Nucleic acid molecule for recruiting ligand to enhance antigen presentation effect, fusion protein and mRNA vaccine

By introducing E3 ubiquitinase ligase ligand into mRNA tumor vaccines, proteasome degradation of antigen proteins is solved, and the existing mRNA tumor vaccines have been solved, and the effective tumor immunotherapy effect has been achieved.

CN120366346APending Publication Date: 2025-07-25WESTGENE BIOPHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510138826.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-10-24
Filing Date
2023-10-20
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing mRNA tumor vaccines still need to be optimized in enhancing antigen presentation efficiency and T cell immune response, especially in mRNA sequence design and synthesis, translation efficiency and stability, antigen presentation efficiency, T cell immune response intensity, etc., to further improve anti-tumor immunotherapy activity.

Method used

Design a nucleic acid molecule whose open reading frame contains the binding or recruitment ligand of antigen elements and E3 ubiquitinase ligase. By fusing the expression of antigen protein and E3 ubiquitin ligase ligand, it promotes the degradation of antigen protein through the proteasome pathway, increases the number and abundance of antigen peptides, forms more peptide-MHC complexes, and enhances the immune response.

Benefits of technology

It improves the antigen presentation effect, enhances the effect of tumor immunotherapy, achieves an efficient tumor immune response, has strong immunogenicity, and is suitable for the sequence design and preparation of nucleic acid, protein and polypeptide vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366346A_ABST
    Figure CN120366346A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicines, and mainly relates to a design method of a vaccine for enhancing an antigen presentation effect, which is applied to structural sequence design and preparation of nucleic acid, protein and polypeptide vaccines. According to the invention, a target antigen and ligands such as a polypeptide or a protein structural domain with an E3 ubiquitin ligase binding or recruiting function are jointly coded in the same nucleic acid sequence, so that fusion expression of an antigen protein and an E3 ubiquitin ligase ligand is realized after a nucleic acid molecule enters a cell, and then degradation of the antigen protein through a proteasome path is promoted; the number and abundance of antigen peptides with epitopes are increased, more peptide-MHC (p-MHC) compounds are formed and then presented to the cell surface, the subsequent immune response is enhanced, and the efficient tumor immunotherapy effect is achieved. The nucleic acid vaccine, the protein vaccine and the polypeptide vaccine provided by the invention have an efficient antigen presentation effect and relatively strong immunogenicity, and have a very good clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to nucleic acid molecules, fusion proteins, their vaccines and applications that can enhance the antigen presentation effect, especially mRNA vaccines. Background Art

[0002] mRNA vaccines are a brand-new type of vaccine, which have the advantages of high generality, high potency, fast construction, easy scale-up production, etc., and have important clinical value and application prospects. The emerging nucleic acid vaccines (mRNA or DNA) have very obvious timeliness advantages as emergency vaccines. In fact, using mRNA vaccines to induce anti-tumor immune effects in the body has shown great potential, and many research results have entered the clinical trial stage. mRNA tumor vaccines are a tumor treatment method that introduces tumor antigens into patients in the form of mRNA, stimulates T cells in the patients' bodies through the tumor antigens, and activates the patients' own specific cellular immunity. At present, there is no marketed product for mRNA tumor vaccines, but 19 clinical trials have been registered globally, and the fastest has reached the clinical phase II stage. Nevertheless, the existing mRNA tumor vaccines still need to be optimized and improved in enhancing antigen presentation efficiency and T cell immune response, especially in aspects such as mRNA sequence design and synthesis, translation efficiency and stability, antigen presentation efficiency, and T cell immune response intensity, so as to further improve the anti-tumor immune therapy activity and accelerate clinical transformation.

[0003] mRNA tumor vaccines mainly translate mRNA into target antigen proteins through the translation mechanism of antigen-presenting cells (APCs). Some of these antigen proteins will undergo ubiquitination degradation through the proteasome degradation pathway, thereby generating a large number of antigen peptides with antigenic epitopes. These antigen peptides are transported to the endoplasmic reticulum (ER) by the antigen processing transporter (TAP), modified by the N-terminal aminopeptidases ERAP1 and ERAP2, then loaded onto MHC class I proteins, further transported to the cell surface, and recognized by antigen-specific CD8+ T cells, thereby presenting the antigenic epitope information to CD8+ T cells. Alternatively, the secreted antigen proteins can be absorbed by professional antigen-presenting cells located in tissues or lymph nodes, degraded into a large number of antigen peptides through the lysosomal degradation pathway, and then replace the CLIP (MHC class II molecule-associated invariant chain peptide) in the antigen-binding groove of MHC class II molecules to form a stable antigen peptide-MHC class II complex, which is then transported to the cell membrane for recognition by CD4+ T cells, and further presents the antigenic epitope information to CD8+ T cells. In addition, APCs can also present internalized exogenous antigens to the cell surface through the MHC-I pathway, that is, "cross-presentation" occurs. The cross-presentation process is crucial for mRNA vaccines to induce cytotoxic T lymphocyte (CTL) and B cell responses.

[0004] To effectively induce an adaptive immune response, antigens after translation in antigen-presenting cells (especially DC cells) need to be presented through MHC class I and MHC class II molecules. Thus, the antigen presentation process is an important factor affecting the immune effect of mRNA vaccines. All endogenous proteins are affected by MHC class I antigen presentation, and only a part of intracellular antigens are presented by MHC class II molecules. However, the process of MHC class I antigen presentation is usually not efficient. Even for high-affinity MHC class I ligands, only one in ten thousand antigen peptides are presented. Therefore, achieving efficient presentation of MHC class I and MHC class II antigens is of great significance for the development of mRNA vaccines. Currently, common strategies include co-delivering MHC molecules with antigens or targeting antigens to MHC molecules to enhance the presentation efficiency. It has been reported that the combined application of a DNA molecule encoding HPV-16E7 and a DNA vaccine encoding a xenogeneic MHC molecule can enhance the cross-presentation mechanism, significantly enhancing the E7-specific immune response and anti-tumor effect.

[0005] A series of steps in antigen processing and presentation can affect the amount of epitope / MHC complexes presented on the cell surface. In addition to enhancing antigen presentation using MHC class I and MHC class II molecules, increasing the molecular number of antigen peptides with antigenic epitopes that are degraded is also an important and effective means of enhancing antigen presentation. Most MHC class I antigen peptides are generally generated in a proteasome-dependent manner. Strategies for increasing proteasome-dependent degradation of antigens have been shown to improve MHC class I presentation of antigens, thereby enhancing the E7-specific CD8+ T cell immune response and significantly increasing the potency of the vaccine. Therefore, targeting the proteasome to increase antigen proteasome degradation may provide a new approach for the development of nucleic acid drugs. Summary of the Invention

[0006] To solve the problems existing in the prior art, the present invention provides a vaccine design strategy for enhancing the antigen presentation effect, which is applied to the structural sequence design and preparation of nucleic acid, protein and polypeptide vaccines, provides a new way to promote the immune potency of vaccines, and provides new ideas for the research and development of new treatment means.

[0007] The present invention is proposed based on the following inventive work of the inventors:

[0008] Using OVA as a model antigen protein, three peptide ligands of currently widely reported E3 ligases MDM2, VHL, and Keap1 were selected and conjugated thereto, including PMI, VHL Ligand (hereinafter simply referred to as VHLL), and the binding element of Keap1 (hereinafter simply referred to as Keap1B). At the same time, according to the protein complex structure characteristics of MDM2 binding to the tumor suppressor protein P53, the 17-26 positions of the helical residues of P53 were selected as the E3 ligase ligand (hereinafter simply referred to as P53B), and it was further verified that the binding or recruitment ligand of the E3 ubiquitin ligase can enhance the degradation of the OVA antigen protein in the intracellular proteasome pathway, improve the tumor suppression effect and anti-tumor activity of the mRNA tumor vaccine. The technical solution of the present invention can be further applied to the design of other mRNA tumor vaccines, and it has been studied and confirmed in a variety of tumor models that it promotes antigen presentation efficiency and exerts the killing effect of activating specific T cells on tumor cells, achieving the effect of efficient tumor immunotherapy. The technical solution of the present invention can also be further applied to the design of prophylactic mRNA vaccines to obtain enhanced immunogenicity.

[0009] On the one hand, the present invention provides a nucleic acid molecule.

[0010] The open reading frame of the nucleic acid molecule contains at least one antigen element and at least one E3 ligand element, and the E3 ligand element is a binding or recruitment ligand of an E3 ubiquitin ligase.

[0011] The E3 ubiquitin ligase in the nucleic acid molecule is optionally selected from one or more of VHL (Von Hippel-Lindau), MDM2, CRBN, IAPs, RNF, β-TrCP, DCAF, Keap1 or its truncated body or its extended body;

[0012] Further, the E3 ubiquitin ligase is selected from the RING type, the HECT type, and the RBR type;

[0013] Further, the E3 ubiquitin ligase in the nucleic acid molecule is preferably one or more of VHL (Von Hippel-Lindau), MDM2, β-TrCP, Keap1 or its truncated body or its extended body;

[0014] Further, the E3 ligand binds to one or more E3 ubiquitin ligases.

[0015] Further, the amino acid sequence corresponding to the binding or recruitment ligand of Keap1 is LDPETGEYL or a sequence with a homology greater than 60% thereto.

