Formate dehydrogenase for realizing direct electron transfer as well as mutant and application of formate dehydrogenase

Abstract

The invention provides formate dehydrogenase for realizing direct electron transfer as well as a mutant and application of the formate dehydrogenase. The mutant takes an amino acid sequence as shown in SEQ ID NO.1 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 97%, 98% or 99% of identity with the SEQ ID NO.1 as a parent, contains at least one of the following sites or equivalent positions E263, L273, H264, R363, E228, H224C, E243 and H224, and is an amino acid sequence which is subjected to amino acid mutation and has a formate dehydrogenase activity function. The mutant provided by the invention can realize direct electron transfer, shows higher CO2 reduction current in a DET system, has higher catalytic ability or efficiency in a CO2 reduction reaction, and improves the turnover rate or conversion rate of CO2.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a formate dehydrogenase capable of realizing direct electron transfer, and a mutant thereof and application thereof. Background Art

[0002] Formate dehydrogenase (FDH) is an oxidoreductase that specifically catalyzes the reversible conversion of CO2 to formate. There are two types of FDH: NADH-dependent FDH, which is oxygen-tolerant, easy to express, and has high yields, but has low CO2-reducing enzyme activity (FEBS Lett. 1972, 27(1), 111-115;); and metal-dependent FDH (Science 1997, 275(5304), 1305-1308; Science 2002, 295(5561), 1863-1868.). This type of FDH exhibits high enzymatic activity and high turnover for CO2 reduction, but has problems such as oxygen intolerance, difficulty in expression, and low yields. In the CO2EER system, when FDH catalyzes CO2, its electrons can mediate the transfer of electron mediators or coenzymes to the electrode to achieve efficient reduction of CO2. However, the process mediated by electron mediators consumes energy. Therefore, many studies now focus on direct electron transfer systems (DET) that do not rely on coenzymes and electron mediators, that is, the direct transfer of electrons between the enzyme's interfacial electron exchange site and the electrode interface. DET can not only simplify the CO2EER system, but also avoid the reduction of redox potential caused by coenzymes and electron mediators. More importantly, the study found that in the DET system, if the directional immobilization of formate dehydrogenase is achieved, it is expected to achieve a turnover rate of CO2 (such as ClFDH: 1210s -1 ) is higher than the enzyme system with electron mediator as electron acceptor (ClFDH: 0.73s -1 (CarbonEnergy 2023, 1-13.), therefore, it is speculated that the electron transfer rate from the interfacial electron exchange sites of formate dehydrogenase to the electron donor plays a crucial role in the CO2 conversion rate. Research on DET systems with targeted immobilization of formate dehydrogenase is expected to improve CO2 conversion.

[0003] Previous studies have shown that SfFDH (PNAS 2008, 105(31), 10654-10658.) and EcFDH (JACS 2014, 136(44), 4592; JACS 2017, 139(29), 9927-9936) can achieve DET, but strict anaerobic conditions limit the application of these two enzymes. Among oxygen-tolerant FDHs, DvFDH (PNAS 2008, 105(31), 10654-10658; ACS Catal. 2017, 7(11), 7558-7566; Angew. Chem. Int. Ed. 2019, 58(23), 7682-7686) and ClFDH (Adv. Energy Mater. 2019, 9(25); ACS Sustain. Chem. Eng 2022, 10(45), 14888–14896) also achieved reversible electrocatalysis of CO2 to formate, while DvFDH was complex to express and purify (ACS Catal. 2020, 10(6), 3844-3856) and ClFDH had a low CO2 reductase activity (9.4 mU / mg) (J CO2. Util 2022, 57, 101876) limits the engineering application of these two enzymes. In CO2EER systems constructed with NADH-dependent FDHs, NADH is generally used as an electron mediator to mediate electron transfer to the electrode interface, resulting in energy loss and difficulty in NADH regeneration. However, NADH-dependent FDHs generally have advantages such as oxygen tolerance, ease of expression, and high yield. If an efficient and rapid electron transfer pathway from the interfacial electron exchange site to the amino acid residues on the enzyme surface could be discovered in NADH-dependent FDHs, precise and targeted immobilization could be achieved to achieve in situ regeneration of NADH, which would open up the possibility of constructing CO2EER systems for engineered DET. TsFDH has the highest enzyme activity among NADH-dependent FDHs, its crystal structure and NADH binding site have been elucidated, and expression and purification methods are mature. In summary, TsFDH has the potential for efficient and rapid DET research and is expected to improve CO2 conversion rates through CO2EER formic acid production reaction systems. Therefore, attempting to explore and establish the electron transfer pathway for efficient and rapid DET in TsFDH is of great scientific significance and a major challenge in the current TsFDH research field. Summary of the Invention

