Rapid detection method for urinary tract infection escherichia coli with non-disease diagnosis or non-treatment purpose

Abstract

The invention relates to the technical field of rapid detection methods, in particular to a rapid detection method for urinary tract infected Escherichia coli with a non-disease diagnosis or non-treatment purpose, firstly, an RPA reaction system and a CRISPR / Cas12a reaction system are placed at the bottom and the inner side of a tube cover of a PCR reaction tube respectively, the competitive effect of CRISPR / Cas12a and RPA is avoided, and the RPA reaction system and the CRISPR / Cas12a reaction system are used for rapidly detecting urinary tract infected Escherichia coli; the reaction rate and the sensitivity are ensured, and meanwhile, the risk of nucleic acid aerosol pollution is also avoided because the cover does not need to be opened; secondly, the RPA provided by the invention specifically amplifies target DNA through an optimized primer, the CRISPR / Cas12a specifically recognizes a target sequence through an optimized crRNA, under an optimized reaction condition, through double screening of the RPA and the CRISPR / Cas12a, rapid, sensitive and specific detection of urinary tract infection escherichia coli can be realized, and the kit is high in reliability, low in cross reactivity and convenient to popularize.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid detection methods, and particularly relates to a rapid detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes. Background Art

[0002] Uropathogenic Escherichia coli (UPEC) is one of the most common pathogens causing urinary tract infections, and its infection route usually involves migration from the intestine to the urinary system. UPEC is part of the intestinal flora and usually resides in the intestine, living symbiotically with the human body. Under normal circumstances, the beneficial flora in the intestine can inhibit the growth and spread of UPEC. However, when the balance of the intestinal flora is disrupted, or the host's defense mechanism is damaged, UPEC may overgrow and migrate from the intestine to the urinary system.

[0003] Conventional detection methods for UPEC cover a variety of techniques, including microbial culture, molecular biology detection (such as polymerase chain reaction, PCR), and mass spectrometry. Microbial culture, as a traditional method for detecting UPEC, is considered the gold standard for detection. This method involves inoculating urine samples onto specific culture media and then culturing the bacteria under suitable conditions. Based on the bacterial culture, the biochemical characteristics of the bacteria are observed to confirm whether it is UPEC; however, this method takes a long time, usually requiring 12 - 24 hours to complete, requires professional laboratory equipment and operators, and for some UPEC strains that do not grow or grow slowly, they may not be detected by the culture method. Other methods include molecular biology methods, usually including PCR and its derivative technologies, and immunological methods, such as enzyme-linked immunosorbent assay. Methods such as PCR usually require expensive laboratory equipment and professional technicians to operate, and immunological methods have a detection window period. Although molecular biology methods are highly sensitive, they do not always meet the requirements of rapidity, low cost, and simple operation simultaneously. Mass spectrometry identifies UPEC by analyzing the mass fingerprint of bacterial proteins or peptides, and there are also problems such as the high cost of mass spectrometers and the need for professional training for operation and maintenance.

[0004] To overcome these limitations, researchers are developing new detection technologies, such as the RPA-CRISPR / Cas12a method, which combines isothermal nucleic acid amplification and CRISPR gene editing technology, can complete the detection of UPEC in a shorter time, has simple operation, does not rely on expensive laboratory equipment, and is expected to become an ideal on-site rapid detection method.

[0005] However, the existing RPA-CRISPR / Cas12a method for detecting Escherichia coli in urinary tract infections still has some defects. For example, in the existing detection operation process, the RPA amplification reaction is first carried out, and then the PRA reaction product is transferred to the CRISPR / Cas12a reaction system. It is necessary to open the lid to transfer the amplification product, which increases the risk of aerosol contamination. In addition, there are also problems of relatively high cross-reactivity and the need to further improve the sensitivity and specificity. Summary of the Invention

[0006] The object of the present invention is to provide a rapid detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes, aiming at the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need to further improve the sensitivity and specificity. By placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube cap respectively, the competitive effect between CRISPR / Cas12a and RPA is avoided, ensuring the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the method provided by the present invention can achieve rapid, sensitive and specific detection of Escherichia coli in urinary tract infections.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A rapid detection method for Escherichia coli in urinary tract infections for non-disease diagnosis or non-therapeutic purposes, comprising the following steps:

[0009] Add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix on the inner side of the tube cap of the reaction tube, and collect them in one tube;