[0016] Furthermore, the amino acid sequence corresponding to the ligand that the β-TrCP binds to or recruits is DRHDSGLDSM or a sequence with a homology greater than 60% thereto.

[0017] Furthermore, the amino acid sequence corresponding to the ligand that the VHL binds to or recruits is at least one of LAP(OH)YI or ALAPYIP, or a sequence with a homology greater than 60% thereto.

[0018] Furthermore, the amino acid sequence corresponding to the ligand that the MDM2 binds to or recruits is one or more of ETFSDLWKLL, TSFAEYWNLLSP, LTFEHYWAQLTS, TNWYANLEKLLR, TAWYANFEKLLR, DWWPLAFEALLR, CNCKAPETALCARRCQQH or CNCKAPETFLCYWRCLQH, or a sequence with a homology greater than 60% thereto.

[0019] Furthermore, for the above nucleic acid molecule, the antigen element and the E3 ligand element are connected in any form of E3 ligand element - antigen element, antigen element - E3 ligand element, E3 ligand element - antigen element - E3 ligand element or antigen element - E3 ligand element - antigen element.

[0020] Furthermore, the antigen element and the E3 ligand element are connected by a linker;

[0021] Wherein, the amino acid sequence of the linker is one or more of GGGGS, (GGGGS)3, (GGGGS)6, (GGS)10 or (GSG)10.

[0022] Furthermore, the antigen element is a natural antigen protein, antigen polypeptide or a truncated form thereof.

[0023] Furthermore, the antigen element includes at least one antigenic epitope;

[0024] Furthermore, the antigen element includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 antigenic epitopes.

[0025] Furthermore, the antigenic epitope is a T cell antigen determinant or a T cell antigenic epitope.

[0026] The antigenic epitope is derived from an antigenic epitope peptide of a tumor, an antigenic epitope peptide of an autoimmune disease or an antigenic epitope peptide of a pathogenic microorganism.

[0027] The antigen or antigenic epitope peptide of the tumor is optionally an antigen caused by gene mutation, and / or a tissue-specific differentiation antigen, and / or an overexpressed antigen, and / or a cancer-testis antigen, and / or a universal antigen, and / or an antigen derived from a carcinogenic virus;

[0028] Further, the antigen caused by gene mutation is optionally selected from one or more of p53, ras, β-catenin, CDK4, CDC27, α-actinin-4;

[0029] Further, the tissue-specific differentiation antigen is optionally selected from one or more of Tyrosinase, TRP1 / gp75, TRP2, gp100, Melan-A / MART1, gangliosides, PSMA;

[0030] Further, the overexpressed antigen is optionally selected from one or more of HER2, WT1, EphA3, EGFR, CD20;

[0031] Further, the cancer-testis antigen is optionally selected from one or more of MAGE, BAGE, GAGE, NY-ESO-1;

[0032] Further, the universal antigen is optionally selected from one or more of Telomerase, Survivin;

[0033] Further, the antigen derived from a carcinogenic virus is optionally selected from one or more of EBV, HPV, HBV, human herpesvirus, Merkel cell polyomavirus.

[0034] In a specific embodiment, the nucleic acid molecule further comprises a signal peptide coding region.

[0035] Further, the nucleic acid molecule further comprises a promoter, a 5'-untranslated region, a 3'-untranslated region, and polyA.

[0036] The promoter is a T7 or SP6 promoter.

[0037] Further, the nucleic acid of the nucleic acid molecule is selected from at least one of DNA, ASO, siRNA, miRNA, mRNA, aptamer;

[0038] Further, the nucleic acid of the nucleic acid molecule is mRNA.

[0039] On the other hand, the present invention provides a nucleic acid vaccine. The nucleic acid vaccine comprises the above nucleic acid molecule, and optionally a pharmaceutically acceptable excipient or adjuvant component.

[0040] Furthermore, the nucleic acid vaccine is an mRNA vaccine, wherein the auxiliary component is a nanocarrier for carrying the mRNA; the excipients are selected from at least one of injection buffer media, lyophilization or cryoprotectants.

[0041] Furthermore, the nanocarrier is selected from at least one of liposomes, nanoparticles, microspheres and lipid nanoparticles.

[0042] Furthermore, the nanocarrier is prepared from at least one of the following lipid materials:

[0043] DOTAP, DOTMA, DOTIM, DDA, DC-Chol, CCS, diC14-amidine, DOTPA, DOSPA, DTAB, TTAB, CTAB, DORI, DORIE and its derivatives, DPRIE, DSRIE, DMRIE, DOGS, DOSC, LPLL, DODMA, DDAB, Dlin-MC3-DMA, CKK-E12, C12-200, DSPC, DMG-PEG, DOPE, phosphatidylethanolamine, phosphatidylcholine and cholesterol.

[0044] Furthermore, for the mRNA vaccine, the mass ratio of the lipid material to the mRNA is (0.5 - 50):1, preferably (2 - 10):1.

[0045] Furthermore, for the mRNA vaccine, the mRNA and the lipid material are self-assembled using a microfluidic device;

[0046] Or

[0047] The mRNA vaccine is formed by incubating the nanocarrier with the mRNA.

[0048] On the other hand, the present invention provides a method for preparing the above nucleic acid vaccine.

[0049] On yet another aspect, the present invention provides a protein; the protein is encoded by the nucleic acid molecule described in any one of the above.

[0050] On yet another aspect, the present invention provides a protein or polypeptide vaccine; the above protein is used as an antigen component.

[0051] Furthermore, the protein or polypeptide vaccine further comprises a pharmaceutically acceptable excipient or auxiliary component; the excipient or auxiliary component is as defined in the nucleic acid molecule described in any one of the above;

[0052] Furthermore, the protein or polypeptide vaccine further contains an immune adjuvant.

[0053] Furthermore, the immunoadjuvant is selected from one or more of Freund's incomplete adjuvant, complete Freund's adjuvant, aluminum hydroxide adjuvant, aluminum phosphate adjuvant, emulsion adjuvant, liposome adjuvant, and microbial adjuvant.

[0054] In another aspect, the present invention provides a vector for carrying the above-mentioned nucleic acid molecule.

[0055] Furthermore, the vector is a eukaryotic vector or a prokaryotic vector.

[0056] Furthermore, the vector includes one or more selected from plasmid vectors, adenovirus vectors, lentivirus vectors, and adeno-associated virus vectors.

[0057] In another aspect, the present invention provides a vector vaccine comprising an active ingredient, which is obtained by loading the above-mentioned nucleic acid molecule into the above-mentioned vector.

[0058] In another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned nucleic acid molecule, the above-mentioned nucleic acid vaccine, the mRNA vaccine prepared according to the above-mentioned method, the above-mentioned protein, the above-mentioned protein or polypeptide vaccine, or the above-mentioned vector vaccine, and a pharmaceutically acceptable excipient.

[0059] In another aspect, the present invention provides the use of the above-mentioned nucleic acid molecule, the above-mentioned nucleic acid vaccine, the mRNA vaccine prepared by the above-mentioned method, the above-mentioned protein, the above-mentioned protein or polypeptide vaccine, the above-mentioned vector vaccine, and the above-mentioned pharmaceutical composition in the preparation of a medicament for preventing or treating related diseases.

[0060] Furthermore, the disease is a tumor.

[0061] The beneficial effects of the present invention are as follows:

[0062] The present invention provides a vaccine design method for enhancing antigen presentation effects, which can be applied to the sequence design and preparation of nucleic acid, protein, and polypeptide vaccines.

[0063] The present invention co-encodes a target antigen and a ligand such as a polypeptide or protein domain having E3 ubiquitin ligase binding and recruitment functions in the same nucleic acid sequence, so that after the nucleic acid molecule enters the cell, the antigen protein and the E3 ubiquitin ligase ligand are fused and expressed, thereby promoting the degradation of the antigen protein through the proteasome pathway, increasing the quantity and abundance of antigen peptides having antigen epitopes, forming more peptide-MHC (p-MHC) complexes, and then being presented on the cell surface, enhancing subsequent immune responses, and exerting an efficient tumor immunotherapy effect.

