Primer probe group and kit for detecting KRAS, NRAS and BRAF genes of colorectal cancer and application
Through fluorescent PCR technology combined with ARMS-PCR and specific primer probe sets, the problem of difficult to efficiently detect multiple mutation sites of colorectal cancer KRAS, NRAS and BRAF genes in the prior art is solved, and efficient and low-cost multi-site detection is achieved, which improves the sensitivity and specificity of the detection, and is suitable for rapid clinical diagnosis.
Patent Information
- Application Number
- CN202510342996.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-25
AI Technical Summary
The prior art is difficult to efficiently and at low cost to detect multiple mutation sites of the KRAS, NRAS and BRAF genes of colorectal cancer simultaneously, resulting in low detection throughput, long time and small coverage, limiting the personalized treatment effect of colorectal cancer patients.
Fluorescent PCR technology is used to combine ARMS-PCR, fluorescent probe method, blocking primer Blocker and locking nucleic acid modified MGB probes to design specific primer probe sets, which can simultaneously detect 11 mutation sites of KRAS, NRAS and BRAF genes. By optimizing primer and probe design, the sensitivity and specificity of detection are improved.
It realizes efficient detection of multiple mutation sites of KRAS, NRAS and BRAF genes, improves the sensitivity and specificity of the detection, simplifies the operation process, shortens the detection time, reduces the cost, and is suitable for the needs of rapid clinical diagnosis.
Smart Images

Figure CN120366454A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of clinical molecular detection, and particularly to a primer-probe set, a kit and an application for detecting KRAS, NRAS and BRAF genes in colorectal cancer. Background Art
[0002] Colorectal cancer (CRC) is one of the common malignant tumors worldwide, including colon cancer and rectal cancer. Although treatment methods include surgery, radiotherapy, chemotherapy and targeted therapy, etc., the low early diagnosis and treatment rates limit the improvement of the prognosis of patients. With the development of molecular detection technology, personalized treatment is expected to improve the survival rate of patients.
[0003] The RAS, NRAS and BRAF genes are important regulatory molecules downstream of the EGFR signaling pathway and are involved in the regulation of cell growth, differentiation and proliferation. The mutation status of these genes directly affects the treatment effect and prognosis of colorectal cancer patients. Approximately 30%-55% of colorectal cancer patients have KRAS gene mutations, 1%-6% have NRAS mutations, and the mutation rate of the BRAF gene is 8%-14%. Mutations in RAS and BRAF genes can lead to ineffective or poor efficacy of EGFR-targeted drugs.
[0004] Currently, the methods for detecting colorectal cancer-related gene mutations mainly include first-generation sequencing (Sanger sequencing), second-generation sequencing (NGS) and real-time fluorescence quantitative PCR (qPCR). First-generation sequencing has low sensitivity and cannot detect samples with low mutation frequencies; although second-generation sequencing has high sensitivity, it has problems such as large amounts of data, complex analysis and long cycles; conventional qPCR has high sensitivity, but it can only detect a single site each time, and multiple amplifications increase the detection complexity and cost.
[0005] Chinese Patent CN113862364A discloses a colorectal cancer diagnostic marker, a PAP detection probe and a detection kit for colorectal cancer. The colorectal cancer diagnostic marker is selected from any one or any combination of KRAS-G12D, KRAS-G12C, KRAS-G13D, KRAS-Q61H, NRAS-Q61K, NRAS-Q61R, NRAS-G12D or BRAF-V600E. However, the number of mutation sites detected each time by this method is limited, and it cannot detect all of the above sites simultaneously at one time. The detection throughput is low, the time consumption is long and the coverage range is small, which limits its application.
[0006] Chinese Patent CN106755445A discloses a method and kit for detecting KRAS / NRAS / BRAF / PIK3CA genes in colorectal cancer. This detection method and kit simultaneously sequence multiple regions of the KRAS / NRAS / BRAF / PIK3CA genes in colorectal cancer based on a high-throughput sequencing platform, greatly improving the detection efficiency, accuracy, and sensitivity and reducing the detection cost. However, it has problems such as a large amount of data, complex analysis, and a long detection cycle, and the sequencing instrument is expensive, which limits its application scope.