[0010] Extract DNA from the test sample;

[0011] Add the extracted DNA into the reaction tube and mix it with the RPA premix, close the tube cap, and carry out the RPA amplification reaction; perform centrifugation to mix the CRISPR / Cas12a premix with the RPA reaction product for reaction;

[0012] Perform fluorescence method or lateral flow biosensing strip to detect whether there is a signal of Escherichia coli in urinary tract infections;

[0013] Wherein, the RPA premix includes RPA primers;

[0014] The RPA primer sequences are: RPA-F: 5’-ACCTCGTTGCGTTTGAGTTTGTTGGCTTTG-3’, RPA-R: 5’-GCAGTTTGATTTTCAGGAGCGGAAGTGTCG-3’;

[0015] The CRISPR / Cas12a premix includes crRNA and ssDNA signal probes;

[0016] The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGAAGGAACUACGUGCAUUC C-3’;

[0017] The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0018] The present invention provides a rapid detection method for Escherichia coli in urinary tract infection based on RPA-CRISPR / Cas12a. First, by placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube cap respectively, the present invention avoids the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided; Second, the RPA provided by the present invention specifically amplifies the target DNA through optimized primers, and CRISPR / Cas12a specifically recognizes the target sequence through optimized crRNA. Under optimized reaction conditions, through the double screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Escherichia coli in urinary tract infection can be achieved, with high reliability and low cross-reactivity, which is convenient for popularization.

[0019] Furthermore, the sample to be tested is a pretreated urine sample;

[0020] The pretreated urine sample is prepared by the following method:

[0021] Take the urine to be tested and perform centrifugation;

[0022] Discard the supernatant, take sterile water to resuspend the precipitate, and obtain the pretreated urine sample.

[0023] Furthermore, the specific method for extracting the DNA template is as follows:

[0024] Place the pretreated urine sample under the condition of heating at 95°C to 100°C, perform centrifugation, and take the supernatant to obtain the extracted DNA template.

[0025] Furthermore, heating is carried out using a metal bath or a water bath.

[0026] Furthermore, heat for 5 min to 8 min.

[0027] Furthermore, the rotation speed for centrifugation is 4000 rpm to 5000 rpm, and the centrifugation time is 30 s to 60 s.

[0028] The DNA template extraction method provided by the present invention does not require the use of a kit for extraction, has a low cost, and a short extraction time.

[0029] Further, the temperature of the RPA amplification reaction is 37°C to 42°C, and the time of the RPA amplification reaction is 10 min to 12

[0030] min.

[0031] Further, the temperature of the reaction of mixing the CRISPR / Cas12a premix with the RPA reaction product is 37°C to 42°C, and the reaction time is 7 min to 10 min.

[0032] Further, the volume ratio of the extracted DNA to the RPA premix is 1 to 1.5:23.5 to 24.

[0033] Further, every 23.8 μL of the RPA premix includes 14.5 μL to 15 μL of the RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 1.1 μL to 1.3 μL of 10 μM RPA-F, 1.1 μL to 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

[0034] Further, every 10 μL of the CRISPR / Cas12a premix includes 0.5 μL to 1 μL of 1 μM Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of buffer buffer, and the balance is DEPC-treated water.

[0035] Further, the added volume ratio of the RPA premix and the CRISPR / Cas12a premix is 2 to 3:1.

[0036] Further, fluorescence method or lateral flow biosensing strip is used to detect the signal of whether Escherichia coli causing urinary tract infection is contained: if the fluorescence increases or the test line shows color, it indicates that Escherichia coli causing urinary tract infection is contained in the sample to be tested.

[0037] In summary, due to the adoption of the above technical solutions, the beneficial effects of the present invention are:

[0038] 1. The present invention provides a rapid detection method for Escherichia coli in urinary tract infections based on RPA-CRISPR / Cas12a. First, by placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube cap respectively, the present invention avoids the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the RPA provided by the present invention specifically amplifies the target DNA through the optimized primers, and CRISPR / Cas12a specifically recognizes the target sequence through the optimized crRNA. Under the optimized reaction conditions, through the dual screening of RPA and CRISPR / Cas12a, the rapid, sensitive and specific detection of Escherichia coli in urinary tract infections can be achieved, with high reliability and low cross-reactivity, which is convenient for popularization.