[0064] The protein or polypeptide encoded by the protein, polypeptide or nucleic acid molecule of the present invention, and its antigen presentation process in cells depends on the ubiquitin-proteasome protein degradation pathway. Different E3 ligase ligand sequences are selected for modification and construction to screen E3 ubiquitin ligase ligands, which can efficiently recruit E3 ligases, thereby realizing the ubiquitination labeling and protein degradation of the protein or polypeptide of the present invention, and further improving the antigen presentation of the vaccine immunogen. Therefore, the protein, polypeptide or nucleic acid vaccine provided by the present invention has an efficient antigen presentation effect, strong immunogenicity, and good clinical application prospects. Description of the Drawings

[0065] Figure 1 Particle size and PDI result diagram of the mRNA-LNP in Example 3;

[0066] Figure 2 Zeta potential result diagram of the mRNA-LNP in Example 3;

[0067] Figure 3 Transmission electron microscopy image of the OVA-P53B mRNA lipid nanoparticle in Example 3;

[0068] Figure 4 Detection result diagram of the activation of lymph node T cells by the mRNA lipid nanoparticle in Example 4; among them, Figure 4 A is the detection data diagram of early activated T cells, Figure 4 B is the detection data diagram of late activated T cells;

[0069] Figure 5 Detection result diagram of the activation of spleen T cells by the mRNA lipid nanoparticle in Example 4; among them, Figure 5 A is the detection data diagram of early activated T cells, Figure 5 B is the detection data diagram of late activated T cells;

[0070] Figure 6 Schematic diagram of the immunization protocol in Example 4;

[0071] Figure 7 Tumor growth curve of E.G7-OVA tumor-bearing mice;

[0072] Figure 8 Representative photos of tumors in each treatment group;

[0073] Figure 9 Body weight-time curve of E.G7-OVA tumor-bearing mice;

[0074] Figure 10 Detection result diagram of antigen presentation mediated by each mRNA lipid nanoparticle in mice in Example 5;

[0075] Figure 11Detection results of specific CTLs mediated by each mRNA-lipid nanoparticle of Example 5 in mice; among them, Figure 11 A is the detection result of specific CTLs mediated by mRNA-lipid nanoparticles in the lymph nodes of mice; Figure 11 B is the detection result of specific CTLs mediated by mRNA-lipid nanoparticles in the spleen of mice; Figure 11 C is the detection result of specific CTLs mediated by mRNA-lipid nanoparticles in the tumor tissues of mice;

[0076] Figure 12 Detection results of CTLs generated by each mRNA-lipid nanoparticle of Example 6 in mice;

[0077] Figure 13 Detection data graphs of ALT, AST, TP, CRE, LDH, and UREA in the sera of mice of Example 7. Detailed implementation manners

[0078] The embodiments of the present invention will be described in detail below. The embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation to the present invention.

[0079] In this article, the term "comprising" or "including" is an open expression, that is, it includes the content specified by the present invention, but does not exclude other aspects of the content.

[0080] In this article, the terms "optionally", "optional" or "option" generally mean that the subsequent events or conditions may or may not occur, and this description includes the cases where such events or conditions occur, as well as the cases where such events or conditions do not occur.

[0081] In this article, the term "(XXXX)n" means that n XXXXs are connected, and X represents an amino acid. For example, "(GGGGS)3" means GGGGSGGGGSGGGGS.

[0082] In this article, the term "fragment" refers to a target protein or polypeptide, and a target protein or polypeptide with N-terminal (N-terminus) or C-terminal (C-terminus) truncation and / or internal deletion.

[0083] In this document, the terms "identity", "homology", or "similarity" are all used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, and refer to the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences determined by conventional methods. For example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, D.C.)). There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 70:173-187 (1997)); and the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs using these algorithms are also available and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0084] In this text, the term "vector" generally refers to a nucleic acid molecule capable of self-replicating after being inserted into a suitable host, which transfers the inserted nucleic acid molecule into host cells and / or between host cells. The vector may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and expression vectors mainly used for transcription and / or translation of DNA or RNA. The vector also includes vectors having multiple of the above functions. The vector can be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, by culturing a suitable host cell containing the vector, the vector can produce a desired expression product.

[0085] In this text, the term "pharmaceutical composition" generally refers to a unit dosage form and can be prepared by any of the methods well-known in the pharmaceutical field. All methods include the step of combining the active ingredient with a carrier constituting one or more accessory ingredients. Generally, the composition is prepared by uniformly and sufficiently combining the active compound with a liquid carrier, a finely divided solid carrier, or both.

[0086] In this text, the term "pharmaceutically acceptable excipient" can include any solvent, solid excipient, diluent, or other liquid excipient, etc., suitable for a particular target dosage form. Their use is also contemplated within the scope of the present invention, except to the extent that any conventional excipient is incompatible with the compounds of the present invention, such as any adverse biological effects produced or any interaction with any other component of the pharmaceutically acceptable composition in a harmful manner.

[0087] In this text, the term "administration" refers to introducing a predetermined amount of a substance into a patient by a suitable means. The nucleic acid molecule, nucleic acid vaccine, vector, vector vaccine, polypeptide, antibody or antigen-binding fragment, recombinant protein, multispecific antibody, protein or polypeptide vaccine, conjugate, or pharmaceutical composition of the present invention can be administered by any common route as long as it can reach the intended tissue. Various modes of administration are contemplated, including intraperitoneal, intravenous injection, intramuscular injection, subcutaneous injection, etc., but the present invention is not limited to the exemplified modes of administration. Preferably, the composition of the present invention is administered by intravenous injection or subcutaneous injection.

[0088] In this text, "E3 ubiquitin ligase" participates in various physiological processes in cells by regulating the ubiquitination process of regulatory proteins. All E3s have the ability to ligate a target protein and a specific E2. The known E3 ubiquitin ligases are mainly divided into two major categories: the HECT domain family and the RING domain family, as well as the U-box protein family. The HECT domain mainly functions by forming a thioester bond necessary for catalysis with ubiquitin, and the RING domain provides a residence site for E2 and the substrate, enabling E2 to catalyze the transfer of ubiquitin to the substrate.

[0089] In this text, the term "binding or recruiting ligand of E3 ubiquitin ligase" is equivalent to "E3 ligand" which is equivalent to "E3 ligand element" which is equivalent to "E3 ligase ligand", and refers to a natural or artificial polypeptide, protein, or its truncated or extended form, or compound that can bind to or recruit an E3 ubiquitin ligase.

[0090] Since most peptides presented by MHC class I molecules are derived from the degradation of antigenic proteins, strategies to increase the degradation of antigenic proteasomes in vivo have been shown to improve MHC class I presentation of antigens. The present invention innovatively utilizes a recruiting ligand of an E3 ubiquitin ligase to form a fusion protein by linking it to an antigen element. This fusion protein may be ubiquitinated and degraded by itself through the ubiquitin-proteasome system (UPS) in vivo, thereby increasing the number of ubiquitinated degradations of antigenic proteins to improve the abundance of available antigens, and further enhancing the direct presentation of MHC-I of the target protein or target antigen determinant, and further enhancing the immune response induced by the vaccine.

[0091] The sequence design of mRNA drugs is crucial for their ultimate efficacy. Although the coding region of mRNA is not as highly plastic as the non-coding region, due to the good adaptability of mRNA molecules, minor functional modifications can be made to the coding region during the design and synthesis processes to enhance the efficacy. Since mRNA vaccines play a role in a very important step in the immune process: the antigen presentation of degraded peptides. Most peptides presented by MHC class I molecules are derived from the degradation of antigenic proteins, and the ubiquitin-proteasome degradation mechanism can achieve targeted degradation of target proteins. Accordingly, the present invention specifically increases the proteasome pathway degradation of target antigenic proteins, thereby enriching the number of candidates for MHC class I presenting peptides. Specifically, a polypeptide E3 ligase ligand is fused and encoded into the mRNA molecule. By recruiting the E3 ligase, rapid and efficient ubiquitination of the target antigenic protein is induced, and then the degradation of the target antigenic protein is promoted through the proteasome pathway to increase the abundance of pMHC complexes, achieving enhanced antigen presentation of mRNA drugs, triggering a highly efficient immune response, and realizing a potent tumor immunotherapy effect.

[0092] The present invention has designed and verified a technical solution for preparing a vaccine with the following structure:

[0093] A nucleic acid molecule, whose open reading frame contains at least one antigen element and at least one E3 ligand element, and the E3 ligand element is a binding or recruiting ligand of an E3 ubiquitin ligase.

[0094] Its open reading frame encodes elements with the following structure:

[0095] Antigen element - (linker) - Recruitment ligand element of E3 ubiquitin ligase.

[0096] The recruitment ligand element of the E3 ubiquitin ligase of the present invention does not directly or through the linker element connect to the ligand that binds to the target protein in the cell, but connects to the antigen element. Experiments have shown that the above structure of the present invention can effectively increase the number of antigen proteins degraded, thereby improving the abundance of available antigens, thereby enhancing the direct presentation of MHC-I of the target protein and further enhancing the immune response induced by the vaccine.

[0097] The open reading frame of the nucleic acid molecule of the present invention at least contains the following structures: E3 ligand - antigen element, antigen element - E3 ligand, E3 ligand - antigen element - E3 ligand, or antigen element - E3 ligand - antigen element.

[0098] When there is a linker element between each element, it has the following structures: E3 ligand - linker - antigen element, antigen element - linker - antigen element - linker - antigen element - linker - E3 ligand, E3 ligand - linker - antigen element - linker - E3 ligand, or antigen element - linker - E3 ligand - linker - antigen element.

[0099] Among them, the linker element includes GGGGS, (GGGGS)3, (GGGGS)6, (GGS) 10 or (GSG) 10 One or more of the sequences.

[0100] According to the embodiments of the present invention, the amino acid sequence of the linker is at least one of GGGGS, (GGGGS)3, (GGGGS)6, (GGS)10, or (GSG)10.

[0101] The amino acid sequence of GGGGS is: GGGGS (Seq ID No.1);

[0102] (GGGGS)3's amino acid sequence is: GGGGSGGGGSGGGGS (Seq ID No.2);

[0103] (GGGGS)6's amino acid sequence is: GGGGSGGGGSGGGGSGGGGSGGGGSGGGGS (Seq ID No.3);

[0104] (GGS)10's amino acid sequence is: GGSGGSGGSGGSGGSGGSGGSGGSGGSGGS (Seq ID No.4);

[0105] The amino acid sequence of (GSG)10 is: GSGGSGGSGGSGGSGGSGGSGGSGGSGGSG (Seq ID No.5).