[0004] To address the shortcomings of the prior art, the present invention provides a formate dehydrogenase capable of direct electron transfer, as well as mutants and applications thereof. Using an amino acid sequence such as SEQ ID NO. 1 as a parent and its structure (PDB: 3WR5) as a design template, a rational design was performed, with predicted sites mutated, enzyme kinetics tested, and electrochemically verified to obtain formate dehydrogenase mutants capable of direct electron transfer.

[0005] In one aspect of the present invention, a formate dehydrogenase mutant is provided, wherein the amino acid sequence is 1) or 2):

[0006] 1) An amino acid sequence having an amino acid sequence as shown in SEQ ID NO. 1 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto as a parent, comprising at least one of the following positions or positions equivalent thereto, E263, L273, H264, R363, E228, E243, H224, subjected to amino acid mutations and having formate dehydrogenase activity;

[0007] 2) An amino acid sequence as shown in 1) having the same function after substitution and / or deletion and / or addition of one or more conservative amino acid residues.

[0008] In one embodiment of the present invention, the nucleotide sequence of the parent is as shown in SEQ ID No. 9, or a nucleotide sequence with at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to SEQ ID No. 9.

[0009] In one embodiment of the present invention, the amino acid sequence of the formate dehydrogenase mutant comprises an amino acid substitution at at least one site selected from the group consisting of E263C, L273C, H264C, R363C, E228C, E243C, and H224C. In one embodiment of the present invention, the amino acid substitution is selected from E263C. In one embodiment of the present invention, the amino acid substitution is selected from L273C. In one embodiment of the present invention, the amino acid substitution is selected from H264C. In one embodiment of the present invention, the amino acid substitution is selected from R363C. In one embodiment of the present invention, the amino acid substitution is selected from E228C. In one embodiment of the present invention, the amino acid substitution is selected from E243C. In one embodiment of the present invention, the amino acid substitution is selected from H224C.

[0010] In one embodiment of the present invention, the formate dehydrogenase mutant comprises an amino acid substitution selected from any one of the following sites: E263C, L273C, H264C, and R363C. Preferably, the formate dehydrogenase mutant comprises an amino acid substitution selected from the E263C site or the L273C site.

[0011] In one embodiment of the present invention, the amino acid sequence of the formate dehydrogenase mutant is as shown in any one of SEQ ID NOs: 2-8, or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the sequence shown in any one of SEQ ID Nos. 2-8.

[0012] In one embodiment of the present invention, compared with the wild-type formate dehydrogenase, the formate dehydrogenase mutant exhibits a higher CO2 reduction current in the DET system and has a higher catalytic ability or efficiency in the CO2 reduction reaction.

[0013] In a second aspect, the present invention provides a polynucleotide encoding the formate dehydrogenase mutant.

[0014] In one embodiment of the present invention, the polynucleotide comprises single-stranded or double-stranded DNA, cDNA, RNA or other artificial nucleic acids.

[0015] In one embodiment of the present invention, the polynucleotide includes nucleotide sequences of an open reading frame (ORF) and an untranslated region (UTR).

[0016] In a third aspect, the present invention provides a vector containing the above-mentioned polynucleotide.

[0017] In one embodiment of the present invention, the vector may be any vector such as a plasmid, a phage, a virus, a YAC vector, a shuttle vector, or the like.

[0018] In one embodiment of the present invention, the plasmid includes but is not limited to pET series, pACYC series or pGEX series, etc. In one embodiment, the plasmid is pET-20b(+) vector.

[0019] In one embodiment of the present invention, the vector is an expression vector, which may contain a transcription promoter, a terminator, a ribosome binding site, an enhancer, an A-addition signal, a ribosome binding sequence (SD sequence), an antibiotic (e.g., ampicillin, neomycin, kanamycin, tetracycline, chloramphenicol, etc.) resistance gene, and other selection marker genes.