[0039] 2. The rapid detection method for Escherichia coli in urinary tract infections provided by the present invention has high RPA amplification efficiency, fast amplification speed, and does not require additional lid opening, and can complete the detection of UPEC in about 20 minutes.

[0040] 3. The rapid detection method for Escherichia coli in urinary tract infections provided by the present invention has high specificity. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target DNA through crRNA. Through the dual screening of RPA and CRISPR / Cas12a, UPEC can be specifically detected without cross-reaction with common pathogenic bacteria.

[0041] 4. The rapid detection method for Escherichia coli in urinary tract infections provided by the present invention has high sensitivity. Through the dual amplification of RPA and CRISPR / Cas12a, UPEC targets with a concentration of 2.8 copies / μL can be detected. Description of the Drawings

[0042] Figure 1 It is a data graph of RPA primer analysis in the examples.

[0043] Figure 2 It is a data graph of crRNA screening in the examples.

[0044] Figure 3 It is a data graph of the process of condition optimization in the examples.

[0045] Figure 4 It is a data graph of the sensitivity test results in the examples.

[0046] Figure 5 It is a data graph of the specificity test results in the examples.

[0047] Figure 6It is a diagram showing the positions of the RPA premix and the CRISPR / Cas12a premix in the reaction tube. Detailed implementation mode

[0048] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0049] Embodiment 1

[0050] Aiming at the problems existing in the prior art, such as the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need to further improve sensitivity and specificity.

[0051] This embodiment provides a rapid detection method for Escherichia coli in urinary tract infection for non-disease diagnosis or non-therapeutic purposes, including the following steps:

[0052] As Figure 6 shown, add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix inside the tube cap of the reaction tube, collecting them in one tube;

[0053] S1. Extract DNA from the test sample;

[0054] The test sample is a pretreated urine sample; the pretreated urine sample is prepared by the following method:

[0055] Take 1 mL of the test urine in a 1.5 mL PCR tube and centrifuge at 4000 rpm for 45 s;

[0056] Discard the supernatant, add 100 μL of sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

[0057] Place the pretreated urine sample in a metal bath or water bath at 95 °C and heat for 5 min, then centrifuge at 4000 rpm for 45 s, and take the supernatant, which is the extracted DNA sample.

[0058] In some embodiments, the specific method for extracting the DNA template is as follows:

[0059] Place the pretreated urine sample under heating conditions of 95 °C to 100 °C, perform centrifugation, and take the supernatant to obtain the extracted DNA template.

[0060] In some embodiments, heating is carried out using a metal bath or a water bath.

[0061] In some embodiments, heat for 5 min to 8 min.

[0062] In some embodiments, the rotation speed of the centrifugation treatment is 4000 rpm to 5000 rpm, and the time of the centrifugation treatment is 30 s to 60 s.

[0063] S2. Add 1.2 μL of the extracted DNA into a reaction tube and mix it with 23.8 μL of the RPA premix. Close the tube cap and perform an RPA amplification reaction at 39 °C for 10 min.

[0064] RPA premix: 14.75 μL of RPA Basic reaction buffer, 1.25 μL of 280 mM MgOAc, 1.2 μL of 10 μM forward primer (F), 1.2 μL of 10 μM reverse primer (R), 5.4 μL of DEPC-treated water.

[0065] In some embodiments, the volume ratio of the extracted DNA to the RPA premix is 1 to 1.5:23.5 to 24.

[0066] In some embodiments, every 23.8 μL of the RPA premix includes 14.5 μL to 15 μL of RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 1.1 μL to 1.3 μL of 10 μM RPA-F, 1.1 μL to 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

[0067] In some embodiments, the temperature of the RPA amplification reaction is 37 °C to 42 °C, and the time of the RPA amplification reaction is 10 min to 12 min.

[0068] S3. Perform centrifugation treatment. Mix and react 10 μL of the CRISPR / Cas12a premix with the RPA reaction product. The reaction temperature is 39 °C, and the reaction time is 7 to 10 min. Composition of the CRISPR / Cas12a reaction system: 0.875 μL of 1 μM Cas12a; 1.75 μL of 1 μM crRNA; 0.875 μL of 10 μM ssDNA probe; 3.5 μL of buffer; 3 μL of DEPC-treated water, with a total of 10 μL.

