADRA2C-pep to replace the ADRA2C carboxy terminal domain, combining β-arrestins, blocking its signaling pathway, the problem of lack of effective targets in breast cancer treatment was solved and the effect of inhibiting breast cancer cells was achieved.
Patent Information
- Application Number
- CN202510563070.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-25
AI Technical Summary
There is a lack of effective therapeutic targets and drugs in the prior art to inhibit breast cancer, and reduced ADRA2C expression leads to abnormal β-arrestins signaling, leading to adverse prognosis.
A polypeptide TAT-ADRA2C-pep is designed to replace the ADRA2C carboxy terminal domain, bind to β-arrestins, block its signaling pathway, and the polypeptide enters the cell by adding TAT-permeable peptide sequence at the amino terminus to play a role.
The peptide TAT-ADRA2C-pep can inhibit the breast cancer pathway mediated by β-arrestins, prolong the patient's survival, and has clinical application potential.
Smart Images

Figure CN120365441A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to a polypeptide with cancer inhibitory effect and its application. Background Art
[0002] Breast cancer is the malignant tumor with the largest number of incidence and death cases in the female population worldwide, and also has the highest standardized incidence rate (SIR) and standardized mortality rate (SMR). It accounts for about 1 / 4 of newly diagnosed cancer cases in women and about 1 / 6 of cancer death cases in women. Breast cancer seriously threatens the life and health of women. However, there are currently no continuous and effective treatment targets and therapeutic drugs, and further research is needed.
[0003] Research shows that the expression level of ADRA2C in breast cancer tissues is significantly lower than that in normal breast tissues, and the decrease in its expression level may be closely related to poor prognosis.
[0004] As a typical G protein-coupled receptor (GPCR), the role of ADRA2C in breast cancer is mainly executed through G proteins and β-arrestins. The interaction between ADRA2C and β-arrestins is currently unclear. However, Kaplan-Meier Plotter database analysis shows that the high expression of β-arrestin 1 and β-arrestin 2 in breast cancer tissues is closely related to poor prognosis.
[0005] The expression of ADRA2C in breast cancer tissues decreases, the signal transduction between it and β-arrestins weakens, and the overexpressed β-arrestin 1 and β-arrestin 2 will mediate the development of breast cancer, ultimately leading to poor prognosis of patients and severely shortening the survival period of patients.
[0006] As a typical seven-transmembrane G protein-coupled receptor, the carboxyl-terminal region of ADRA2C may play a key role in the interaction with β-arrestins.
[0007] If a polypeptide is designed based on the amino acid sequence of the carboxyl-terminal region of ADRA2C, the polypeptide will compensatorily replace the carboxyl-terminal domain of ADRA2C, interact with β-arrestins, relieve the inhibition of the ADRA2C pathway by β-arrestins, and thus make up for the functional abnormality caused by the decreased expression of ADRA2C. At the same time, the polypeptide interacting with β-arrestins may block the signal pathway of the latter, achieving the purpose of inhibiting the progression of breast cancer cells and prolonging the survival period of patients. As a drug, the polypeptide needs to enter breast cancer cells to play a role, and we will add a TAT transmembrane peptide sequence to its amino terminus.
[0008] In summary, the research and development of polypeptide drugs based on the carboxyl-terminal domain sequence of ADRA2C to interfere with the β-arrestins signaling pathway are expected to have the effect of inhibiting breast cancer and have clinical application prospects. SUMMARY OF THE INVENTION
[0009] Technical problem to be solved: In view of the above technical problems, the present invention provides a polypeptide with cancer-inhibiting effect and its application. This polypeptide can replace the ADRA2C with reduced expression, bind to β-arrestins, and then inhibit the β-arrestins-mediated breast cancer pathway to play an anti-breast cancer role; it is also expected to have clinical application potential in the treatment of cancers with the same mechanism of action as breast cancer, namely, cancers with inhibited ADRA2C expression and abnormal β-arrestins expression.
[0010] Technical solution: A polypeptide with cancer-inhibiting effect, named TAT-ADRA2C-pep, is a polypeptide consisting of amino acid residues at positions 12-33 of the amino acid sequence shown in SEQ ID NO: 1 or a polypeptide of the amino acid sequence shown in SEQ ID NO: 1.