[0020] In a fourth aspect, the present invention provides a host cell containing the polynucleotide or the vector.

[0021] In one embodiment of the present invention, the host cell is obtained by introducing a polynucleotide encoding the mutant protease or a vector (preferably a recombinant expression vector) containing the polynucleotide.

[0022] In one embodiment of the present invention, the host cell includes bacteria such as Escherichia coli and Bacillus subtilis, fungi such as yeast, animal cells, and plant cells. In one embodiment of the present invention, the host cell is Escherichia coli.

[0023] In one embodiment of the present invention, the introduction method may include transformation methods such as calcium phosphate method, electroporation method, lipofection method, gene gun, and PEG method.

[0024] In a fifth aspect, the present invention provides a method for preparing the formate dehydrogenase mutant, comprising culturing the host cell in a culture medium to obtain the mutant.

[0025] In one embodiment of the present invention, the culture medium includes any culture medium suitable for culturing the aforementioned host cells. For example, a culture medium suitable for host cells such as Escherichia coli and yeast cells can be used, as long as the culture medium can utilize a carbon source, nitrogen source, inorganic salts, etc. for culturing the host cells. Examples include LB medium and 2×YT medium. During the culturing of the host cells, an inducer, such as IPTG, can be added to the culture medium.

[0026] In one embodiment of the present invention, rational design is used to predict the surface sites that can achieve direct electron transfer of TsFDH based on the structure of TsFDH; and target mutants are obtained by plasmid amplification using site-directed mutagenesis primers.

[0027] In one embodiment of the present invention, the following steps are specifically included:

[0028] (1) predicting the surface site that can achieve direct electron transfer of TsFDH based on the structure of TsFDH, mutating the predicted site to cysteine, inoculating a single clone of the host cell containing the recombinant plasmid into 5 mL of liquid LB medium, and culturing at 37°C overnight to obtain a seed solution;

[0029] (2) The seed solution was inoculated into LB medium at a 1% inoculum size and cultured at 37°C until the biomass OD600 reached 0.6-0.8. Then, the inducer was added and cultured at 16°C for 12-16 h. The cells were collected by centrifugation.

[0030] (3) The cells collected by centrifugation were disrupted by high-pressure homogenization, and the disrupted liquid was centrifuged at 8000 rpm at 4°C for 25 min to obtain a crude enzyme solution;

[0031] (4) The crude enzyme solution was subjected to nickel column affinity chromatography to obtain pure TsFDH mutant enzyme.

[0032] In a sixth aspect, the present invention provides an enzyme electrode for enzyme electrocatalytic reduction, comprising a metal electrode and a formate dehydrogenase mutant coated on the surface of the metal electrode.

[0033] In one embodiment of the present invention, the metal electrode is selected from an ITO electrode, an FTO electrode, a glassy carbon electrode, a gold electrode, a carbon electrode or a carbon cloth electrode.

[0034] In one embodiment of the present invention, the loading amount of the formate dehydrogenase mutant on the metal electrode is 0.1-0.4 mg / cm 2 .

[0035] In one embodiment of the present invention, the formate dehydrogenase mutant is coated on the surface of a metal electrode and incubated to allow the mutant to bind to the electrode surface; then, the surface active sites on the metal electrode that are not bound to the formate dehydrogenase mutant are blocked to obtain the enzyme electrode.

[0036] In a seventh aspect, the present invention further provides an enzyme electroreactor, comprising the above enzyme electrode, wherein the enzyme electrode is a working electrode.

[0037] In an eighth aspect, the present invention provides a method for performing a catalytic reduction reaction using the above-mentioned enzyme electrode or enzyme electroreactor, comprising contacting the enzyme electrode or enzyme electroreactor with a reaction solution and generating a current to carry out the reaction, wherein the reaction solution comprises an electrolyte and a substrate. The substrate is a substrate for formate dehydrogenase. The electrolyte comprises at least one of a phosphate buffer, a carbonate buffer, a Tris-HCl buffer, a PBS buffer, and the like.