[0106] The vaccine design strategy for enhancing antigen presentation effect of the present invention can be applied to the structural sequence design and preparation of nucleic acid, protein and polypeptide vaccines.

[0107] The recruitment ligand element of the E3 ubiquitin ligase refers to any polypeptide, protein and its nucleic acid coding sequence that can bind to the E3 ubiquitin ligase.

[0108] The binding or recruitment ligand of the E3 ubiquitin ligase can bind to one or more E3 ubiquitin ligases. Common E3 ubiquitin ligase molecules such as: VHL, MDM2, CRBN, IAPs, and ligands of common E3 ubiquitin ligase molecules such as: VHL ligand (VHLL), with the amino acid sequence of ALAPYIP; the binding element of Keap1, with the amino acid sequence of LDPETGEYI.

[0109] Further classification and sequence information are listed in the following table:

[0110] Table 1

[0111]

[0112] In the specific implementation manner, the amino acid sequences of Keap1, β-TrCP, VHL, and MDM2 in Table 1 above can also use sequences with a homology greater than 60%;

[0113] In other specific implementation manners, the amino acid sequences of Keap1, β-TrCP, VHL, and MDM2 in Table 1 above can also use sequences with a homology greater than 70%;

[0114] In other specific implementation manners, the amino acid sequences of Keap1, β-TrCP, VHL, and MDM2 in Table 1 above can also use sequences with a homology greater than 80%;

[0115] In other specific implementation manners, the amino acid sequences of Keap1, β-TrCP, VHL, and MDM2 in Table 1 above can also use sequences with a homology greater than 90%;

[0116] In other specific implementation manners, the amino acid sequences of Keap1, β-TrCP, VHL, and MDM2 in Table 1 above can also use sequences with a homology greater than 95%;

[0117] In a specific implementation, the N-terminus of the open reading frame is also connected to a coding sequence of a signal peptide. Generally, a class I MHC transport signal sequence is used, and the self-signal peptide of the antigen-derived protein or other signal peptides commonly used in the art can also be used.

[0118] Among them, the antigen element is at least one antigenic epitope that is known or unknown.

[0119] Among them, the antigenic epitope can be an antigenic epitope from any source, such as an antigenic epitope derived from a tumor, an antigenic epitope derived from an autoimmune disease, or an antigenic epitope derived from an infectious disease.

[0120] Among them, the antigen element is an antigen polypeptide or protein containing at least one antigenic epitope that is currently known or unknown in the art.

[0121] One implementation mode of the present invention is to directly use the antigen protein as the antigen element. The number of antigen proteins can be one.

[0122] Another implementation mode is to use a polypeptide molecule obtained by re-fusing one or more antigenic epitope peptides as the antigen element.

[0123] Among them, the antigenic epitope can be an antigenic epitope from any source, such as an antigenic epitope derived from a tumor, an antigenic epitope derived from an autoimmune disease, or an antigenic epitope derived from an infectious disease.

[0124] The antigen or antigenic epitope peptide is derived from a tumor antigen, a viral pathogen antigen or any combination thereof.

[0125] The tumor antigen is any tumor-specific antigen, tumor-associated antigen or tumor neoantigen.

[0126] The tumors include, but are not limited to, the following: breast cancer, ovarian cancer, mammary cancer, testicular cancer, pancreatic cancer, liver cancer, colon cancer, colorectal cancer, thyroid cancer, lung cancer, prostate cancer, kidney cancer, melanoma, squamous cell carcinoma, gastrointestinal adenocarcinoma, chronic myelogenous leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, promyelocytic leukemia, multiple myeloma, B-cell lymphoma, bladder cancer, head and neck cancer, esophageal cancer, brain cancer, pharyngeal cancer, tongue cancer, synovial cell carcinoma, neuroblastoma, uterine cancer, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, basal cell carcinoma, epidermoid carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver tumor, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, nephroblastoma, uterine cancer, cervical cancer, small cell lung cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, intracranial or intraspinal tumor, glioblastoma, or retinoblastoma.

[0127] The one or more antigenic epitopes are one, two or more epitopes of one or more tumor-associated antigens, which are selected from kallikrein 4, papillomavirus binding factor (PBF), preferentially expressed melanoma antigen (PRAME), Wilms' tumor-1 (WT1), hydroxysteroid dehydrogenase-like 1 (HSDL1), mesothelin, cancer-testis antigen (NY-ESO-1), carcinoembryonic antigen (CEA), p53, human epidermal growth factor receptor 2 / neureceptor tyrosine kinase (Her2 / Neu), cancer-associated epithelial cell adhesion molecule (EpCAM), ovarian and uterine cancer antigen (CA125), folate receptor alpha, sperm protein 17, tumor-associated differentially expressed gene-12 (TADG-12), mucin-16 (MUC-16), L1 cell adhesion molecule (L1CAM), mannan-MUC-1, human endogenous retrovirus K (HERV-K-MEL), Kitakyushu lung cancer antigen-1 (KK-LC-1), human cancer / testis antigen (KM-HN-1), cancer-testis antigen (LAGE-1), melanoma antigen-A1 (MAGE-A1), zona pellucida-binding protein on sperm surface (Sp17), synovial sarcoma,X breakpoint 4 (SSX-4), transient axonal glycoprotein-1 (TAG-1), transient axonal glycoprotein-2 (TAG-2), Enabled homolog (ENAH), mammaglobin-A, NY-BR-1, breast cancer antigen, (BAGE-1), B melanoma antigen, melanoma antigen-A1 (MAGE-A1), melanoma antigen-A2 (MAGE-A2), mucin k, synovial sarcoma, X breakpoint 2 (SSX-2), taxol resistance-associated gene-3 (TRAG-3), avian myelocytomatosis viral oncogene (c-myc), cyclin B1, mucin 1 (MUC1), p62, survivin, lymphocyte common antigen (CD45), dickkopf WNT signaling pathway inhibitor 1 (DKK1), telomerase, Kirsten rat sarcoma viral oncogene homolog (K-ras), G250, intestinal carboxylesterase, alpha-fetoprotein, macrophage colony-stimulating factor (M-CSF), prostate-specific membrane antigen (PSMA), caspase 5 (CASP-5), cytochrome C oxidase assembly factor 1 homolog (COA-1), O-linked beta-N-acetylglucosamine transferase (OGT), osteosarcoma amplified 9, endoplasmic reticulum lectin (OS-9), transforming growth factor beta receptor 2 (TGF-βRII), murine leukemia glycoprotein 70 (gp70), calcitonin gene-related peptide alpha (CALCA), programmed cell death 1 ligand 1 (CD274), mouse double minute 2 homolog (mdm-2), alpha-actinin-4, elongation factor 2, malic enzyme 1 (ME1), nuclear transcription factor Y subunit C (NFYC), G antigen 1,3 (GAGE-1,3), melanoma antigen-A6 (MAGE-A6), cancer-testis antigen XAGE-1b, six transmembrane epithelial antigen of the prostate 1 (STEAP1), PAP, prostate-specific antigen (PSA), fibroblast growth factor 5 (FGF5), heat shock protein hsp70-2, melanoma antigen-A9 (MAGE-A9), Arg-specific ADP-ribosyltransferase family C (ARTC1), B-Raf proto-oncogene (B-RAF), serine / threonine kinase, beta-catenin, cell division cycle 27 homolog (Cdc27), cyclin-dependent kinase 4 (CDK4), cyclin-dependent kinase 12 (CDK12), cyclin-dependent kinase inhibitor 2A (CDKN2A), casein kinase 1 alpha 1 (CSNK1A1), fibronectin 1 (FN1), growth arrest-specific 7 (GAS7), glycoprotein non-metastatic melanoma protein B (GPNMB), HAUS class augmin complex subunit 3 (HAUS3), LDLR-fucose, T cell recognition melanoma antigen 2 (MART2),Myostatin (MSTN), Melanoma-associated antigen (mutated) 1 (MUM-1-2-3), Poly(A) polymerase γ (neo-PAP), Myosin class I, Protein phosphatase 1 regulatory subunit 3B (PPP1R3B), Peroxiredoxin-5 (PRDX5), Receptor-type tyrosine-protein phosphatase κ (PTPRK), Transforming protein N-Ras (N-ras), Retinoblastoma-associated factor 600 (RBAF600), Sirtuin-2 (SIRT2), SNRPD1, Triosephosphate isomerase, Ocular albinism type 1 protein (OA1), Member of the RAS oncogene family (RAB38), Tyrosinase-related protein 1-2 (TRP-1-2), Melanoma antigen gp75 (gp75), Tyrosinase, Melan-A (MART-1), Melanoma antigen glycoprotein 100 (GP100), N-acetylglucosaminyltransferase V gene (GnTVf), Lymphocyte antigen 6 complex locus K (LY6K), Melanoma antigen-A10 (MAGE-A10), Melanoma antigen-A12 (MAGE-A12), Melanoma antigen-C2 (MAGE-C2), Melanoma antigen NA88-A, Paclitaxel resistance-associated protein 3 (TRAG-3), PDZ-binding kinase (pbk), Caspase-8 (CASP-8), Sarcoma antigen 1 (SAGE), Breakpoint cluster region-Abelson oncogene (BCR-ABL), Leukemia fusion protein, dek-can, Containing elongation factor Tu GTP-binding domain 2 (EFTUD2), ETS variant gene 6 / Acute myeloid leukemia fusion protein (ETV6-AML1), FMS-like tyrosine kinase-3 internal tandem duplication (FLT3-ITD), Cyclin A1, Containing fibronectin type III domain 3B (FDNC3B), Promyelocytic leukemia / Retinoic acid receptor α fusion protein (pml-RARα), Melanoma antigen-C1 (MAGE-C1), Membrane protein alternative splicing isoform (D393-CD20), Melanoma antigen-A4 (MAGE-A4) or Melanoma antigen-A3 (MAGE-A3).