[0011] SEQ ID NO: 1 Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Asn Gln Asp Phe Arg ArgSer Phe Lys His Ile Leu Phe Arg Arg Arg Arg Arg Gly Phe Arg Gln That is, YGRKKRRQRRRNQDFRRSFKHILFRRRRRGFRQ Among them, the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing consists of 33 amino acid residues. The amino acid residues at positions 1-11 in sequence 1 form a region with the function of penetrating cell membranes. The positions of this region before and after positions 12-33 can be interchanged and can be replaced by other sequences with the same function; the amino acid residues at positions 12-33 in sequence 1 constitute a region that can replace the interaction between ADRA2C and β-arrestins proteins.
[0012] A nucleic acid molecule encoding the polypeptide, which is a DNA molecule shown by nucleotides at positions 34-99 from the 5'-end of SEQ ID NO: 2 or a DNA molecule shown by SEQ ID NO: 2.
[0013] SEQ ID NO: 2 TACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTAACCAGGATTTCCGGCGATCCTTTAAGCACATCCTCTTCCGACGGAGGAGAAGGGGCTTCAGGCAG Among them, the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing has a length of 99 bp, and its encoded amino acid sequence is the polypeptide fragment shown in SEQ ID NO: 1 in the sequence listing.
[0014] An expression cassette, recombinant vector or recombinant bacterium containing the nucleic acid molecule.
[0015] Use of the polypeptide and / or the nucleic acid molecule in the preparation of a product having an anti-cancer effect.
[0016] Preferably, the anti-cancer effect includes inhibiting cancer cell proliferation.
[0017] Preferably, the cancer includes breast cancer.
[0018] Preferably, the cancer includes cancer tissues or cells with inhibited ADRA2C expression and abnormally increased β-arrestins expression.
[0019] A product having an anti-cancer effect, the active ingredient of which is the polypeptide and / or the nucleic acid molecule described above.
[0020] Preferably, the administration methods of the product include: intravenous injection, intratumoral injection, subcutaneous injection, intramuscular injection, intradermal injection, intraperitoneal injection and oral administration.
[0021] Beneficial effects: The polypeptide TAT-ADRA2C-pep provided by the present invention is derived from the G protein-coupled receptor ADRA2C. The polypeptide TAT-ADRA2C-pep can replace the decreased ADRA2C expression and bind to β-arrestins, thereby inhibiting the β-arrestins-mediated breast cancer pathway and playing an anti-breast cancer role. The polypeptide TAT-ADRA2C-pep of the present invention has clinical application potential in the treatment of cancers with inhibited ADRA2C expression and abnormal β-arrestins expression such as breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 For the expression, solubility analysis and purification of the TAT-ADRA2C-pep polypeptide.
[0023] Figure 2 For the effect of the TAT-ADRA2C-pep peptide sequence on the proliferation of breast cancer MCF-7 and MDA-MB-361 cells.
[0024] Figure 3 Effect of TAT-ADRA2C-pep peptide sequence on cAMP levels in breast cancer MCF-7 and MDA-MB-361 cells
[0025] Figure 4 Effect of TAT-ADRA2C-pep peptide sequence on the expression level of β-arrestins. Lane 1: cancer cell control group; Lane 2: TAT-ADRA2C-pep polypeptide control group Specific implementation manners
[0026] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. In the quantitative experiments in this embodiment, unless otherwise specified, three replicates are set, and the results are averaged
[0027] Unless otherwise specified, the experimental methods in the following embodiments are all conventional molecular biology methods
[0028] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels
[0029] The breast cancer MCF-7 cells and MDA-MB-361 cells in the following embodiments are derived from ATCC (American Type Culture Collection)