[0007] Currently, the PCR fluorescence probe method for detecting the markers KRAS / NRAS / BRAF in colorectal cancer mainly detects each site one by one, resulting in a low detection throughput, long time consumption, and small coverage range.
[0008] Therefore, detecting the mutation status of KRAS, NRAS, and BRAF has great clinical significance for the treatment of colorectal cancer patients. Summary of the Invention
[0009] In view of this, the purpose of the present invention is to provide a primer-probe set, kit, and application for detecting KRAS, NRAS, and BRAF genes in colorectal cancer, which can effectively improve the sensitivity and specificity of gene detection and achieve the simultaneous detection of 11 mutation sites of KRAS, NRAS, and BRAF genes in one tube.
[0010] The present invention solves the above technical problems through the following technical means:
[0011] In the first aspect, the present invention provides a primer-probe set for detecting KRAS, NRAS, and BRAF genes in colorectal cancer, including primer-probe sets for detecting several mutation sites of KRAS, NRAS, and BRAF genes. The mutation sites include: KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12S, KRAS G12V, KRAS G13D, NRAS G12D, NRAS Q61K, NRAS Q61R, BRAF V600E;
[0012] Among them, the primer-probe set for detecting the KRAS gene includes: the forward primer has any one or more of the nucleotide sequences shown in SEQ ID NO.4 - SEQ ID NO.10; the reverse primer has the nucleotide sequence shown in SEQ ID NO.2; the specific probe has the nucleotide sequence shown in SEQ ID NO.3; the blocking primer has the nucleotide sequence shown in SEQ ID NO.1; and / or
[0013] The primer-probe set for detecting the NRAS gene includes: the forward primer has any one or more of the nucleotide sequences shown in SEQ ID NO. 13 and SEQ ID NOs. 18-19; the reverse primer has any one or more of the nucleotide sequences shown in SEQ ID NOs. 11 and 16; the specific probe has any one or more of the nucleotide sequences shown in SEQ ID NOs. 12 and 17; the blocking primer has any one or more of the nucleotide sequences shown in SEQ ID NOs. 14-15; and / or
[0014] The primer-probe set for detecting the BRAF gene includes: the forward primer has the nucleotide sequence shown in SEQ ID NO. 20; the reverse primer has the nucleotide sequence shown in SEQ ID NO. 21; the specific probe has the nucleotide sequence shown in SEQ ID NO. 22; the blocking primer has the nucleotide sequence shown in SEQ ID NO. 23.
[0015] Preferably, both ends of the nucleotide sequence of the specific probe are respectively carried with a fluorescent reporter group and a quenching group.
[0016] Preferably, the fluorescent reporter group is selected from one of FAM, VIC, ROX, HEX, Cy5, Cy3, and the quenching group includes MGB.
[0017] Preferably, the 3'-end of the nucleotide sequence of the blocking primer is labeled with one of an amino group, NH2-C7, and a phosphate group, and the nucleotide sequence of the blocking primer is modified with locked nucleic acid
[0018] Preferably, the primer-probe set further includes a primer-probe set for detecting an internal reference gene, and the internal reference gene includes GAPDH, ACTB or β-globin.
[0019] Preferably, the primer-probe for detecting the internal reference gene includes: a primer pair having the nucleotide sequences shown in SEQ ID NOs. 24 and 25; a specific probe having the nucleotide sequence shown in SEQ ID NO. 26.
[0020] In a second aspect, the present invention also provides the use of the above primer-probe set in the preparation of reagents or kits for detecting KRAS, NRAS, and BRAF genes.
[0021] In a third aspect, the present invention also provides a kit including the above primer-probe set.
[0022] Preferably, the kit further comprises PCR reaction reagents, which include dNTP, DNA polymerase, UNG enzyme and PCR buffer.
[0023] More preferably, the method for using the kit includes: the GAPDH primers, probes bind to the region where the target of the template DNA is located, and the Ct value is obtained during detection to determine whether the entire reaction system is working properly; the primers and probes of the KRAS gene bind to the region where the template DNA is located, and the Ct value is obtained during detection to determine whether there are mutations at 7 sites of the KRAS gene; the primers and probes of the NRAS gene bind to the region where the template DNA is located, and the Ct value is obtained during detection to determine whether there are mutations at 3 sites of the NRAS gene, and the primers and probes of the BRAF gene bind to the region where the template DNA is located, and the Ct value is obtained during detection to determine whether there is a mutation at 1 site of the BRAF gene.
