Escherichia coli promoter library and application thereof

Abstract

The invention relates to an escherichia coli promoter library and application thereof. Escherichia coli is taken as a research object, enhanced green fluorescent protein (eGFP) is taken as a reporter gene, the expression of the reporter gene is started through the selected promoters, the promoters with different expression trends are screened out according to transcriptome data of response of strains to oxaloacetic acid (OAA) with different concentrations, a promoter library is constructed, and the promoter library is used for constructing a promoter library. And expression regulation elements of escherichia coli are enriched.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an Escherichia coli promoter library and its application. Background Art

[0002] As a model microbial strain, Escherichia coli is a common host in molecular biology; at the same time, it also has important applications in industrial fermentation. The regulation of gene expression in bacteria mainly occurs at the transcriptional level, and promoters play a key role in transcriptional regulation. A bacterial promoter refers to the DNA sequence region that can bind to RNA polymerase to initiate gene transcription, which is the core regulatory element for gene expression in bacteria and determines the intensity and timing of bacterial gene expression. Promoters are also the basis for constructing various expression systems to achieve heterologous gene expression and regulation. The research on the identification and application of promoters is of great significance for realizing the controllable expression of heterologous genes, effectively obtaining target products, and conducting metabolic engineering research. Oxaloacetic acid (OAA) plays an important role in L-threonine synthesis. As an intermediate in the TCA cycle, OAA is the direct precursor for L-threonine biosynthesis, not only participating in energy metabolism, but also affecting the process of L-threonine biosynthesis and transformation. Promoter engineering has been widely used to regulate gene expression and promote product synthesis, and has shown great application potential. In order to finely regulate the L-threonine synthesis pathway around OAA and establish an OAA-responsive synthesis pathway, it is very necessary to regulate L-threonine synthesis. Summary of the Invention

[0003] To solve the above technical problems, the present invention provides an Escherichia coli promoter library based on transcriptomic data. Based on the transcriptomic data of Escherichia coli's response to different concentrations of OAA, an Escherichia coli promoter library containing 104 promoters with different expression intensities is constructed.

[0004] The first object of the present invention is to provide an Escherichia coli promoter library, which includes promoters with sequences shown in SEQ ID NO.1 to SEQ ID NO.104.

[0005] Preferably, the promoters in the library are responsive to oxaloacetic acid.

[0006] The second object of the present invention is to provide the application of the above Escherichia coli promoter library in regulating the expression intensity of target genes in Escherichia coli.

[0007] Preferably, the target genes include eGFP gene, ppc gene and aspC gene.

[0008] The third object of the present invention is to provide the application of the above-mentioned Escherichia coli promoter library in biocatalysis, biorefining or metabolic engineering transformation.

[0009] The fourth object of the present invention is to provide an expression vector containing a promoter in the above-mentioned Escherichia coli promoter library.

[0010] Preferably, the expression vector is a vector suitable for expression in Escherichia coli.

[0011] The fifth object of the present invention is to provide an expression system containing a promoter in the above-mentioned Escherichia coli promoter library.

[0012] The sixth object of the present invention is to provide a metabolic regulation system containing a promoter in the above-mentioned Escherichia coli promoter library.

[0013] The seventh object of the present invention is to provide the application of the above-mentioned expression system in biocatalysis, biorefining or metabolic engineering transformation.

[0014] The eighth object of the present invention is to provide an Escherichia coli containing a promoter in the above-mentioned Escherichia coli promoter library.

[0015] Furthermore, the above-mentioned promoter can be used to construct expression systems with different responses. In the present invention, the promoter sequence is connected to eGFP, expressed in Escherichia coli and its strength is measured.

[0016] Furthermore, the construction method of the above-mentioned recombinant Escherichia coli includes the following steps:

[0017] (1) Construct a fusion expression cassette of the promoter and green fluorescent protein (eGFP)

[0018] Respectively obtain the 104 selected promoter sequences and the nucleic acid sequence of the target protein eGFP by PCR, and connect the promoter sequence to the front end of the eGFP nucleic acid sequence by fusion PCR.

[0019] (2) Construct a recombinant strain

[0020] Transform the above-mentioned gene fusion expression cassette into Escherichia coli to obtain recombinant Escherichia coli with different expression intensities of eGFP.

[0021] Furthermore, the expression level of eGFP is measured by transferring the recombinant strain cultured at 37 °C and 200 rpm into a fermentation medium and fermenting at 37 °C and 200 rpm.