[0038] In a ninth aspect, the present invention provides the use of the formate dehydrogenase mutant, polynucleotide, vector, host cell, enzyme electrode, and enzyme-electroreactor in the preparation of fuel cells, hydrogen storage materials, fine chemicals (including methanol, ethanol, or other organic acid / alcohol compounds), and biofuels.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The mutant of the present invention can realize direct electron transfer, exhibit a higher CO2 reduction current in the DET system, have a higher catalytic ability or efficiency in the CO2 reduction reaction, and improve the turnover rate or conversion rate of CO2. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Diagram of the design concept for direct electron transfer of TsFDH;

[0042] Figure 2 This is the result of the enzymatic performance test of the TsFDH mutant;

[0043] Figure 3 : Testing of direct electron transfer performance of TsFDH mutants. DETAILED DESCRIPTION

[0044] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0045] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0046] "Parent" refers to a polypeptide whose amino acid residues are mutated to form a mutant. In other words, the "parent" is the polypeptide before the polypeptide mutant is mutated.

[0047] "Amino acid mutation" refers to the replacement of an amino acid residue at a given position (e.g., a naturally occurring amino acid residue in wild-type TsFDH (e.g., SEQ ID NO: 1)) with another amino acid residue (e.g., other than a naturally occurring residue). For example, the naturally occurring amino acid residue at position 263 of the wild-type TsFDH sequence (SEQ ID NO: 1) is glutamic acid (E) (E263); therefore, an amino acid substitution at E263 refers to the replacement of the naturally occurring glutamic acid with any amino acid residue other than asparagine.

[0048] A "position equivalent thereto" refers to an amino acid in a polypeptide of interest that aligns with the equivalent amino acid in a specified sequence when the polypeptide and the sequence are optimally aligned. This can be determined by aligning (aligning) the target sequence and a reference sequence (e.g., the amino acid sequence of SEQ ID NO: 1) in a manner that maximizes identity. Amino acid sequence alignment can be performed using a well-known algorithm, and the methods are well known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple sequence alignment program (Thompson, J.D. et al., 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Alternatively, Clustal W2 or Clustal Omega, which are revisions of Clustal W, can also be used. For example, Clustal W, Clustal W2, and Clustal Omega are available on the website of the European Bioinformatics Institute (EBI [www.ebi.ac.uk]). A position in a target sequence that matches any position in a reference sequence through the above alignment is considered a "position equivalent thereto." For example, the amino acid corresponding to a position in SEQ ID NO: 1 can be determined using an alignment algorithm such as BLAST. In some embodiments, the amino acid position corresponding to SEQ ID NO: 1 is determined by aligning it with another TsFDH sequence.

[0049] A "polynucleotide" is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, typically read from the 5' to the 3' end. Polynucleotides include RNA and DNA and can be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.

[0050] "Identity" The identity of nucleotide sequences and amino acid sequences can be calculated using the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it can be calculated using the Search homology program of the genetic information processing software Genetyx-Win, with the unit size to compare (ktup) set to 2.

[0051] "Operably linked" means that a gene and a regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Methods of "operably linked" are well known to those skilled in the art.

[0052] The term "host cell" refers to any cell capable of replicating and / or transcribing and / or translating a heterologous polynucleotide. Thus, a "host cell" refers to any prokaryotic cell (including but not limited to Escherichia coli (E. coli)) or eukaryotic cell (including but not limited to yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo. For example, a host cell can be located in a transgenic animal or transgenic plant. A host cell can, for example, be transformed with a heterologous polynucleotide.

[0053] "Vector" refers to a nucleic acid that contains a coding sequence and sequences necessary for expression of the coding sequence. Vectors can be viral or non-viral. "Plasmids" are non-viral vectors, such as nucleic acid molecules that encode genes and / or regulatory elements required for gene expression. "Viral vectors" are nucleic acids of viral origin that are capable of transporting another nucleic acid into a cell. When present in the appropriate environment, viral vectors are capable of directing the expression of one or more proteins encoded by one or more genes carried by the vector. Examples of viral vectors include, but are not limited to, retroviral, adenoviral, lentiviral, and adeno-associated viral vectors.

[0054] "Direct electron transfer" means that when the formate dehydrogenase mutant catalyzes the substrate (CO2), electrons are directly transferred to the electron acceptor (such as a metal electrode) through the active site of the enzyme without relying on traditional cofactors, thereby achieving direct electron transfer.