[0069] In some embodiments, every 10 μL of the CRISPR / Cas12a premix includes 0.5 μL to 1 μL of 1 μM Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of buffer solution, and the balance is DEPC-treated water.

[0070] In some embodiments, the added volume ratio of the RPA premix to the CRISPR / Cas12a premix is 2 to 3:1.

[0071] In some embodiments, the temperature for the mixing reaction of the CRISPR / Cas12a premix and the RPA reaction product is 37°C to 42°C, and the reaction time is 7 min to 10 min.

[0072] Perform fluorescence method or lateral flow biosensing strip detection to check for signals of Escherichia coli causing urinary tract infection; if the fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Escherichia coli causing urinary tract infection.

[0073] Among them, the RPA premix includes RPA primers;

[0074] The RPA primer sequences are: RPA-F: 5’-ACCTCGTTGCGTTTGAGTTTGTTGGCTTTG-3’, RPA-R: 5’-GCAGTTTGATTTTCAGGAGCGGAAGTGTCG-3’;

[0075] The CRISPR / Cas12a premix includes crRNA and ssDNA signal probes;

[0076] The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGAAGGAACUACGUGCAUUC C-3’;

[0077] The sequence of the ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0078] Specifically, this embodiment provides the exploration process of the rapid detection method of the embodiment:

[0079] Step 1. Plasmid and clinical sample preparation

[0080] Select the chuA gene of Escherichia coli causing urinary tract infection (GenBank: U67920.1) as the detection target gene, and synthesize a plasmid carrying the chuA gene (GenBank: U67920.1) by Sangon Biotech (Shanghai) Co., Ltd. The clinical strain is cultured in Luria-Bertani (LB) broth culture medium at a constant temperature of 37°C (120 r / min) for 12 hours, boiled at 95°C for 5 minutes, and then centrifuged to take the supernatant as the template.

[0081] Step 2. Primer design

[0082] Using the chuA gene of Escherichia coli in urinary tract infection as the detection target gene, according to the RPA primer design principle, 3 pairs of RPA forward and reverse candidate primers were designed using the primer design software Primer Premier 6, and the specificity of the primers was verified online using NCBI-BLAST. The primers and target fragments are shown in Table 1, and all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0083] Table 1 Primer sequences

[0084] Name Sequence (5’→3’) F1 GCGTTTGAGTTTGTTGGCTTTGGCTGTTTC R1 GCAGTTTGATTTTCAGGAGCGGAAGTGTCG F2 TTACCTCGTTGCGTTTGAGTTTGTTGGCTTTG R2 GCAGTTTGATTTTCAGGAGCGGAAGTGTCG F3 ACCTCGTTGCGTTTGAGTTTGTTGGCTTTG R3 GCAGTTTGATTTTCAGGAGCGGAAGTGTCG

[0085] Step 3, RPA amplification reaction system

[0086] RPA Basic reaction buffer (recombinase polymerase amplification kit Basic kit purchased from TwistDxTM, UK) 14.75 μL, 280 mM MgOAc 1.25 μL, 10 μM upstream primer (F) 1.2 μL, 10 μM downstream primer (R) 1.2 μL, template 1.2 μL, DEPC-treated water 5.4 μL, total 25 μL. The prepared reaction system was reacted at 39 °C for 15 minutes, and the results could be observed.

[0087] Step 4, Reaction system of one-tube RPA-CRISPR / Cas12a reaction

[0088] The reaction of the one-tube method integrates the RPA reaction and the CRISPR / Cas12a reaction ( Lba Cas12a (Cpf1) nuclease purchased from NEB England Biolabs (Beijing)) in one tube. Composition of the CRISPR / Cas12a reaction system: 1 μM Cas12a 0.875 μL; 1 μM crRNA 1.75 μL; 10 μM ssDNA probe 0.875 μL; DEPC water 3 μL; buffer 3.5 μL, total 10 μL. Place the RPA reaction system at the bottom of the EP tube, place the CRISPR / Cas12a system on the inner side of the EP tube cap, add the sample to the RPA reaction system, after a 10-min RPA reaction at 39 °C, centrifuge at 1200 rpm for 10 seconds, centrifuge the CRISPR / Cas12a system on the inner side of the tube cap into the RPA reaction, perform the CRISPR / Cas12a cleavage reaction, and collect the fluorescence signal through a real-time fluorescence quantitative PCR instrument. The detection can be completed in 7 - 10 minutes.