[0030] Example 1 Obtaining of polypeptide TAT-ADRA2C-pep (1) Obtaining of TAT-ADRA2C-pep polypeptide with transmembrane activity Total RNA of MCF-7 cells was extracted and reverse transcribed to obtain cDNA. The coding sequence of the ADRA2C carboxyl-terminal polypeptide was amplified by PCR using cDNA as a template. Its upstream primer: 5'CCATCTCGAGATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTAACCAGGATTTCCGGCGATC3' (SEQ ID NO.3), downstream primer: 5' CGTCGGATCCCTGCCTGAAGCCCCTTCTC3' (SEQ ID NO.4). The TAT coding nucleic acid sequence was inserted into the upstream primer, and the restriction enzyme sites of XhoI and BamHI were added to the upstream and downstream primers respectively. An expression vector pWaldo-TAT-ADRA2C-pep was constructed by restriction enzyme digestion and ligation methods, and recombinants were screened
[0031] The correctly sequenced recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells. Subsequently, single colonies were picked and inoculated into 200 mL of LB liquid medium containing the appropriate antibiotic, and cultured overnight at 37°C in a constant temperature shaker (220 rpm) for 12 - 16 hours. The next day, 50 mL of the overnight culture was transferred to 1 L of fresh LB medium at an inoculation ratio of 1:20, and the culture was continued to shake at 37°C until the logarithmic growth phase (OD 600 value reached 0.5 - 0.6). At this time, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.5 mM, and the culture temperature was adjusted to 20°C for low-temperature induction expression, and the culture was continued for 20 hours to promote the production of soluble proteins. Finally, the cells were collected by centrifugation at 6000 × g for 15 minutes at 4°C, and the obtained cell pellet could be immediately used for protein purification or stored in a -80°C ultra-low temperature refrigerator for later use.
[0032] The collected cell pellet was resuspended in 120 mL of pre-cooled lysis buffer (20 mM Tris-HCl, pH 7.5; 300 mM NaCl; 5% glycerol), and lysozyme was added sequentially to a final concentration of 60 μg / mL, DNase I 200 U, and protease inhibitor PMSF (final concentration 1 mM). The cells were disrupted by cycling through a high-pressure cell disruptor at 800 bar pressure, and then centrifuged at 10,000 × g for 30 minutes at 4°C to collect the supernatant. SDS-PAGE analysis showed that under these expression and induction conditions, the TAT-ADRA2C-pep fusion GFP protein mainly existed in the form of soluble protein ( Figure 1 A).
[0033] The lysate supernatant was loaded onto a pre-equilibrated Ni-NTA affinity chromatography column, and 100 mL of wash buffer (20 mM Tris-HCl, pH 7.5; 300 mM NaCl; 5% glycerol; 30 mM imidazole) was used to remove the impurity proteins in turn, and then the target protein was eluted with elution buffer containing 300 mM imidazole. The affinity chromatography product was further separated by a Superdex 200 gel filtration chromatography column, and the chromatography buffer was 20 mM Tris-HCl (pH 7.5) containing 300 mM NaCl and 5% glycerol. Subsequently, 200 μL of 3 mg / mL TEV protease was added to the purified fusion protein solution, and the reaction was shaken at 4°C for 16 hours for site-specific cleavage. The digested product was passed through the Ni-NTA column again, and the uncleaved fusion protein (bound) and the cleaved GFP component (flow-through) were separated by the difference in histidine tags, and the flow-through containing the TAT-ADRA2C-pep polypeptide was collected. Through this step, high-purity TAT-ADRA2C-pep polypeptide could be obtained ( Figure 1 B).
[0034] The target polypeptide was concentrated to 10 mg / mL using an ultrafiltration centrifugal tube with a molecular weight cut-off of 3 kDa. After confirmation by protein electrophoresis, the purity was >90% (the specific sequence is shown in SEQ ID NO.1, and the corresponding coding gene is SEQ ID NO.2). After aliquoting, it was stored at -80 °C for subsequent functional studies.
[0035] Example 2 Application research of polypeptide TAT-ADRA2C-pep MTT assay: MCF-7 and MDA-MB-361 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 5×10³ cells / well and cultured adherently for 12 hours at 37 °C and 5% CO2 in DMEM medium containing 10% FBS. A gradient dosing strategy was adopted: initially, 0.2 mg / mL of the TAT-ADRA2C-pep polypeptide solution (dissolved in PBS) was added, and 0.1 mg / mL was added after 2 hours to maintain the final concentration. At the same time, a negative control group treated with an equal volume of PBS was set up.