[0128] The infectious diseases mentioned above are those caused by bacterial infections, viral infections, and some other pathogenic microorganisms such as rickettsiae, chlamydiae, mycoplasmas, etc.

[0129] The viral pathogens are selected from, including but not limited to: Dengue virus, Ebola virus, EBV, Hepitis A virus, Hepitis B virus, Hepitis C virus, Hepitis D virus, HIV, HSV1, HSV2, cytomegalovirus (CMV), Influenza A virus, Marburg virus, human respiratory syncytial virus (RSV), SARS coronavirus (SARS-CoV), West Nile virus, human papillomavirus (HPV), human rhinovirus (HRV), Epstein-Barr virus (EBV), human rabies virus (HRV), and Zika virus, one or more of which.

[0130] The bacterial pathogens are selected from, including but not limited to: Acinetobacter baumanii, Burkholderia cepacia, Bacterioides fragilis, Chlamydia trachomatis, Citrobacter freundii, Campylobacter jejuni, Escherichia coli, Enterobacter aerogenes, Enterobacter cloacae, Haemophilus infb, Helicobacter pylori, Klebsiella oxytoca, Klebsiella pneumoniae (MDR / CRE), Legionella pneumophila, Neisseria meningitides, Neisseria gonorrhoeae, Pseudomonas aeruginosa, Salmonella typhi, paratyphi, typhimurium, Serratia marcescens, Shigella flexneri, Stenotrophomonas maltophilia, Yersinia pseudotuberculosis, Bacillus subtilis, Clostridium neoformans, Clostridium difficile, Clostridium perfringens, Corynebacterium spp, Enterococcus faecalis, Enterococcus faecium, vancomycin-resistant enterococcus (VRE), Listeria monocytogenes, Mycobactrium avium, Mycobacterium tuberculosis, Mycobacterium leprae (M.one or more of Mycobacterium leprae, Nocardia farcinica, Propionibacterium acnes, Staphylococcus aureus, methicillin-sensitive Staphylococcus aureus (MSSA), methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcus epidermidis, Streptococcus pyogenes, group A streptococcus (Strep), group B streptococcus (Streptococcus agalactiae), and group C streptococcus.

[0131] The fungal pathogens are selected from, including but not limited to: one or more of Aspergillus spp, Blastomyces, Candida albicans, glabrata, guilliermondii, krusei, parapsilosis, tropicalis, Cryptococcus, Fusarium spp., Mucor spp., Saccharomyces, and Pneumocystis jirovecii (carinii).

[0132] In some embodiments, the antigen or antigenic epitope peptide of the tumor is optionally an antigen caused by gene mutation, and / or a tissue-specific differentiation antigen, and / or an overexpressed antigen, and / or a cancer-testis antigen, and / or a common antigen, and / or an antigen derived from an oncogenic virus;

[0133] Among them, the antigen caused by gene mutation in the antigen of the tumor is optionally selected from one or more of p53, ras, β-catenin, CDK4, CDC27, and α-actinin-4;

[0134] Among them, the tissue-specific differentiation antigen in the antigen of the tumor is optionally selected from one or more of Tyrosinase, TRP1 / gp75, TRP2, gp100, Melan-A / MART1, gangliosides, and PSMA;

[0135] Among them, the overexpressed antigen in the antigen of the tumor is optionally selected from one or more of HER2, WT1, EphA3, EGFR, and CD20;

[0136] Among them, the cancer-testis antigen in the antigen of the tumor is optionally selected from one or more of MAGE, BAGE, GAGE, and NY-ESO-1;

[0137] Among them, the common antigen in the tumor antigen is optionally selected from one or more of Telomerase and Survivin;

[0138] Among them, the oncogenic virus-derived antigen in the tumor antigen is optionally selected from one or more of EBV and HPV.

[0139] It should be noted that for the nucleic acid molecules mentioned in this article, those skilled in the art should understand that it actually includes any one or both of the complementary double strands. For convenience, in this article, although only one strand is given in most cases, in fact, the other complementary strand is also disclosed. In addition, the nucleic acid sequences in this application include DNA form or RNA form, and the disclosure of one means the disclosure of the other.

[0140] When connecting the above-mentioned nucleic acid molecule to a vector, the nucleic acid molecule can be directly or indirectly connected to the control elements on the vector, as long as these control elements can control the translation and expression of the nucleic acid molecule, etc. Of course, these control elements can come directly from the vector itself or be exogenous, that is, not from the vector itself. Of course, the nucleic acid molecule can be operably linked to the control element. As used herein, "operably linked" means connecting an exogenous gene to a vector such that the control elements in the vector, such as transcriptional control sequences and translational control sequences, etc., can perform their intended functions of regulating the transcription and translation of the exogenous gene. Commonly used vectors can be, for example, plasmids, viral vectors, phages, etc. After the vector according to some specific embodiments of the present invention is introduced into a suitable recipient cell, under the mediation of the regulatory system, the expression of the aforementioned protein, antibody or conjugate can be effectively achieved, and then a large amount of the protein, antibody or conjugate can be obtained in vitro.

[0141] Meanwhile, the present invention designs a series of nucleic acid molecules containing the above-mentioned open reading frames. These open reading frames may or may not contain a signal peptide sequence coding region in addition to the coding region encoding the above-mentioned antigen element-(linker)-recruitment ligand element structure of the E3 ubiquitin ligase.

[0142] The above-mentioned nucleic acid molecule may also contain a 5'-untranslated region, an open reading frame, and a 3'-untranslated region connected in sequence. It may also contain a promoter. Through the DNA template connected in sequence by the promoter, 5'-untranslated region, open reading frame, and 3'-untranslated region, mRNA can be transcribed. The transcription process can be carried out by existing in vitro transcription methods and related kits. Further, the above-mentioned nucleic acid molecule may also contain a polyA fragment.

[0143] In one embodiment, the promoter is a T7 or SP6 promoter.

[0144] In one embodiment, the nucleotide sequence of the 5'-untranslated region is as follows (Seq ID No.18):

[0145] AGGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAACACATCATCAAGACAGCCACC.

[0146] In one embodiment, the nucleotide sequence of the 3'-untranslated region is as follows (Seq ID No.19):

[0147] TGATGAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCTGCGTCGAGAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC.

[0148] In one embodiment, the nucleotide sequence of polyA is as follows (Seq ID No.20):

[0149] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTCTTCAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0150] The above nucleic acid, protein or polypeptide can be used as an active ingredient to prepare a drug or vaccine for preventing and / or treating diseases. Generally, those skilled in the art can use the above protein as an antigen active ingredient to prepare a protein or polypeptide vaccine. The vaccine uses the above protein as an antigen component, as well as pharmaceutically acceptable excipients or auxiliary components.

[0151] When preparing a vaccine, an immunoadjuvant is often added to enhance the immune response of the body to the vaccine. Among them, the immunoadjuvant is Freund's incomplete adjuvant, complete Freund's adjuvant, aluminum hydroxide adjuvant, aluminum phosphate adjuvant, emulsion adjuvant, liposome adjuvant, microbial adjuvant, etc.

[0152] Naturally, based on the proteins described in the present invention in this field, it is easy to obtain antibodies against the above-mentioned proteins. The above-mentioned antibodies are polyclonal antibodies or monoclonal antibodies; preferably monoclonal antibodies. The above-mentioned antibodies also form conjugates with coupling moieties. Further, the coupling moiety is one or more selected from radionuclides, drugs, toxins, cytokines, enzymes, fluorophores, carrier proteins or biotin. Antibodies that can specifically bind to the aforementioned proteins can be used on the one hand for the preparation of drugs and on the other hand for the related immunoassays of the aforementioned proteins.

[0153] In addition, the present invention also encompasses the coding genes of the above-mentioned proteins. The coding genes of the above-mentioned proteins can be used on the one hand for the expression and preparation of the above-mentioned proteins or antibodies; on the other hand, they can also be operably loaded into expression vectors, and then can be prepared into vector vaccines or vector drugs. The expression can be selected from common vectors such as plasmid vectors, adenovirus vectors, lentivirus vectors or adeno-associated virus vectors. When using an adenovirus vector, a replication-deficient adenovirus vector is generally used.