[0089] Step 5, Condition optimization

[0090] (1) RPA primer screening: At a concentration of 10 4Using the plasmid with the chuA gene of Escherichia coli causing urinary tract infection at copies / μL as a template, and using DEPC-treated water instead of the plasmid as a control, different RPA primer pairs were used for amplification according to the conditions in step 3. Subsequently, an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution was added to the reaction tube, mixed well, centrifuged at 12,000 rpm for 5 min, the supernatant was aspirated, and the amplification product was extracted. The amplification product was added with 6×SuperStain Loading Buffer at a ratio of 5:1, mixed well, and electrophoresed on a 1.5% agarose gel at a constant voltage of 90 V for 30 min, and the results were observed by developing with a gel imager. The results are as Figure 1 shown in A of 1 . According to the observation of the thickness of the bands of the amplification product, the effect of primer 3 is the best. The sensitivity of primer 3 was verified and it can reach 10 Figure 1 copies / μL, as shown in B of

[0091] Figure 1 . A in

[0092] Figure 1 , Screening of RPA primers for Escherichia coli causing urinary tract infection. Lane 1: 250 bp DNA Ladder; Lane 2: F1R1 (162 bp); Lane 3: F1R1 control; Lane 4: F2R2 (172 bp); Lane 5: F2R2 control; Lane 6: F3R3 (170 bp); Lane 7: F3R3 control.

[0092] Figure 1 . B in 2 , Analysis of the sensitivity of RPA amplification of the F3R3 primer group. Lane 1: 250 bp DNA Ladder; Lane 2: plasmid concentration 10 1 copies / μL; Lane 3: plasmid concentration 10 0 copies / μL; Lane 4: negative control.

[0093] crRNA design and screening: crRNA was designed according to the optimal RPA primer amplification sequence, and the specific sequences are shown in Table 2; different crRNAs were used for reaction in the system described in step 4, and the best crRNA was selected according to the intensity of the fluorescence signal and the time to reach the plateau. The results are as Figure 2 shown. The time for crRNA1 to reach the plateau is shorter and the fluorescence value at the end point is higher, so crRNA1 was selected for the following experiments.

[0094] Table 2 crRNA and ssDNA probe sequences

[0095]

[0096] (3) Optimization of the CRISPR / Cas12a system: Using the plasmid (2.82×104 Using the plasmid template concentration of 10 Figure 3 copies / μL), the reaction conditions such as the concentration of Cas12a (25 nM, 50 nM, 75 nM, 100 nM), the ratio of Cas12a / crRNA (1:1, 1:1.5, 1:2), and the concentration of ssDNA probe (150 nM, 250 nM, 350 nM) were optimized respectively. The fluorescence values at 10 min of the reaction were plotted, and the results are shown in Figure 3 A in Figure 3 B in

[0097] Figure 3 C in Figure 3 A. Optimization of Cas12a concentration; Figure 3 B. Optimization of the ratio of Cas12a / crRNA; 4 C. Optimization of the concentration of ssDNA probe; The plasmid template concentration used was 10

[0098] Step 6. Sample pretreatment

[0099] Nucleic acid extraction of Escherichia coli in urinary tract infection was carried out by boiling method. The suspension of Escherichia coli in urinary tract infection was directly thermally lysed at 95 °C for 5 min, centrifuged, and the supernatant was used as the RPA-CRISPR / Cas12a reaction template.

[0100] Step 7. Sensitivity test of the one-tube RPA-CRISPR / Cas12a detection method

[0101] For the sensitivity detection using plasmid as the template, the plasmid standard containing the chuA target fragment of Escherichia coli in urinary tract infection was serially diluted to 2.8×10 2 copies / μL, 2.8×10 1 copies / μL and 2.8×10 0copies / μL. Meanwhile, DEPC-treated water was used as a negative control. According to the reaction system of optimized step 4, 1.2 μL of the plasmid dilution was added to the RPA reaction system. After performing the 10-min RPA reaction at 39 °C, it was centrifuged at 1200 rpm for 10 seconds to centrifuge the CRISPR / Cas12a system on the inner side of the tube cap into the RPA reaction for the CRISPR / Cas12a cleavage reaction. Fluorescence signals were collected by a real-time fluorescence quantitative PCR instrument, and the detection could be completed in 7 - 10 min. A graph was plotted with the fluorescence value at 10 min of the reaction ( Figure 4 ). The reaction results showed that this method could detect plasmid standards as low as 1×10 0 copies / μL.