[0055] Example 1 Surface site design of TsFDH enzyme

[0056] The Pymol Find Surface Residuce plug-in was used to identify amino acid residues on the protein surface, and residues with high electron coupling matrix (T DA ) residues, and screened by the method shown below, and mutated the screened residues to cysteine.

[0057] 1. The residue is not in the surface depressions.

[0058] 2.CB atoms are points outside the protein.

[0059] 3. When the residue is mutated to cysteine, the structural stability is essentially unaffected.

[0060] 4. The electron transfer pathway does not cross the protein-protein interaction interface.

[0061] Then, for each mutant system, a molecular dynamics (MD) simulation was performed using Amber for 100 ns. In the fourth step, T was calculated based on the MD trajectory using Pathways (VMD plug-in) developed by Balabin and Beratan. DA , and based on the calculated T DA Potential direct electron pathways of selected mutant proteins.

[0062] According to the Fermi-Golden rule, calculate the electron transfer rate k ET .

[0063] The electron transfer rate (k ET ) is determined by four variables, namely the electron coupling matrix (T DA ), driving force (ΔG), reorganization energy (λ) and temperature T, in calculating k ET We assume that the driving force (ΔG) and reorganization energy (λ) of different protein crystal conformations remain unchanged, and the electron transfer rate is mainly determined by T DA Decision. Select k ET The higher the electron pathway, the more amino acid residues it passes through are determined for subsequent experimental verification and analysis.

[0064] Example 2 Plasmid construction of predicted mutants

[0065] Based on the predicted TsFDH surface sites in Example 1, positions 263, 273, 264, 363, 228, 243, and 224 were site-directed mutated to cysteine.

[0066] The required cells and reagents are as follows: wild-type expression plasmid pET-20b(+) was obtained from our laboratory; Escherichia coli Top10 and BL21(DE3) were both homemade and commercially available; nickel affinity chromatography filler was purchased from Sigma and packed as needed for protein purification; β-nicotinamide adenine dinucleotide (NAD + ) and β-nicotinamide adenine dinucleotide coenzyme reduced (NADH) were purchased from Aladdin Company, and the other reagents were domestically produced or imported of analytical grade.

[0067] The target mutant was obtained by PCR amplification using site-directed mutagenesis primers and the mutant plasmid pET-20b(+)-TsFDH containing the previous laboratory work as a template. The PCR amplification procedure is as follows: pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 90 seconds, 25 cycles; extension at 72°C for 5 minutes. The above product was digested with DpnI at 37°C for 1 hour, purified using a DNA reagent purification kit, and then transformed into Escherichia coli competent top 10 to obtain positive clones. After the single clone was picked and sequenced correctly, different mutants were obtained, and the recombinant plasmids of 6 mutants were extracted for use. The specific primer sequences are shown in Table 1:

[0068] Table 1 Primers used for site-directed mutagenesis

[0069] Primer Name Primer Sequence H264C-r(SEQ ID NO:10) CTGCATCCGGAAACCGAATGCATGATCAATGATGAA H264C-f(SEQ ID NO:11) TTCATCATTGATCATGCATTCGGTTTCCGGATGCAG E263C-r(SEQ ID NO:12) CTGCATCCGGAAACCTGCCACATGATCAATGATGAA E263C-f(SEQ ID NO:13) TTCATCATTGATCATGTGGCAGGTTTCCGGATGCAG L273C-r(SEQ ID NO:14) ACGCTGAAACTGTGCAAGCGTGGCGCTTAT L273C-f(SEQ ID NO:15) ATAAGCGCCACGCTTGCACAGTTTCAGCGT R363C-r(SEQ ID NO:16) GGTCGTCCGATTCGCTGCGAATATCTGATCGTG R363C-f(SEQ ID NO:17) CACGATCAGATATTCGCAGCGAATCGGACGACC E243C-r(SEQ ID NO:18) CACATCGCAGTGCGGTGTCATGTCTTCGCGGGT E243C-f(SEQ ID NO:19) ACCCGCGAAGACATGACACCGCACTGCGATGTG E228C-r(SEQ ID NO:20) CGTCACCGTCTGCCGtgcGCAGTGGAAAAAGAA E228C-f(SEQ ID NO:21) TTCTTTTTCCACTGCgcaCGGCAGACGGTGACG H224C-r(SEQ ID NO:22) ACCCGCGAAGACATGACACCGCACTGCGATGTG H224C-f(SEQ ID NO:23) CACATCGCAGTGCGGTGTCATGTCTTCGCGGGT