[0154] For example, when the above nucleic acid molecule is DNA, the mRNA obtained by its transcription can be prepared into an mRNA vaccine together with pharmaceutically acceptable excipients or auxiliary components. The auxiliary component can be a nanocarrier for carrying the mRNA. The nanocarrier is commonly a lipid nanocarrier. For example, a lipid nanocarrier prepared from at least one of the following raw materials: DOTAP, DOTMA, DOTIM, DDA, DC-Chol, CCS, diC14-amidine, DOTPA, DOSPA, DTAB, TTAB, CTAB, DORI, DORIE and its derivatives, DPRIE, DSRIE, DMRIE, DOGS, DOSC, LPLL, DODMA, DDAB, Dlin-MC3-DMA, CKK-E12, C12-200, DSPC, DMG-PEG, DOPE, phosphatidylethanolamine (PE), phosphatidylcholine (PC), cholesterol (Chol).

[0155] Preferably, the lipid materials used for preparing the nanocarrier are amphiphilic lipid materials or cationic lipid materials, because such lipid materials carry a positive charge on the surface under acidic conditions and can encapsulate mRNA molecules into the interior through electrostatic adsorption with the phosphate groups of nucleic acids to form an mRNA-lipid complex. The mRNA-lipid complex can be adsorbed by the cell membrane with a negative charge on the surface, and then through membrane fusion or endocytosis of the cell, the mRNA is delivered into the cell for further expression, thereby exerting the immune effect of the vaccine.

[0156] Generally speaking, for the preparation of the above-mentioned mRNA vaccines, a microfluidic device can be used to self-assemble mRNA and lipid materials to form an mRNA-lipid complex, or after preparing the nanocarrier, it can be incubated with mRNA to form an mRNA-lipid complex.

[0157] The present invention will be further described in detail below through the description of examples.

[0158] Example 1 Construction of the mRNA Transcription Vector Template Containing the E3 Ubiquitin Ligase Ligand Antigen Element

[0159] The DNA of the transcription template of mRNA in this example is composed of a promoter, 5'-untranslated region, signal peptide sequence, antigen-encoding region sequence, linker sequence, recruitment ligand sequence of E3 ubiquitin ligase, 3'-untranslated region, and Poly(A) connected in sequence, and inserted into the corresponding position of the plasmid, and the sequence is verified by sequencing to obtain the DNA of the mRNA transcription template. Among them, the signal peptide sequence, antigen-encoding region sequence, linker sequence, and recruitment ligand sequence of E3 ubiquitin ligase can be provided by two sequences respectively or located in the same sequence.

[0160] The promoter is the T7 or SP6 promoter.

[0161] Using chicken ovalbumin (OVA) as a model antigen, three recruitment ligands P53B, PMI, VHLL, and keap1B of E3 ubiquitin ligases PMI, VHL, and Keap1 were selected to construct and prepare mRNAs encoding the full-length OVA protein, namely OVAmRNA (control), OVA-P53BmRNA, OVA-PMImRNA, OVA-VHLLmRNA, OVA-keap1BmRNA, and at the same time, the positive control OVA-H2DbmRNA was constructed. The antigen-encoding region was inserted into the corresponding position of the plasmid vector and verified by sequencing.

[0162] Table 2: mRNA Sequence Information Containing the E3 Ubiquitin Ligase Ligand Antigen Element

[0163] mRNA number Amino acid sequence corresponding to the E3 ubiquitin ligase ligand coding sequence OVA mRNA / OVA-H2D b mRNA / OVA-P53B mRNA ETFSDLWKLL OVA-PMI mRNA TSFAEYWNLLSP OVA-VHL L mRNA ALAPYIP OVA-keap1B mRNA LDPETGEYL

[0164] Example 2 In Vitro Transcription of mRNA Containing the E3 Ubiquitin Ligase Ligand Antigen Element

[0165] The mRNA transcription template DNA of Example 1 was inserted into the pUC57 vector to prepare plasmid DNA. Referring to the "Molecular Cloning: A Laboratory Manual (Fourth Edition)", the instructions for commercially available restriction endonucleases and DNA purification kit products, the plasmid DNA was digested with enzymes to be processed into a linearized plasmid DNA template, and then the linearized plasmid DNA template was purified. The concentrations and purities of the plasmid DNA and the linearized DNA template were detected by spectrophotometry and gel electrophoresis, and electrophoresis was used to verify whether the linearization was complete.

[0166] RNA polymerase, NTP, and cap analogs were selected to synthesize and prepare mRNA. In vitro transcription of precursor mRNA was carried out according to the operation guide of the kit (Vazyme TR101-02). The specific steps are as follows:

[0167] The relevant reactants were added to a 1.5 mL centrifuge tube according to the dosage and order. The pipette was used to aspirate and discharge 3 times or the bottom of the tube was gently tapped with fingers to mix evenly, and then centrifuged briefly to collect the reaction solution at the bottom of the tube. After incubating in a 37 °C water bath for 4 h, 1 μL of DNase was added and incubated at 37 °C for 15 min; then 179 μL of nuclease-free water was added, and then 200 μL of phenol / chloroform / isoamyl alcohol (25:24:1) solution was added for mRNA extraction. After mixing evenly, it was centrifuged at 15000 rpm for 10 min, and then the aqueous phase was taken. Then 200 μL of 5 M ammonium acetate solution was added and placed at 4 °C overnight for mRNA precipitation. Then it was taken out and centrifuged at 4 °C, 15000 rpm for 10 min, and the supernatant was carefully removed. 1 mL of 70% ethanol was added to wash the precipitate, centrifuged at 4 °C, 15000 rpm for 10 min, the supernatant was carefully removed, and the precipitate was air-dried. Then 20 μL of nuclease-free water was added to redissolve to obtain the mRNA solution.

[0168] The purity of mRNA was detected by agarose gel electrophoresis or nucleic acid fragment analyzer.

[0169] Table 3: Prescription of mRNA transcription reaction solution

[0170]

[0171] Preparation of mRNA lipid nanoparticles (mRNA-LNP) in Example 3

[0172] As shown in Table 4, mRNA lipid nanoparticles can be prepared according to the needs of mRNA, target organs, etc. by selecting a suitable prescription. The specific method is as follows:

[0173] The lipid materials in the prescription were dissolved in an ethanol solution and then mixed with the corresponding mRNA solution to self-assemble into mRNA-lipid nanoparticles, and then ethanol was removed through a tangential flow system and sterilized by filtration to obtain the product. The specific method is as follows:

[0174] (1) Solution preparation: Dissolve cationic lipids (MC3, DTAB, DC-Chol, CTAB, DOTMA, DDA, DOTAP), co-lipids (DSPC or DOPE), cholesterol (Chol), and DMG-PEG2000 in absolute ethanol to make the concentration of the ionizable lipid 10 mg / mL, obtaining a lipid solution. The molar ratio of cationic lipid, co-lipid, cholesterol (Chol), and DMG-PEG2000 is 50:10:38.5:1.5. Dilute mRNA to an appropriate concentration with PBS buffer (prepared with RNase-free water) for later use.

[0175] (2) LNP preparation: Mix the lipid solution obtained in step (1) with mRNA solutions of different concentrations to obtain samples with different mass ratios of cationic lipid to mRNA as shown in Table 4. The mixing is carried out in a microfluidic device (Myanna (Shanghai) Instrument Technology Co., Ltd.). The mixing process parameters are: the volume ratio of the lipid solution to the mRNA solution is 1:3, and the total flow rate is 9 mL / min.

[0176] (3) Ultrafiltration: Dilute the LNP crude preparation prepared by microfluidics 25-fold with PBS buffer, and ultrafilter it in an ultrafiltration cup to the initial volume to obtain the LNP final preparation. Ethanol is removed during the ultrafiltration process to prepare mRNA-loaded lipid nanoparticles. Ultrafiltration process parameters: filter membrane 100 kDa, air pressure 0.2 MPa, rotation speed 100 - 200 rpm.

[0177] Using the above method, according to the lipid formulations and mass ratios of Prescription 1 in Table 4, prepare lipid nanoparticles encapsulating 6 kinds of mRNAs, namely OVA mRNA, OVA-H2D b mRNA, OVA-P53B mRNA, OVA-PMI mRNA, OVA-VHL mRNA, and OVA-keap1B mRNA obtained in Example 1, as well as blank lipid nanoparticles without mRNA. Detect the particle size, zeta potential, and mRNA encapsulation efficiency of the 7 kinds of mRNA-loaded lipid nanoparticles prepared. The specific detection methods are as follows:

[0178] Measure a certain volume of the mRNA-loaded lipid nanoparticle colloidal solution, dilute it with purified water to an mRNA concentration of 0.01 mg / ml, and measure the particle size and zeta potential of the mRNA-loaded lipid nanoparticles in a laser particle size analyzer (n = 3, that is, each prescription is measured 3 times). The detection results show that the particle sizes of the 7 kinds of mRNA-loaded lipid nanoparticles prepared are all about 100 nm ( Figure 1 -Particle size and PDI results of mRNA-LNP), the PDI is all about 0.2, and the zeta potential is all about 25 mV ( Figure 2 -Zeta potential results of mRNA-LNP), with good uniformity.

[0179] Encapsulation efficiency detection: Use Quant-iTTM RiboGreen TM The encapsulation efficiency was detected by the kit, and the detection results are shown in Table 5, indicating that the prepared mRNA-LNP has good nano-formulation properties, with an encapsulation efficiency greater than 95%, providing good protection for mRNA.