[0036] After 48 hours of drug treatment, 10 μL of the pre-prepared 5 mg / mL MTT solution (prepared with PBS) was added to each well, and incubated at 37 °C in a constant temperature shaker (50 rpm) in the dark for 4 hours. The culture medium-MTT mixture in the wells was carefully aspirated, and 100 μL of DMSO was added to each well and shaken at 37 °C for 10 minutes. Due to the presence of MTT, viable cells will form crystals, and the crystals will then dissolve in the DMSO solution. The absorbance value at a wavelength of 490 nm was detected using an enzyme-linked immunosorbent assay detector ( Figure 2 )
[0037] Example 3 Effect of polypeptide TAT-ADRA2C-pep on cAMP level Using an ELISA kit, the effect of TAT-ADRA2C-pep treatment for 48 h on the cAMP level in the supernatant of MCF-7 and MDA-MB-361 cell culture media was detected. The cell culture medium was centrifuged at 1000 r / min for 10 min at room temperature (the cells were reserved), the supernatant was taken, 0.1 mol / L hydrochloric acid (final concentration) was added to the supernatant, mixed well, left standing for 15 min, neutralized with Tris solution, and added to the enzyme-linked immunosorbent assay plate to detect the change in cAMP level ( Figure 3 )
[0038] Example 4 Effect of TAT-ADRA2C-pep on the expression level of β-arrestins in breast cancer cells The effect of TAT-ADRA2C-pep treatment for 48 h on the expression level of β-arrestins in MCF-7 cells was detected by Western blot (Figure 4 ). After treatment with TAT-ADRA2C-pep for 48 h, the supernatant was removed, the cells were washed with PBS, and the cells were collected after trypsin digestion. Proteins were separated by SDS-PAGE, transferred to membranes, incubated with primary antibodies overnight at 4°C, the membranes were washed with TBST, incubated with secondary antibodies for 1 h at room temperature, and developed.
[0039] As Figure 1 shown, TAT-ADRA2C-pep polypeptide with high purity (>90%) can be obtained according to this embodiment; as Figure 2 shown, TAT-ADRA2C-pep polypeptide can significantly inhibit the proliferation of breast cancer MCF-7 and MDA-MB-361 cells; as Figure 3 shown, TAT-ADRA2C-pep polypeptide can significantly increase the cAMP levels of breast cancer MCF-7 and MDA-MB-361; as Figure 4 shown, TAT-ADRA2C-pep polypeptide can significantly inhibit the expression levels of β-arrestin-1 and β-arrestin-2 in MCF7 cells.
[0040] In summary: The polypeptide TAT-ADRA2C-pep of the present invention can interact with ADRA2C and β-arrestins instead, thereby releasing the G protein signaling pathway of ADRA2C, disrupting the β-arrestins signaling pathway, and playing a role in inhibiting breast cancer cells.
Claims
1. A polypeptide with cancer inhibitory effect, characterized in that, Its name is TAT-ADRA2C-pep, which is a polypeptide consisting of amino acid residues at positions 12-33 of the amino acid sequence shown in SEQ ID NO: 1 or a polypeptide of the amino acid sequence shown in SEQ ID NO:
1.
2. A nucleic acid molecule encoding the polypeptide according to claim 1, characterized in that, It is a DNA molecule shown by nucleotides at positions 34 to 99 from the 5'-end of SEQ ID NO: 2 or a DNA molecule shown in SEQ ID NO:
2.
3. An expression cassette, recombinant vector or recombinant bacterium containing the nucleic acid molecule according to claim 2.
4. Use of the polypeptide and / or the nucleic acid molecule according to claim 2 in the preparation of a product having an anti-cancer effect.
5. The application according to claim 4, characterized in that, The anti-cancer effect includes inhibiting the proliferation of cancer cells.
6. The application according to claim 4, wherein The cancer includes breast cancer.
7. The application according to claim 4, wherein The cancer includes cancer tissues or cells with inhibited ADRA2C expression and abnormally increased β-arrestins expression.
8. A product with cancer-inhibiting effect, characterized in that, Its active ingredient is the polypeptide and / or the nucleic acid molecule according to claim 2.
9. The product with cancer-inhibiting effect according to claim 8, characterized in that, The administration routes of the product include: intravenous injection, intratumoral injection, subcutaneous injection, intramuscular injection, intradermal injection, intraperitoneal injection and oral administration.