[0022] By means of the above scheme, the present invention has at least the following advantages:

[0023] The present invention successfully constructed Escherichia coli carrying 104 different promoter sequences, including 53 OAA-induced promoters and 51 OAA-repressed promoters. Compared with the commonly used P trc promoter, this promoter library greatly enriches the synthetic biology elements and lays a foundation for the application of this strain in genetic engineering modification and foreign gene expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Shows the effect of oxaloacetic acid on the growth of the strain. (A) Strain growth under different concentrations of oxaloacetic acid; (B) Differentially expressed genes at 0.5 g / L OAA; (C) Differentially expressed genes at 2 g / L OAA; (D) KEGG enrichment at 0.5 g / L OAA; (E) KEGG enrichment at 2 g / L OAA.

[0025] Figure 2 Shows the effect of different promoters on the production performance of the strain. (A) L-threonine production regulated by different promoters for the aspC gene; (B) Cell growth (OD 600 ) regulated by different promoters for the aspC gene; (C) L-threonine production regulated by different promoters for the ppc gene; (D) Cell growth (OD 600 ) regulated by different promoters for the ppc gene. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] To enable those skilled in the art to better understand the solution of the present invention, the present invention will be further described in detail below with reference to the drawings and specific embodiments.

[0027] Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be obtained through commercial channels.

[0028] Example 1: Determination of Escherichia coli transcriptome data

[0029] Single colonies were picked from the Escherichia coli W3110 streaked plate and inoculated into LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, solvent is water), cultured at 37 °C and 200 rpm, and 0.5 and 2 g / L OAA were added respectively and cultured until the logarithmic phase, and the samples were collected for transcriptome sequencing.

[0030] Example 2: Construction of Escherichia coli promoter library

[0031] Based on the measured transcriptome data, according to the gene expression levels calculated by the FPKM (Fragments Per Kilo bases per Million reads) method, the gene expression conditions under different OAA concentrations were respectively counted, and the results are as Figure 1Taking ∣log2FC∣≥1 as the threshold for judging whether a gene has significant changes, 104 promoters with different expression trends were selected to construct a promoter library, including 53 induced by OAA and 51 inhibited by OAA.

[0032] Taking the constructed P yhjX promoter characterization plasmid as an example, using the Escherichia coli W3110 genome and eGFP synthesized by the whole gene (Genewiz Biotechnology Co., Ltd.) as templates, and using primers P yhjX -F / R and primers eGFP-F / R, the promoter sequence and the nucleic acid sequence of the target protein eGFP were obtained by PCR amplification. The promoter sequence was ligated to the front end of the eGFP nucleic acid sequence by fusion PCR to obtain a DNA fragment of the gene fusion expression cassette. Other promoters were amplified with the corresponding primers in Table 2.

[0033] The nucleotide sequence of enhanced green fluorescent protein (eGFP) is as follows:

[0034] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttca

[0035] gcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctgg

[0036] cccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccat

[0037] gcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgaca

[0038] ccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagc

[0039] cacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcag

[0040] ctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctg

[0041] agcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtac

[0042] aagtag。

[0043] The primers for amplifying the plasmid backbone and eGFP are shown in Table 1:

[0044] Table 1 Primers for the backbone and eGFP

[0045] Primer Name Primer Sequence (5’-3’) pACYC-F tgtacaagtaaaataactagcataaccccttggg pACYC-R acttcaggtgctacatttgaagag eGFP-F gtttaactttaagaaggagatatacatatggtgagcaagggcgaggagct eGFP-R tgctagttattttacttgtacagctcgtccatgcc

[0046] The primers for amplifying each promoter are shown in Table 2:

[0047] Table 2 Promoter primers

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056] The DNA fragment of the above gene fusion expression cassette and the linear plasmid of Escherichia coli were used to construct a plasmid by homologous recombination (amplified using pACYC-Duet as a template, purchased from Novagen, and amplified with pACYC-F / R primers), and then recombinant Escherichia coli with different expression trends of eGFP was obtained. Transformants were selected for colony PCR to verify the successful construction of the recombinant Escherichia coli. Each recombinant bacterium was cultured at 37 °C and 200 rpm, and the fluorescence intensity was measured.

[0057] The results are shown in Tables 3 and 4. Table 3 is the Escherichia coli promoter library composed of promoters with different expression intensities, and Table 4 is the intensity of each promoter in the promoter library. The promoters P yhjX -P gcvP have sequences as shown in SEQ ID NO.1 to SEQ ID NO.104.