[0024] The present invention also provides the application of the above primer-probe set in the preparation of colorectal cancer auxiliary diagnostic reagents.
[0025] Advantages of the present invention:
[0026] (1) First, by designing the mutant base site at the end of the 3' end of the primer, it is ensured that the primer can only be normally extended when it is completely complementary paired, thereby restricting the amplification of the wild-type template and only detecting the mutant template, improving the specificity and accuracy of the detection. Secondly, the use of the MGB probe increases the melting temperature (Tm value) of the probe by 10-15 °C, enhances the specificity of the hybridization reaction, makes the probe more easily completely hydrolyzed during PCR, releases sufficient fluorescence signals, and improves the PCR efficiency and detection sensitivity. Furthermore, the blocker primer Blocker is designed to specifically bind to the non-target DNA region, preventing the conventional primer from binding to the non-target sequence, playing a steric hindrance role and inhibiting non-specific amplification. Finally, nucleic acid modification significantly reduces the tolerance of template sequence mismatches, improves the binding ability of the probe to the template, reduces background noise, and further improves the accuracy of the detection.
[0027] (2) The present invention adopts the fluorescence PCR technology and combines multiple advanced technologies such as ARMS-PCR, fluorescence probe method, blocker primer Blocker, locked nucleic acid modification and MGB probe. This method can effectively improve the sensitivity and specificity of gene detection, and can simultaneously detect 11 mutation sites of KRAS, NRAS and BRAF genes (7 for KRAS, 3 for NRAS, 1 for BRAF) in one tube, with a wide coverage range. In addition, this method also has the advantages of saving reagent consumables, reducing detection costs, shortening the detection time (only 1 to 2 hours) and being convenient to operate, and is particularly suitable for the clinical rapid diagnosis needs.
[0028] (3) The present invention not only realizes the efficient detection of multiple mutation sites of KRAS, NRAS and BRAF genes, but also significantly improves the sensitivity and specificity of the detection. The optimized primer and probe design minimizes false positive and false negative results, ensuring the reliability and accuracy of the detection results. The whole detection process is simple and fast, suitable for large-scale clinical applications. The synergistic effect of these technologies not only improves the detection performance, but also simplifies the operation process, shortens the detection time and reduces the cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 It is the PCR amplification diagram for screening the KRAS Blocker blocking primer;
[0030] Figure 2 It is the PCR amplification diagram in which mutations occur at sites in all three genes of KRAS / NRAS / BRAF; DETAILED DESCRIPTION OF THE INVENTION
[0031] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in combination with the specific embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention:
[0032] To identify whether the KRAS / NRAS / BRAF genes are mutated, this application counts the high-frequency mutation sites of these 3 genes (Table 1). Finally, 7 somatic hot spot mutations on exon 2 of the KRAS gene, 3 somatic hot spot mutations on exons 2 and 3 of the human NRAS gene, and the V600E hot spot mutation site on exon 15 of the human BRAF gene are selected according to the mutation frequency and the difficulty of design (Table 2). A set of primer-probe groups is designed and developed according to the mutation sites to identify the gene status.
[0033] Table 1 KRAS / NRAS / BRAF gene mutation sites and mutation frequencies
[0034]
[0035]
[0036] Table 2 KRAS / NRAS / BRAF gene mutation sites detected by the kit of this patent
[0037]
[0038] Primer design, probe design, and blocker primer (Blocker) design are carried out at the mutation sites of KRAS, NRAS, and BRAF genes. In this method, the 3'-end of the upstream primer is exactly the mutated base of the gene. The sequence of the blocker primer (Blocker) covers the mutated base site and is modified with locked nucleic acid (LNA) at the mutated base. The 3'-end of the blocker primer (Blocker) is modified with an amino group or phosphorylated to hinder the amplification of the wild-type template. The fluorescent modification group used at the 5'-end of the probe can be one or several of FAM (6-carboxyfluorescein), HEX (hexachloro-6-methylfluorescein), VIC, ROX, Cy3 (TYETM563), and Cy5 (TYETM665), and each modification can be interchanged. The 3'-end of the probe is modified with MGB.