[0070] Example 3 Expression and purification of TsFDH mutants

[0071] The TsFDH mutant plasmid obtained in Example 2 was transformed into E. coli BL21 (DE3) for expression of the TsFDH mutant. The specific steps are as follows:

[0072] (1) Preparation of Escherichia coli strains expressing TsFDH mutants. Positive strains screened were streaked onto LB solid medium (100 μg / mL ampicillin) until a single colony emerged. A single colony was selected and inoculated into liquid LB medium. The culture was shaken at 37°C and 200 rpm for 12–16 h to obtain a seed solution.

[0073] (2) Induced expression and screening of mutant enzymes. The inducible expression conditions of the six mutant enzymes were consistent with those of the wild-type TsFDH. The overnight culture seed liquid was inoculated into LB medium at a 1% inoculum size and cultured at 37°C until the biomass OD600 reached 0.6-0.8. Then, the inducer isopropyl-β-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.1mM and induced at 16°C for 12-16h. The bacteria were collected by centrifugation at 4°C. The collected bacteria were added to the crushing solution (50mM PBS, pH 7.0) and crushed by high-pressure homogenization (pressure 1000bar) for 1min, and then centrifuged at 8000rpm at 4°C for 25min to collect the supernatant. The supernatant was directly applied to a nickel affinity chromatography column. Contaminants were eluted using equilibration buffer (50 mM PBS, pH 7.0, containing 20 mM imidazole), followed by elution of the target protein using elution buffer (50 mM PBS, pH 7.0, containing 200 mM imidazole). The target protein was concentrated by centrifugation in a centrifuge tube and diluted to a concentration of less than 0.1 mM imidazole.

[0074] Example 4 Enzymatic performance test of TsFDH mutant

[0075] The principle of the TsFDH mutant activity assay is as follows: Under the catalysis of TsFDH, the absorbance of the cofactor NADH at 340nm will decrease. The concentration change of NADH is calculated based on the molar extinction coefficient, and thus the TsFDH enzyme activity is calculated. Under the detection conditions, the extinction coefficient of NADH is 6.22mM -1 cm -1 The enzyme activity was defined as 1 U of enzyme required to catalyze the consumption of 1 μmol of NADH per mg of TsFDH at 37°C.

[0076] The specific steps are as follows:

[0077] (1) Final concentrations of the reaction solution: 50 mM NaHCO3, 0.1, 0.2, 0.4, 0.8, 1.2, 1.6, 2.0, 2.5, 3.0, 4.0 mM NADH solution, 100 mg / L TsFDH mutant.

[0078] (2) Add the above reaction solution to a 96-well plate, 250 μL per well, and react at 25°C for 40 min.

[0079] (3) GraphPad Prism software was used to calculate the enzyme kinetic parameters by nonlinear regression ( Figure 2 ).

[0080] The results showed that compared with the wild-type formate dehydrogenase, the Km and Vmax of all TsFDH mutants changed little, indicating that these sites had little effect on the enzymatic performance.

[0081] Example 5: Testing of direct electron transfer by TsFDH mutants

[0082] A gold electrode was selected as the base electrode and polished with Al2O3. The electrode was electrochemically activated in 0.5M H2SO4 with a scan range of -0.3V to 1.5V, a scan rate of 50mV / s, and 20 scans. The electrode was then ultrasonically cleaned with ultrapure water and ethanol for 5min each and dried with nitrogen. 10μl of the above-mentioned active mutant at 2g / L was applied to the surface of the Au electrode and incubated overnight at 37°C. This was labeled FDH / Au. The next day, unbound mutants were washed with ultrapure water and dried with N2. The FDH / Au was immersed in a 1mM 6-mercapto-1-hexanol (MCH) solution for 1h to allow MCH to block unbound active sites on the gold electrode surface. This was labeled FDH / M / Au and used later. First, all mutant electrodes were subjected to time-current tests with the voltage set at -1.0 V, the electrolyte being 0.1 M PBS (pH 6), 50 mM sodium bicarbonate added, and CO2 continuously introduced for two hours, and the current response was recorded.