[0058] Table 3 Promoter Sequences

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081] Table 4 Promoter Strength

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Example 3: Application of Promoter Library in the Regulation of L-Threonine Anabolic Metabolism

[0088] Twenty promoters induced by OAA and twenty promoters repressed by OAA were respectively selected to regulate the key genes ppc (Gene ID: 948457) and aspC (Gene ID: 945553) for OAA synthesis and utilization, with the strong promoter P commonly used in metabolic engineering trcAs a control, using the pCDF-Duet plasmid (purchased from Novagen) as a template, the plasmid backbone was amplified with primers pCDF-F / R; using the Escherichia coli W3110 genome as a template, the ppc gene and the aspC gene were amplified with ppc-F / R and aspC-F / R respectively to construct the plasmid pCDF-ppc-aspC, which was introduced into the WS000 strain from the literature (Su B, Lai P, et al. Bioresour Technol, 2024) to construct the strain WA00. For the regulation of the aspC gene, first using pCDF-ppc-aspC as a template, the plasmid backbone was amplified with primers pCDF-ppc-aspC-F / R, and the corresponding promoter primers in Table 5 were used to amplify the promoters respectively using the W3110 genome as a template to construct the strains WA01-WA20; for the regulation of the ppc gene, first using pCDF-ppc-aspC as a template, the plasmid backbone was amplified with primers pCDF-ppc-F / R, and the corresponding promoter primers in Table 5 were used to amplify the promoters respectively using the W3110 genome as a template to construct the strains WA21-WA40 to investigate the effects of different regulatory elements on L-threonine synthesis. The results showed ( Figure 2 ), the production performance of most strains was improved. WN00 is pCDF-Duet, WA00 is promoter P trc , WA01 is P pgi promoter, WA02 is P hdeD promoter, WA03 is P ribB promoter, WA04 is P ompT promoter, WA05 is P hdeA promoter, WA06 is P adiA promoter, WA07 is P gadE promoter, WA08 is P ahpC promoter, WA09 is P ompA promoter, WA10 is P yiiS promoter, WA11 is P copA promoter, WA12 is P nadE promoter, WA13 is P zwf promoter, WA14 is P aroG promoter, WA15 is P yecR promoter, WA16 is P yhjX promoter, WA17 is P dps promoter, WA18 is P infA promoter, WA19 is P tsx promoter, WA20 is P ptsH promoter. WA21 is P tisB promoter, WA22 is P zinT promoter, WA23 is P glnHPromoter, with WA24 being P gcvP Promoter, with WA25 being P glgS Promoter, with WA26 being P cstA Promoter, with WA27 being P rmf Promoter, with WA28 being P ylaC Promoter, with WA29 being P cpxP Promoter, with WA30 being P ygeW Promoter, with WA31 being P degP Promoter, with WA32 being P uspF Promoter, with WA33 being P putP Promoter, with WA34 being P katG Promoter, with WA35 being P hns Promoter, with WA36 being P dppA Promoter, with WA37 being P aceB Promoter, with WA38 being P iraP Promoter, with WA39 being P yfiS Promoter, with WA40 being P yahO Promoter. Among them, strain WA38 was increased by 7.7 times based on the control strain WN00, indicating that the idea of regulating the L-threonine synthesis pathway using OAA-responsive regulatory elements is feasible.

[0089] Table 5 ppc and aspC regulatory primers

[0090]

[0091]

[0092]

[0093]

[0094] The above are only the preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limitations on the present invention. The protection scope of the present invention should be defined by the scope of the claims. For those of ordinary skill in the art, without departing from the spirit and scope of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An Escherichia coli promoter library, characterized in that, The promoter library includes promoters with sequences shown in SEQ ID NO.1 to SEQ ID NO.

104.

2. The Escherichia coli promoter library according to claim 1, wherein The promoters in the library are responsive to oxaloacetic acid.

3. Use of the Escherichia coli promoter library according to claim 1 or 2 in regulating the expression intensity of a target gene in Escherichia coli.

4. The application according to claim 3, wherein The target gene includes the eGFP gene, the ppc gene, and the aspC gene.

5. Use of the Escherichia coli promoter library according to claim 1 or 2 in biocatalysis, biofermentation, or metabolic engineering modification.

6. An expression vector containing a promoter in the Escherichia coli promoter library according to claim 1 or 2.

7. The expression vector according to claim 6, characterized in that, The expression vector is a vector suitable for expression in Escherichia coli.

8. An expression system containing a promoter in the Escherichia coli promoter library according to claim 1 or 2.

9. A metabolic regulation system containing a promoter in the Escherichia coli promoter library according to claim 1 or 2.

10. Use of the expression system according to claim 8 in biocatalysis, biofermentation, or metabolic engineering modification.

Images