[0180] The prepared OVA-P53B mRNA lipid nanoparticles were observed and photographed under a transmission electron microscope (TEM) to observe the morphology of the LNP, as Figure 3 shown. The TEM results of the OVA-P53B mRNA lipid nanoparticles showed that they had a spherical-like structure, with a round appearance, and the particle size was basically consistent with the measurement results of the particle size analyzer.

[0181] Other OVA-PMI mRNA, OVA-VHL mRNA, and OVA-keap1B mRNA lipid nanoparticles showed similar effects in observing the LNP morphology under a transmission electron microscope (TEM);

[0182] Table 4 Formulation of mRNA lipid nanoparticles

[0183]

[0184] Table 5 Detection results of mRNA-LNP encapsulation efficiency

[0185] mRNA-LNP Entrapment efficiency (%) OVA mRNA-LNP 95.87 OVA-H2D b mRNA-LNP 98.02 OVA-P53B mRNA-LNP 97.65 OVA-PMI mRNA-LNP 96.61 OVA-VHL L mRNA-LNP 95.11 OVA-keap1B mRNA-LNP 97.27

[0186] Example 4 In vivo activation of T cells by mRNA lipid nanoparticles containing E3 ubiquitin ligase ligand antigen elements

[0187] The lipid nanoparticles loaded with OVA-mRNA and OVA-P53B mRNA prepared in Example 3 were administered to mice, and the content of mRNA in the lipid nanoparticle sample was 0.1 mg / mL; the specific operation was as follows:

[0188] After 1 week of adaptive feeding of C57BL / 6 mice, they were divided into a control group, an OVA group, and an OVA-P53 group, with 4 mice in each group. The mice were immunized intravenously. Among them, the control group was given 100 μL of normal saline, and the OVA group and the OVA-P53 group were respectively given 100 μL of the corresponding mRNA lipid nanoparticle samples. 36 h after administration, all the mice were sacrificed and dissected, and the spleen and lymph node tissues were collected, processed, and filtered to obtain a single-cell suspension. After centrifugation at 400 g, erythrocyte lysate was added and lysed at room temperature, followed by secondary centrifugation, and the supernatant was discarded. Protein antibodies against T cells (including anti-CD45, anti-CD3ε, anti-CD4, anti-CD8, anti-CD25, anti-CD69) were respectively added, stained at room temperature, centrifuged, and the supernatant was discarded. The cells were resuspended and detected by flow cytometry.

[0189] The results are as Figure 4 and Figure 5 shown:

[0190] Figure 4 For the immune cell detection results of lymph nodes, among which, Figure 4 A is the detection data graph of early-activated CD8 + and CD4 + T cells, Figure 4 B is the detection data graph of late-activated CD8 + and CD4 + T cells; It can be seen from the figure that at the lymph node site, the lipid nanoparticles of OVA-P53B mRNA conjugated with the E3 ubiquitin ligase recruitment ligand P53B in this example can better activate CD8 + T cells and CD4 + T cells compared with the lipid nanoparticles of OVA-mRNA without conjugated E3 ubiquitin ligase recruitment ligand P53B;

[0191] Figure 5 For the immune cell detection results of the spleen, among which, Figure 5 A is the detection data graph of early-activated CD8 + and CD4 + T cells, Figure 4 B is the detection data graph of late-activated CD8 + and CD4 + T cells; It can be seen from the figure that at the spleen site, the lipid nanoparticles of OVA-P53B mRNA conjugated with the recruitment ligand P53B of E3 ubiquitin ligase in this example can better activate CD8 + T cells and CD4 + T cells compared with the lipid nanoparticles of OVA-mRNA without conjugated E3 ubiquitin ligase recruitment ligand P53B.

[0192] It shows that the mRNA lipid nanoparticles added with the E3 ubiquitin ligase recruitment ligand P53B in this example can mediate the activation of T cells in mice, and the effect is significantly better than that of the mRNA lipid nanoparticles without adding the E3 ubiquitin ligase ligand antigen element.

[0193] In vivo anti-E.G7-OVA tumor effect of mRNA lipid nanoparticles containing E3 ubiquitin ligase ligand antigen element in Example 5

[0194] The lipid nanoparticles encapsulating OVA mRNA, OVA-H2Db mRNA, OVA-P53B mRNA, OVA-PMI mRNA, OVA-VHLL mRNA, and OVA-keap1B mRNA prepared in Example 3 were administered to mice, and the content of mRNA in the lipid nanoparticle sample was 0.1 mg / mL; specifically:

[0195] 1. Investigate the effect of the mRNA lipid nanoparticles of the present invention on tumor volume: Select male C57BL / 6 mice at 5-6 weeks old, randomly divide them into groups with 6 mice in each group, and investigate the anti-tumor effect of OVA mRNA lipid nanoparticles containing the E3 ubiquitin ligase ligand antigen element after immunizing E.G7-OVA tumor-bearing mice.

[0196] Specific method:

[0197] After 1 week of adaptive feeding of C57BL / 6 mice, the density of the E.G.7-OVA tumor cell suspension was adjusted to 7×10 6 cells / mL, and 100 μL was aspirated and subcutaneously injected into the upper right axilla of C57BL / 6 mice. 7 days after inoculation, the mice were immunized intravenously according to the experimental design ( Figure 6 - Schematic diagram of the immunization protocol), and the dosing dose of mRNA-LNP was 10 μg mRNA / mouse (the control group was given the same volume of normal saline).

[0198] On the day of the first administration, the tumor diameter of the tumor-bearing mice was measured using an electronic vernier caliper, and then recorded every 1 day. The tumor volume was calculated according to the experimental design, and the growth volume-time curve of the tumor-bearing mice during the tumor period was plotted as Figure 7 ( Figure 5 Tumor growth curve of E.G7-OVA tumor-bearing mice) shown.

[0199] The above experimental results showed that: compared with the control group and the positive control OVA-H2Db group, the OVA mRNA vaccine containing the E3 ubiquitin ligase ligand antigen element of the present invention significantly improved the inhibitory effect on tumor growth. Among them, the tumor inhibitory effect of OVA-P53B was the best.

[0200] 2. Further, the inhibition rate of the mRNA lipid nanoparticles of the present invention on mouse tumors was investigated: After the immunization experiment, all the mice were sacrificed and dissected, and the tumor tissues were collected, photographed, weighed, and the tumor inhibition rate was calculated. The results were as Figure 8 ( Figure 8 Representative photos of tumors in each treatment group) shown.

[0201] The above experimental results showed that the tumor inhibition rate of OVA-H2Db was 38.8%, showing a certain degree of tumor inhibition effect. The tumor inhibition rates of OVA-PMI, OVA-Keap1B, and OVA-VHLL were increased to 51.1%, 66.8%, and 70.5%, respectively, showing good antitumor effects. The tumor inhibition rate of OVA-P53B reached 84.8%, showing a better antitumor effect.

[0202] 3. Further, the effects of the mRNA lipid nanoparticles of the present invention on the body weight of mice were investigated to preliminarily evaluate the administration safety: On the day of the first administration, the body weights of tumor-bearing mice were weighed using an electronic balance, and then recorded once every 1 day. A body weight-time curve of tumor-bearing mice was plotted to evaluate the toxicity, and the obtained body weight-time curve of tumor-bearing mice was as Figure 9 (e.g., the body weight-time curve of E.G7-OVA tumor-bearing mice) shown.

[0203] The experimental results showed that during the entire treatment process, the body weights of all groups showed an increasing trend, and no obvious body weight loss occurred, indicating that each preparation had no obvious toxic and side effects and had good in vivo administration safety.

[0204] 4. The antigen presentation mediated by the mRNA lipid nanoparticles of the present invention in mice and the generation effect of specific CTLs were investigated. Specific operation: After the above immune experiment was completed, all mice were sacrificed and dissected, and lymph nodes, spleens, and tumor tissues were collected, processed, and filtered to obtain single-cell suspensions. After centrifugation, an appropriate amount of red blood cell lysate was added and lysed at room temperature, followed by secondary centrifugation, and the supernatant was discarded. Protein antibodies of various immune cells such as DC, macrophages, and effector T cells (including anti-CD45, anti-CD11c, anti-CD3ε, anti-CD4, anti-CD8, anti-H-2Kb bound to SIINFEKL, H2KbOVA tetramer) were added respectively, stained at room temperature, centrifuged, and the supernatant was discarded. Resuspended cells were added for flow cytometry detection.

[0205] The results were as Figure 10 and Figure 11 shown: Figure 10 was the detection result diagram of antigen presentation mediated by mRNA lipid nanoparticles in mice; Figure 11 was the detection result diagram of specific CTLs mediated by mRNA lipid nanoparticles in mice; among them, Figure 11 A was the detection result diagram of specific CTLs mediated by mRNA lipid nanoparticles in lymph nodes of mice; Figure 11 B was the detection result diagram of specific CTLs mediated by mRNA lipid nanoparticles in spleens of mice; Figure 11 C was the detection result diagram of specific CTLs mediated by mRNA lipid nanoparticles in tumor tissues of mice.

[0206] From Figure 10 and Figure 11 It can be seen that, compared with OVA-mRNA without the addition of the E3 ubiquitin ligase ligand antigen element, the mRNA lipid nanoparticles of OVA-P53B mRNA, OVA-PMI mRNA, OVA-VHLL mRNA, and OVA-keap1B mRNA added with the E3 ubiquitin ligase ligand antigen element in this example can mediate stronger antigen presentation and generate more specific CTLs in mice, and among them, the effect of OVA-P53B is the best.