[0039] Example 1: Screening of KRAS, NRAS, and BRAF primers, probes, and blocker primers
[0040] 1. Screening of KRAS primers and probes:
[0041] The primer, probe, and blocker primer (Blocker) for detecting the KRAS gene are designed as follows:
[0042] Table 3 Primers, probes, and blocker primers (Blocker) for the KRAS gene
[0043]
[0044]
[0045]
[0046]
[0047] KRAS gene primer and probe group screening scheme:
[0048] The first step is to screen primers. Taking the primer and probe group of KRAS-G12A as an example, primers and probes are first designed. Using the synthesized G12A plasmid of the KRAS gene as a template, the primer group of KRAS-G12A as the forward primer and reverse primer, and KRAS-P1 as the probe, PCR amplification is carried out with the 2*MIX enzyme of TransGen AQ732. The amplification system is 20 μL, and the amplification program is pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 10 s; annealing and extension at 60 °C for 30 s; 45 cycles of amplification.
[0049] The screening results of the primer sets for KRAS-G12A are as follows: With the template and probe fixed, the Ct values of the PCR amplification of the G12A primer sets for the KRAS gene are shown in Table 4. By comparing the average Ct values of each primer, it can be seen that the primer pair of KRAS-G12A-F10 and KRAS-R2 has the smallest average Ct value for amplification. Therefore, the primer pair for KRAS-G12A is preferably KRAS-G12A-F10 and KRAS-R2.
[0050] Table 4 Ct values of PCR amplification of the G12A primer sets for the KRAS gene
[0051]
[0052]
[0053] The second step is to screen the probe. Taking the primer-probe set of KRAS-G12A as an example to screen the probe. Using the synthesized G12A plasmid of the KRAS gene as the template, the primer set of KRAS-G12A, namely KRAS-G12A-F10 and KRAS-R2, as the forward primer and reverse primer respectively, and KRAS-P1, KRAS-P2, and KRAS-P3 as the probes, perform PCR amplification with the 2*MIX enzyme of TransGen Biotech AQ732. The amplification system is 20 μL, and the amplification program is pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 30 s; annealing and extension at 60 °C for 30 s; 45 cycles of amplification.
[0054] The screening results of the probes for KRAS-G12A are as follows: With the template and primer fixed, the Ct values of the PCR amplification of the G12A primer sets for the KRAS gene are shown in the following table. By comparing the average Ct values of each reaction, it can be seen that the average Ct values among the three probes are very close. However, the probes KRAS-P2 and KRAS-P3 are modified with MGB, which greatly improves the specificity of the test. Therefore, the probe for KRAS-G12A is finally preferably KRAS-P3.
[0055] Table 5 Ct values of PCR amplification of the G12A primer sets for the KRAS gene
[0056]
[0057] The third step is to screen the Blocker blocking primers, and the KRAS-G12A primer probe set is used as an example to screen the blocking primers. Because this method detects single-base mutations, it is necessary to inhibit the amplification of the wild-type template. Using the wild-type plasmid of KRAS-G12A as a template, KRAS-G12A-F10 and KRAS-R2 as primers, and KRAS-P3 as a probe, 4 blocking primers and a blank control without blocking primers were added respectively. PCR amplification was performed using the 2*MIX enzyme of the full-form gold AQ732, the amplification system was 20 μL, and the amplification program was pre-denaturation at 95°C for 2min; denaturation at 95°C for 30S; annealing and extension at 60°C for 30S; amplification for 45 cycles.
[0058] The amplification results showed that: Figure 1 As shown, without adding Blocker blocking primers, there is an "S"-shaped amplification curve, indicating that the template with a single base difference in KRAS-G12A cannot be recognized and the mutation site cannot be identified; in the system with Blocker blocking primers, the blocking primers competitively bind to the wild-type template, greatly reducing the probability of primer binding to the wild-type template, and the amplification curve is a tail at the end, and the Ct value is after 39Ct, indicating that the system after adding Blocker blocking primers can distinguish templates with single base mutations. By comparing the amplification curves of KRAS-Blocker1, KRAS-Blocker2, KRAS-Blocker3 and KRAS-Blocker4 blocking primers, the obvious Ct value of the blocking primer with locked nucleic acid modification at the mutation site is lower than that without locked nucleic acid modification. The amino modification that hinders polymerase extension is slightly better than the phosphorylation modification in this system. Finally, KRAS-Blocker4 is preferred as the blocking primer.