[0083] Compare the reduction currents of CO2 by different mutant enzyme electrodes, and screen out mutant electrodes that can directly transfer electrons based on the size of the reduction current ( Figure 3 ).

[0084] The results show that compared with the wild-type formate dehydrogenase, the mutants E263C, L273C, H264C, and R363C exhibited higher CO2 reduction currents, with the reduction currents increased by 16 times, 14 times, 8 times, and 1 times, respectively, indicating that these mutant enzymes have higher catalytic ability or efficiency in the CO2 reduction reaction.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

[0086] SEQ ID NO: 1

[0087]

[0088] SEQ ID NO:2

[0089]

[0090] SEQ ID NO:3

[0091]

[0092] SEQ ID NO:4

[0093]

[0094]

[0095] SEQ ID NO:5

[0096]

[0097] SEQ ID NO:6

[0098]

[0099] SEQ ID NO:7

[0100]

[0101] SEQ ID NO:8

[0102]

[0103] SEQ ID NO.9 Sequence:

[0104]

[0105]

Claims

1. A formate dehydrogenase mutant, characterized in that: Its amino acid sequence is 1) or 2): 1) Using the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No.1 as the parent, containing at least one of the following sites or the corresponding positions E263, L273, H264, R363, E228, E243, H224, and having an amino acid sequence with formate dehydrogenase activity function after amino acid mutation; 2) An amino acid sequence having the same function as that shown in 1) after substitution and / or deletion and / or addition of one or several conservative amino acid residues.

2. The formate dehydrogenase mutant according to claim 1, wherein: The amino acid sequence of the formate dehydrogenase mutant contains an amino acid substitution at at least one site selected from the group consisting of: E263C, L273C, H264C, R363C, E228C, E243C, H224C; preferably E263C, L273C, H264C, R363C; Preferably, the amino acid sequence of the formate dehydrogenase mutant is as shown in any one of SEQ ID NO:2-8 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the sequence shown in any one of SEQIDNo.2-8; Preferably, compared with the wild-type formate dehydrogenase, the formate dehydrogenase mutant exhibits a higher CO2 reduction current in the DET system and has a higher catalytic ability or efficiency in the CO2 reduction reaction.

3. A polynucleotide encoding the formate dehydrogenase mutant according to claim 1 or 2.

4. A vector containing the polynucleotide according to claim 3.

5. A host cell containing the polynucleotide according to claim 3 or the vector according to claim 4; Preferably, the host cell is obtained by introducing the polynucleotide encoding the mutant protease or the vector containing the polynucleotide; Preferably, the host cell includes bacteria such as Escherichia coli and Bacillus subtilis, fungi such as yeast, animal cells, and plant cells; more preferably, the host cell is Escherichia coli.

6. A method for preparing the formate dehydrogenase mutant according to claim 1 or 2, characterized in that: Culturing the host cell according to claim 5 in a medium to obtain the mutant.

7. An enzyme electrode for enzyme electrocatalytic reduction, characterized in that: Including a metal electrode and the formate dehydrogenase mutant according to claim 1 or 2 covering the surface of the metal electrode.

8. An enzyme electrode reactor, characterized in that: it includes the enzyme electrode according to claim 7, and the enzyme electrode is a working electrode.

9. A method for catalytic reduction reaction using the enzyme electrode according to claim 7 or the enzyme electroreactor according to claim 8, characterized in that: Including contacting the enzyme electrode or the enzyme electrode reactor with the reaction solution to generate current for reaction; the reaction solution includes an electrolyte solution and a substrate; the substrate is a substrate of formate dehydrogenase; the electrolyte solution includes at least one of a phosphate buffer solution, a carbonate buffer solution, a Tris-HCl buffer solution, and a PBS buffer solution.

10. Use of the formate dehydrogenase mutant according to claim 1 or 2, the polynucleotide according to claim 3, the vector according to claim 4, the host cell according to claim 5, the enzyme electrode according to claim 7, and the enzyme electroreactor according to claim 8 in the preparation of fuel cells, hydrogen storage materials, fine chemicals (including methanol, ethanol or other organic acid / alcohol compounds), and biofuels.

Images