[0207] Example 6 Effect of P53 on the in vivo anti-EBV tumor effect of EBV LMP2A@mRNA lipid nanoparticles

[0208] The amino acid sequence of the EBV virus LMP2A antigen is as follows (Seq ID No. 21):

[0209] MGSLEMVPMGAGPPSPGGDPDGYDGGNNSQYPSASGSSGNTPTPPNDEERESNEEPPPPYEDPYWGNGDRHSDYQPLGTQDQSLYLGLQHDGNDGLPPPPYSPRDDSSQHIYEEAGRGSMNPVCLPVIVAPYLFWLAAIAASCFTASVSTVVTATGLALSLLLLAAVASSYAAAQRKLLTPVTVLTAVVTFFAICLTWRIEDPPFNSLLFALLAAAGGLQGIYVLVMLVLLILAYRRRWRRLTVCGGIMFLACVLVLIVDAVLQLSPLLGAVTVVSMTLLLLAFVLWLSSPGGLGTLGAALLTLAAALALLASLILGTLNLTTMFLLMLLWTLVVLLICSSCSSCPLSKILLARLFLYALALLLLASALIAGGSILQTNFKSLSSTEFIPNLFCMLLLIVAGILFILAILTEWGSGNRTYGPVFMCLGGLLTMVAGAVWLTVMSNTLLSAWILTAGFLIFLIGFALFGVIRCCRYCCYYCLTLESEERPPTPYRNTV.

[0210] The method of Example 1 and Example 2 was used to prepare mRNA containing the above LMPA2 antigen sequence, and the method of Example 3 was used to prepare lipid nanoparticles encapsulating LMP2A mRNA, LMP2A-P53B mRNA and LUC mRNA with a mass ratio of cationic lipid to mRNA of 15:1, wherein the content of mRNA was 0.1 mg / mL. And the in vivo anti-tumor effect of LMP2A-P53B mRNA lipid nanoparticles containing the E3 ubiquitin ligase ligand antigen element P53B was investigated according to the method disclosed in Example 5.

[0211] The anti-tumor effect mediated by specific T cells in vivo of LMP2A-P53B mRNA lipid nanoparticles containing the E3 ubiquitin ligase ligand antigen element was investigated by ELISpot method.

[0212] The specific method was as follows:

[0213] After the immunization experiment, all the mice were sacrificed and dissected, and the spleens were collected, processed, filtered to obtain a single cell suspension, centrifuged, and then added with erythrocyte lysate for lysis at room temperature. After secondary centrifugation, the supernatant was discarded to obtain a spleen lymphocyte suspension for detection.

[0214] The results were as Figure 12 shown: The mRNA lipid nanoparticles containing the LMP2A antigen could mediate the production of specific CTL in mice, and the LMP2A-P53B-mRNA lipid nanoparticles added with the E3 ubiquitin ligase ligand antigen element sequence had a more significant effect.

[0215] It was shown that compared with the control group, the model mRNA group (LUC mRNA) and the group only containing the LMP2A antigen (LMP2A mRNA), the LMP2A-P53B mRNA lipid nanoparticles containing the E3 ubiquitin ligase ligand antigen element P53B in this example could induce the production of more CTL, had a stronger inhibitory effect on tumor growth, and had a higher tumor inhibition rate.

[0216] Example 7 Safety evaluation of mRNA lipid nanoparticles containing the E3 ubiquitin ligase ligand antigen element

[0217] In this example, the safety of the mRNA lipid nanoparticles prepared in Example 5 in mice was investigated.

[0218] The specific operation was as follows:

[0219] After C57BL / 6 mice were adaptively fed for 1 week, according to the experimental design ( Figure 6- Schematic diagram of the immunization protocol) Mice were immunized intravenously at a dose of 10 μg mRNA per mouse. Seven days after the administration, mouse blood samples were collected and mouse plasma was prepared. ALT, AST, TP, CRE, LDH, and UREA in the mouse serum were detected using a blood biochemical analyzer.

[0220] The results are as Figure 13 shown: Compared with the Control, there were no significant changes in the data of ALT, AST, TP, CRE, LDH, and UREA in the mouse serum after immunization with each mRNA-lipid nanoparticle;

[0221] It indicates that after the administration of each mRNA-lipid nanoparticle, there were no significant changes in the indicators related to the liver and kidney functions of the mice. Each mRNA-lipid nanoparticle added with the E3 ubiquitin ligase ligand antigen element in this example has good safety.

[0222] It should be noted that the specific features, structures, materials, or characteristics described in this specification can be combined in a suitable manner in any one or more embodiments. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments and the features of different embodiments described in this specification.

Claims

1. A nucleic acid molecule comprising at least one open reading frame, characterized in that, The open reading frame contains at least one antigen element and at least one E3 ligand element; wherein, the E3 ligand element is a binding or recruiting ligand of an E3 ubiquitin ligase; the E3 ligand binds to one or more E3 ubiquitin ligases; The antigen element includes at least one antigen epitope; the antigen epitope is a T cell antigen determinant or a T cell antigen epitope; the antigen epitope is derived from an antigen epitope peptide of a tumor, an antigen epitope peptide of an autoimmune disease, or an antigen epitope peptide of a pathogenic microorganism; The E3 ubiquitin ligase is selected from one or more of a truncated or extended form of VHL (Von Hippel-Lindau), MDM2, CRBN, IAPs, RNF, β-TrCP, DCAF, Keap1.

2. The nucleic acid molecule according to claim 1, wherein The amino acid sequence corresponding to the binding or recruiting ligand of Keap1 is a sequence with a homology greater than 60% to LDPETGEYL. The amino acid sequence corresponding to the binding or recruiting ligand of β-TrCP is a sequence with a homology greater than 60% to DRHDSGLDSM. The amino acid sequence corresponding to the binding or recruiting ligand of VHL is at least one of a sequence with a homology greater than 60% to LAP(OH)YI or ALAPYIP. The amino acid sequence corresponding to the binding or recruiting ligand of MDM2 is at least one of a sequence with a homology greater than 60% to ETFSDLWKLL, TSFAEYWNLLSP, LTFEHYWAQLTS, TNWYANLEKLLR, TAWYANFEKLLR, DWWPLAFEALLR, CNCKAPETALCARRCQQH, or CNCKAPETFLCYWRCLQH.

3. The nucleic acid molecule according to any one of claims 1 to 2, characterized in that, The antigen element and the E3 ligand element are connected in any one of the forms of E3 ligand element - antigen element, antigen element - E3 ligand element, E3 ligand element - antigen element - E3 ligand element, or antigen element - E3 ligand element - antigen element; wherein, the antigen element and the E3 ligand element are connected by a linker.

4. The nucleic acid molecule according to claim 1, wherein The antigen or antigen epitope peptide of the tumor is selected from antigens caused by gene mutations, and / or tissue-specific differentiation antigens, and / or overexpressed antigens, and / or cancer-testis antigens, and / or common antigens, and / or carcinogenic virus-derived antigens; The antigens caused by gene mutations are selected from one or more of p53, ras, β-catenin, CDK4, CDC27, α-actinin-4. The tissue-specific differentiation antigens are selected from one or more of Tyrosinase, TRP1 / gp75, TRP2, gp100, Melan-A / MART1, gangliosides, PSMA. The overexpressed antigens are selected from one or more of HER2, WT1, EphA3, EGFR, CD20. The cancer-testis antigens are selected from one or more of MAGE, BAGE, GAGE, NY-ESO-1. The general antigen is selected from one or more of Telomerase and Survivin; The carcinogenic virus-derived antigen is selected from one or more of EBV, HPV, HBV, HCV, human herpesvirus, and Merkel cell polyomavirus.

5. A nucleic acid vaccine, characterized in that, Comprising: The nucleic acid molecule according to any one of claims 1 to 4, and optionally a pharmaceutically acceptable excipient or auxiliary component; wherein, the nucleic acid vaccine is an mRNA vaccine; the auxiliary component is a nanocarrier for carrying the mRNA; and / or The excipient includes at least one selected from an injection buffer medium, a lyophilization or cryoprotectant.

6. A protein, characterized in that, The protein is encoded by the nucleic acid molecule according to any one of claims 1 to 4.

7. A protein or polypeptide vaccine, characterized in that, Comprising: the protein according to claim 6 as an antigen component; also Comprising an immunoadjuvant.

8. Vector vaccine, characterized in that, Including an active ingredient; the active ingredient is obtained by loading the nucleic acid molecule according to any one of claims 1 to 4 into a carrier; the carrier is a eukaryotic carrier or a prokaryotic carrier.

9. A pharmaceutical composition, characterized in that, Including: The nucleic acid molecule according to any one of claims 1 to 4, the nucleic acid vaccine according to claim 5, the protein according to claim 6, the protein or polypeptide vaccine according to claim 7, or the carrier vaccine according to claim 8; also including a pharmaceutically acceptable excipient.

10. Use of the nucleic acid molecule according to any one of claims 1 to 4, the nucleic acid vaccine according to claim 5, the protein according to claim 6, the protein or polypeptide vaccine according to claim 7, or the carrier vaccine according to claim 8, and the pharmaceutical composition according to claim 9 in the preparation of a drug for preventing or treating related tumor diseases.