[0059] The design of the primer probe set and Blocker primer for KRAS-G12A includes the design of primers at the mutant base. The mutant base is designed at the 3' end of the forward primer. This design can reduce the binding of the primer to the wild-type template. The probe uses the MGB probe with higher specificity. The MGB probe increases the temperature of binding to the template and reduces the probability of non-specific binding. The Blocker primer uses locked nucleic acid modification at the mutation site. The locked nucleic acid modification increases the affinity between the base and the template, and has a stronger recognition of the mismatched base during complementary pairing, which increases its specificity of binding to the wild-type template and increases the TM value of the Blocker primer, so that it binds to the template earlier than the detection primer when competitively binding to the wild-type template. Finally, the chemical modification that hinders the extension of the polymerase is preferably amino modification, so as to maximize the effect of the Blocker primer.
[0060] Similarly, according to the above screening scheme, primer-probe sets for other several sites of the KRAS gene, such as G12C, G12D, and G12R, were optimized. After the optimization of the primer-probes, the best primer-probe set for the KRAS gene was finally determined, and the design of the best primer-probe set is shown in Table 6.
[0061] Table 6 The best primer-probe set for the KRAS gene finally determined
[0062] Sequence Name Sequence 5’ 3’ Intermediate Modification Serial Number KRAS-Blocker4 <![CDATA[GTAGTTGGAGCTG L G L TGG L CGTA]]> / <![CDATA[NH2-C7]]> L: Locked Nucleic Acid Modification SEQ ID NO.1 KRAS-R2 TGGATCATATTCGTCCACAAAATG / / / SEQ ID NO.2 KRAS-P3 AGTGCCTTGACGATACAG FAM MGB / SEQ ID NO.3 KRAS-G12A-F10 GAATATAAACTTGTGGTAGTTGGAGCTGC / / / SEQ ID NO.4 KRAS-G12C-F6 GACTGAATATAAACTTGTGGTAGTTGGAGCTT / / / SEQ ID NO.5 KRAS-G12D-F9 TGAATATAAACTTGTGGTAGTTGGAGCTGA / / / SEQ ID NO.6 KRAS-G12R-F11 GACTGAATATAAACTTGTGGTAGTTGGAGCTC / / / SEQ ID NO.7 KRAS-G12S-F8 TGACTGAATATAAACTTGTGGTAGTTGGAGCTA / / / SEQ ID NO.8 KRAS-G12V-F10 CTGAATATAAACTTGTGGTAGTTGGAGCTGT / / / SEQ ID NO.9 KRAS-G13D-F7 AAACTTGTGGTAGTTGGAGCTGGTGA / / / SEQ ID NO.10
[0063] 2. Screening of primer-probes for NRAS:
[0064] The primers, probes, and blocker primers for detecting the NRAS gene were designed as follows:
[0065] Table 7 Primers, probes, and blocker primers for the NRAS gene
[0066]
[0067] The screening scheme for the primer-probe set of the NRAS gene was carried out according to the screening method of KRAS. After the optimization of the primer-probes, the best primer-probe set for the NRAS gene was finally determined, and the design of the best primer-probe set is shown in Table 8 below.
[0068] Table 8 The best primer-probe set for the NRAS gene finally determined
[0069]
[0070]
[0071] 3. Screening of primer-probes for BRAF The primers, probe design, and blocker primers for detecting the BRAF gene are as follows:
[0072] Table 9 Primers, probes, and blocker primers for the BRAF gene
[0073]
[0074] The screening scheme for the primer-probe set of the BRAF gene was carried out according to the screening method of KRAS. After the optimization of the primer-probes, the best primer-probe set for the BRAF gene was finally determined, and the design of the best primer-probe set is shown in Table 10.