[0102] Step 8: Specificity test of one-tube RPA-CRISPR / Cas12a

[0103] DNA of pathogenic bacteria such as Escherichia coli and Klebsiella pneumoniae causing urinary tract infections was extracted by the boiling method as templates for one-tube RPA-CRISPR / Cas12a detection. A graph was plotted with the fluorescence value at 10 min of the reaction ( Figure 5 ). The results showed that this method had high specificity for Escherichia coli causing urinary tract infections and there was no cross-reaction during the detection process.

[0104] From the results of the above various embodiments, it can be seen that the present invention can rapidly, sensitively, specifically, and accurately detect Escherichia coli causing urinary tract infections, avoiding sample or environmental cross-contamination. This method has strong anti-interference ability, does not require complex nucleic acid extraction steps, and only simple thermal lysis can complete the sample pretreatment link. This method realizes one-tube RPA-CRISPR / Cas12a detection, does not require liquid transfer links, simplifies the experimental steps, and reduces the possibility of aerosol contamination. In summary, this method can achieve rapid and accurate on-site detection of Escherichia coli causing urinary tract infections.

[0105] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rapid detection method for Escherichia coli in urinary tract infections for non-diagnostic or non-therapeutic purposes, characterized in that, It includes the following steps: Add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix inside the tube cap of the reaction tube, and collect them in one tube; Extract DNA from the sample to be tested; Add the extracted DNA into the reaction tube and mix it with the RPA premix, close the tube cap, and perform RPA amplification reaction; Centrifuge to mix the CRISPR / Cas12a premix with the RPA reaction product for reaction; Perform fluorescence method or lateral flow biosensing test strip to detect the signal of Escherichia coli causing urinary tract infection; Among them, the RPA premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-ACCTCGTTGCGTTTGAGTTTGTTGGCTTTG-3’, RPA-R: 5’-GCAGTTTGATTTTCAGGAGCGGAAGTGTCG-3’; The CRISPR / Cas12a premix includes crRNA and ssDNA signal probe; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUGAAGGAACUACGUGCAUUCC-3’; the sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

2. The rapid detection method according to claim 1, wherein The sample to be tested is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and centrifuge it; Discard the supernatant, take sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

3. The rapid detection method according to claim 2, characterized in that, The specific method for extracting DNA template is as follows: Place the pretreated urine sample at 95°C - 100°C for heating for 5 min - 8 min, centrifuge, and take the supernatant to obtain the extracted DNA template.

4. The rapid detection method according to claim 1, wherein The temperature of the RPA amplification reaction is 37°C - 42°C, and the time of the RPA amplification reaction is 10 min - 12 min.

5. The rapid detection method according to claim 1, wherein The temperature for the reaction of mixing the CRISPR / Cas12a premix with the RPA reaction product is 37°C - 42°C, and the reaction time is 7 min - 10 min.

6. The rapid detection method according to claim 1, characterized in that, The volume ratio of the extracted DNA to the RPA premix is 1 - 1.5:23.5 - 24.

7. The rapid detection method according to claim 6, wherein Each 23.8 μL of RPA premix includes 14.5 μL - 15 μL of RPA Basic reaction buffer, 1 μL - 1.5 μL of 280 mM MgOAc, 1.1 μL - 1.3 μL of 10 μM RPA-F, 1.1 μL - 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

8. The rapid detection method according to claim 7, wherein Each 10 μL of CRISPR / Cas12a premix includes 0.5 μL - 1 μL of 1 μM Cas12a, 1.5 μL - 2 μL of 1 μM crRNA, 0.5 μL - 1 μL of 10 μM ssDNA probe, 3 μL - 4 μL of buffer buffer, and the balance is DEPC-treated water.

9. The rapid detection method according to claim 8, wherein The added volume ratio of the RPA premix and the CRISPR / Cas12a premix is 2 - 3:

1.

10. The rapid detection method according to any one of claims 1 to 9, characterized in that, Signals for detecting whether the urinary tract infection Escherichia coli is contained by fluorescence method or lateral flow biosensing test strip: If the fluorescence is enhanced or the test line shows color, it indicates that the urinary tract infection Escherichia coli is contained in the sample to be tested.

Images