[0075] Table 10 The best primer-probe set for the BRAF gene finally determined
[0076]
[0077] Example 2. Screening of primer-probes for internal reference genes:
[0078] In this example, GAPDH was selected as the internal reference gene, and the primers and probes for detecting the GAPDH gene were designed as shown in Table 11:
[0079] Table 11 Primers and Probes for GAPDH Gene
[0080]
[0081]
[0082] According to the screening scheme of the primer-probe group of KRAS, after the optimization of primers and probes, the best primer-probe group of the GAPDH gene was finally determined, and the design of the best primer-probe group is shown in Table 12 below.
[0083] Table 12 The Best Primer-Probe Group of GAPDH Gene Finally Determined
[0084] Sequence Name Sequence 5'-3' 5’ 3’ Intermediate Modification Serial Number GAPDH-F1 aagtttgtgtttagattgtgggtggtag / / / SEQ ID NO.24 GAPDH-R1 tctcccttaaacttccctaccaaactaa / / / SEQ ID NO.25 GAPDH-P1 tatgattgggggtgttgggtagttttgg CY5 MGB / SEQ ID NO.26
[0085] Example 3 Composition and Use of the Kit
[0086] The composition of the reaction system components is shown in Table 13
[0087] Table 13 Composition of the Reaction System Components
[0088]
[0089]
[0090] Usage Method of the Kit
[0091] Using the optimized primers and probes and the optimized reaction system, the primer-probe composition is mixed with the template DNA of the sample to be detected for qPCR detection. Among them, the GAPDH primers, probes bind to the target region on the template DNA, and the Ct value is obtained during the detection to determine whether the entire reaction system works properly; the primers and probes of the KRAS gene bind to the region where the template DNA is located, and the Ct value is obtained during the detection to determine whether there are mutations at 7 sites of the KRAS gene; the primers and probes of the NRAS gene bind to the region where the template DNA is located, and the Ct value is obtained during the detection to determine whether there are mutations at 3 sites of the NRAS gene, and the primers and probes of the BRAF gene bind to the region where the template DNA is located, and the Ct value is obtained during the detection to determine whether there is a mutation at 1 site of the BRAF gene.
[0092] The usage method of the kit specifically includes the following steps:
[0093] Nucleic acid extraction of the sample to be detected:
[0094] Reagent preparation: Prepare the PCR amplification reaction solution according to 20 μL of the PCR reaction solution per number of samples to be tested.
[0095] Add 2 μL of the PCR amplification template obtained by nucleic acid extraction to the above reagents, and amplify the positive control and negative control simultaneously. After brief centrifugation, transfer to the amplification area. The amplification program is shown in Table 14.
[0096] Table 14 PCR Amplification Program
[0097]
[0098] Result interpretation:
[0099] The determination method for the gene mutation of the sample to be tested by the Ct value difference is as follows:
[0100] For the internal control CY5 signal of the sample to be tested, if there are obvious amplification signals and CtCY5 < 38, subsequent interpretation can be carried out: If there is no obvious amplification signal in the CY5 channel or CtCY5 > 38, it indicates that there is no human genome in the sample and the nucleic acid extraction has failed; if there is no obvious amplification signal in the FAM channel or CtFAM > 38, it indicates that there is no mutation in the 7 sites of the KRAS gene of the sample; if CtFAM ≤ 38, it indicates that at least one of the 7 sites of the KRAS gene of the sample has a mutation; if there is no obvious amplification signal in the VIC channel or CtVIC > 38, it indicates that there is no mutation in the 3 sites of the NRAS gene of the sample; if CtVIC ≤ 38, it indicates that at least one of the 3 sites of the NRAS gene of the sample has a mutation; if there is no obvious amplification signal in the ROX channel or CtROX > 38, it indicates that there is no mutation in the V600E site of the BRAF gene of the sample; if CtROX ≤ 38, it indicates that the V600E site of the BRAF gene of the sample has a mutation.
[0101] Result verification of the sensitivity and specificity of the kit in Example 4
[0102] To verify the detection performance of this kit, the following tests were designed for verification.
[0103] 1. Verify the detection sensitivity of the kit
[0104] Method: There are 7 detection sites for the colorectal cancer KRAS mutant gene in this kit. Since the detection methods for the 7 mutant sites are the same, selecting one of the mutant sites can determine the detection limit of the KRAS mutant gene plasmid sample. In this test, the KRAS-G12A mutant site was selected to determine the detection limit. Use the colorectal cancer KRAS mutant gene plasmid KRAS-G12A at 10000 copies / mL for serial concentration dilution, and repeatedly detect the serial concentration samples. The concentration at which the positive detection rate is ≥ 95% is used as the detection limit of the kit.
[0105] The plasmid of colorectal cancer KRAS mutant gene KRAS-G12A at a concentration of 10,000 copies / mL was serially diluted, and the serially diluted samples were repeatedly detected. The concentration at which the positive detection rate was ≥95% was used as the detection limit of the product.
[0106] Table 15 Detection results of serial concentrations of colorectal cancer KRAS mutant gene KRAS-G12A plasmid samples
[0107]
[0108]
[0109] (Note: Negative is "-", positive is "+")
[0110] Result analysis:
[0111] When the sample concentration was above 3,000 copies / mL, the positive detection rate of the kit was 100%; when the sample concentration was 1,000 copies / mL, the positive detection rate of the kit was 95%. Therefore, the kit could still detect samples with a concentration of 1,000 copies / mL, that is, the kit could detect samples with a lower concentration and had high sensitivity.
[0112] 2. Verify the sensitivity of the kit for mutation detection
[0113] Since there may be mutations in some parts of the genes and no mutations in other parts in actual colorectal cancer samples. For example, the proportion of the KRAS-G12A mutant gene in the sample DNA is 50%, and the proportion of the wild-type KRAS gene is 50%. Whether the kit can detect the mutant gene in the mixed template. In this experiment, the KRAS-G12A mutation site was selected for detection. The plasmid of colorectal cancer KRAS mutant gene KRAS-G12A and the wild-type KRAS plasmid were mixed in different proportions. The final concentration of the template was 3,000 copies / mL.
[0114] Table 16 Different proportions of mixing of colorectal cancer KRAS mutant gene plasmid KRAS-G12A and wild-type KRAS plasmid
[0115] Name Ratio 1 Ratio 2 Ratio 3 Ratio 4 Ratio 5 Ratio 6 Ratio 7 Ratio 8 KRAS-G12A Mutant Plasmid 100% 80% 60% 40% 20% 10% 5% 0 KRAS Wild-Type Plasmid 0 20% 40% 60% 80% 90% 95% 100
[0116] Result analysis:
[0117] As can be seen from Table 17: When the proportion of the KRAS-G12A mutant plasmid was 10% and the proportion of the wild-type KRAS plasmid was 90%, the kit could still detect the mutant result, indicating that the kit had a good effect in detecting low-concentration mutant samples.
[0118] Table 17 Detection Results of Proportion of KRAS-G12A Mutant Gene Series
[0119]
[0120] (Note: Negative is "-", positive is "+")
[0121] 3. Verification of the Specificity of the Kit
[0122] Verification of interfering substances: Since colorectal cancer samples are from the intestine, it is necessary to perform PCR amplification verification on common strains in the intestine to ensure that the amplification results are correct and not other interfering strains. DNA was extracted from Campylobacter jejuni bacterial solution, Bacillus subtilis bacterial solution, Enterobacter aerogenes bacterial solution, Proteus vulgaris bacterial solution, Enterococcus faecalis bacterial solution, Klebsiella pneumoniae bacterial solution, Escherichia coli bacterial solution, Candida albicans bacterial solution, and Staphylococcus aureus bacterial solution respectively. Through dilution adjustment, their respective concentrations were made 10 8 copies / mL.
[0123] Table 18 PCR Amplification Verification of Common Strains in the Intestine
[0124] Name Amplification Result Campylobacter jejuni - Bacillus subtilis - Enterobacter aerogenes - Proteus vulgaris - Enterococcus faecalis - Klebsiella pneumoniae - Escherichia coli - Candida albicans - Staphylococcus aureus - Positive Control +
[0125] (Note: Negative is "-", positive is "+")
[0126] According to the test results in Table 18, the kit does not cross-react with common interfering strains that may exist in the sample, indicating that the kit has strong specificity.
[0127] The above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention. The technologies, shapes, and structures not described in detail in the present invention are all well-known technologies.
Claims
1. A primer-probe set for detecting KRAS, NRAS, and BRAF genes in colorectal cancer, characterized in that, A primer-probe set for detecting a plurality of mutation sites of the KRAS, NRAS, and BRAF genes, wherein the mutation sites include: KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12S, KRAS G12V, KRAS G13D, NRAS G12D, NRAS Q61K, NRAS Q61R, BRAF V600E; Among them, the primer-probe set for detecting the KRAS gene includes: the forward primer has any one or more of the nucleotide sequences shown in SEQ ID NO.4 - SEQ ID NO.10; the reverse primer has the nucleotide sequence shown in SEQ ID NO.2; the specific probe has the nucleotide sequence shown in SEQ ID NO.3; the blocking primer has the nucleotide sequence shown in SEQ ID NO.1; and / or The primer-probe set for detecting the NRAS gene includes: the forward primer has any one or more of the nucleotide sequences shown in SEQ ID NO.13 and SEQ ID NO.18 - SEQ ID NO.19; the reverse primer has any one or more of the nucleotide sequences shown in SEQ ID NO.11 and SEQ ID NO.16; the specific probe has any one or more of the nucleotide sequences shown in SEQ ID NO.12 and SEQ ID NO.17; the blocking primer has any one or more of the nucleotide sequences shown in SEQ ID NO.14 - SEQ ID NO.15; and / or The primer-probe set for detecting the BRAF gene includes: the forward primer has the nucleotide sequence shown in SEQ ID NO.20; the reverse primer has the nucleotide sequence shown in SEQ ID NO.21; the specific probe has the nucleotide sequence shown in SEQ ID NO.22; the blocking primer has the nucleotide sequence shown in SEQ ID NO.
23.
2. The primer-probe set for detecting KRAS, NRAS, and BRAF genes in colorectal cancer according to claim 1, wherein Both ends of the nucleotide sequence of the specific probe are respectively carried with a fluorescent reporter group and a quenching group.
3. The primer-probe set for detecting KRAS, NRAS, and BRAF genes in colorectal cancer according to claim 2, wherein, The fluorescent reporter group is selected from one of FAM, VIC, ROX, HEX, Cy5, and Cy3, and the quenching group includes MGB.
4. A primer-probe set for detecting KRAS, NRAS, and BRAF genes in colorectal cancer according to claim 1, characterized in that, The 3' end of the nucleotide sequence of the blocking primer is labeled with one of an amino group, NH2-C7, and a phosphate group, and the nucleotide sequence of the blocking primer is modified with locked nucleic acid.
5. The primer-probe set for detecting KRAS, NRAS, and BRAF genes of colorectal cancer according to claim 1, characterized in that The primer-probe set further includes a primer-probe set for detecting an internal reference gene, and the internal reference gene includes GAPDH, ACTB, or β-globin.
6. The primer-probe set for detecting KRAS, NRAS, and BRAF genes of colorectal cancer according to claim 5, characterized in that, The primer-probe set for detecting the internal reference gene includes: a primer pair having the nucleotide sequences shown in SEQ ID NO.24 and SEQ ID NO.25; a specific probe having the nucleotide sequence shown in SEQ ID NO.
26.
7. Use of the primer-probe set according to any one of claims 1-6 in the preparation of a reagent or kit for detecting KRAS, NRAS, and BRAF genes.
8. A kit, characterized in that, Comprising the primer-probe set according to any one of claims 1-6.
9. A kit according to claim 8, characterized in that, Further comprising PCR reaction reagents; the PCR reaction reagents include dNTP, DNA polymerase, UNG enzyme, and PCR buffer.
10. Use of the primer-probe set according to any one of claims 1-6 in the preparation of a reagent for the auxiliary diagnosis of colorectal cancer.
Citation Information
Patent Citations
Method and kit for detecting colorectal cancer KRAS / NRAS / BRAF / PIK3CA genes
CN106755445A
Colorectal cancer diagnostic markers, PAP detection probe and colorectal cancer detection kit
CN113862364A
Cited By
Marker detection reagent for intestinal cancer gene mutation detection, kit and application
CN122128435A