HPDP polypeptide, coding gene thereof, polypeptide preparation and application of HPDP polypeptide and coding gene thereof

The HPDP polypeptide inhibits the HNRNP/PD-L1 axis, and the lack of inhibition of HNRNP/PD-L1 axis in the prior art is solved, effectively treating hepatocellular carcinoma, enhancing immune response and inhibiting tumor growth.

CN120383656APending Publication Date: 2025-07-29THE SECOND AFFILIATED HOSPITAL OF NANJING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510485937.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-07-29

Smart Images

  • Figure CN120383656A_ABST
    Figure CN120383656A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biotechnology and biomedicine, and discloses an HPDP polypeptide, a coding gene thereof, a polypeptide preparation and applications of the HPDP polypeptide and the coding gene and the polypeptide preparation. The amino acid sequence of the HPDP polypeptide is as shown in SEQ ID NO.1, codon optimization is performed on the amino acid sequence as shown in SEQ ID NO.1, and the nucleotide sequence of the optimized coding gene is as shown in SEQ ID NO.2. The HPDP polypeptide can significantly inhibit the proliferation, migration and invasion ability of cancer cells, increase the proportion of CD8 + T cells and inhibit tumor growth by inhibiting the HNRNP / PD-L1 axis, and has good medical prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and biomedicine, and particularly relates to an HPDP polypeptide, its encoding gene, a polypeptide preparation, and their applications. Background Art

[0002] The definition of immune escape is to avoid the recognition and destruction of the immune system, and it is increasingly regarded as one of the hallmarks of cancer. The interaction between programmed death ligand 1 (PD-L1) on the surface of cancer cells and programmed death protein 1 (PD-1) on the surface of T cells leads to T cell inhibition, thereby preventing further immune rejection and avoiding immune surveillance. Immunotherapy, especially immune checkpoint inhibitors (ICIs) targeting the PD-L1 / PD-1 interaction, has changed the clinical treatment response of various solid tumors. However, the high expression of PD-L1 on tumor cells inhibits the anti-tumor response, resulting in immune tolerance in hepatocellular carcinoma (HCC). Therefore, revealing the regulatory mechanism of PD-L1 in liver cancer cells and developing novel small molecule inhibitors targeting PD-1 / PD-L1 will greatly promote the identification of biomarkers and the formulation of effective immunotherapy strategies.

[0003] HNRNPC (Heterogeneous nuclear ribonucleoprotein C) is a member of the hnRNP family. It is an RNA-binding protein that associates with nascent RNA transcripts and regulates the stability, splicing, translocation, and translation of mRNA in eukaryotic cells. By recognizing m6A modification, HNRNPC can change the secondary structure of RNA, thereby selectively regulating the abundance and splicing of mRNA. The ubiquitination modification site located on the lysine residue within the coiled-coil domain is related to the process of selective viral RNA splicing. New evidence indicates that HNRNPC plays a key role in disease progression by regulating gene expression. For example, HNRNPC knockdown has been shown to prevent the occurrence of breast cancer by stimulating type I interferon response. In addition, HNRNPC can reshape the immunosuppressive microenvironment of prostate cancer and cause Treg cell infiltration and T cell exhaustion. Notably, our previous study showed that in HCC patients, the low-expression group and high-expression group of HNRNPC exhibited different levels of immune cell infiltration, and for the first time, the correlation between HNRNPC and PD-L1 was revealed. Given the close relationship between HNRNPC and the immune microenvironment, further research on its role in driving anti-tumor immunity may help discover new targets for HCC immunotherapy. Currently, there is no existing technology that can effectively guide the inhibition method of the HNRNP / PD-L1 axis. Therefore, developing novel small molecule inhibitors targeting the HNRNP / PD-L1 axis is of great significance. Summary of the Invention

[0004] The object of the present invention is to overcome the problem in the prior art that there is no effective guidance for the inhibition method of the HNRNP / PD-L1 axis in any existing technology, and to provide an HPDP polypeptide, its coding gene, a polypeptide preparation, and their applications. By inhibiting the HNRNP / PD-L1 axis, this HPDP polypeptide can significantly inhibit the proliferation, migration, and invasion abilities of cancer cells, increase the proportion of CD8 + T cells, and inhibit tumor growth, showing good medical prospects. To achieve the above object, on the one hand, the present invention provides a polypeptide, which is the polypeptide described in (a) or (b):

[0005] (a) A polypeptide with the amino acid sequence shown in SEQ ID NO.1;

[0006] (b) A derivative polypeptide obtained by modifying the polypeptide with the amino acid sequence shown in SEQ ID NO.1 and having the same activity as before the modification.

[0007] Preferably, the modification includes:

[0008] i. Performing at least one of substitution, deletion, and addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID NO.1; and / or

[0009] ii. Connecting a tag facilitating purification at the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO.1; and / or

[0010] iii. Connecting a signal peptide sequence facilitating the secretion and expression of the polypeptide at the amino terminus of the amino acid sequence shown in SEQ ID NO.1;

[0011] Preferably, the tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc, and more preferably Poly-His.

[0012] On the second aspect, the present invention provides a gene encoding the polypeptide, which has a nucleotide sequence encoding the polypeptide as described above.

[0013] Preferably, the gene is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1.

[0014] Preferably, the gene is the nucleotide sequence shown in SEQ ID NO.2.

[0015] On the third aspect, the present invention provides a polypeptide preparation, which contains the polypeptide as described above.

[0016] The fourth aspect of the present invention provides the use of at least one of the polypeptide as described above, the gene as described above, and the polypeptide preparation as described above in the preparation of a drug.

[0017] Preferably, the drug is a drug for enhancing the binding affinity between HNRNPC and PD-L1.

[0018] Preferably, the drug is an anti-tumor disease drug.

[0019] More preferably, the anti-tumor disease drug is at least one of a drug for inhibiting cancer cell proliferation and / or invasion and metastasis, a drug for enhancing immune cell regulation, and a drug for inhibiting in vivo tumor growth.

[0020] Preferably, the tumor disease is liver cancer.

[0021] The fifth aspect of the present invention provides a pharmaceutical composition, which contains the polypeptide as described above and / or the polypeptide preparation as described above.

[0022] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient, carrier, solvent, or a combination thereof.

[0023] Preferably, the excipient is selected from at least one of diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, wetting agents, emulsifiers, chelating agents, antioxidants, preservatives, stabilizers, and coating agents.

[0024] Through the above technical solutions, the polypeptide provided by the present invention can significantly reduce the level of PD-L1. By inhibiting the HNRNP / PD-L1 axis, it can significantly inhibit the proliferation and invasion ability of cancer cells, increase the proportion of CD8 + T cells, and inhibit tumor growth, having good medical prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the diagram of panning, amplification, purification, sequencing, and synthesis of HPDP polypeptide using phage display technology and NGS sequencing in Example 1;

[0026] Figure 2 is the product elution diagram in Example 1;

[0027] Figures 3 to 5 is the competitive EC50 detection and identification diagram of 7 specific polypeptides and HNRNPC protein in Example 2;

[0028] Figure 6 In which A is the curve fitting diagram of the relationship between the HPDP concentration and the absorbance value (OD 450nm ) in Example 2; Figure 6In Figure B, the expression levels of PD-L1 and HNRNPC proteins in two human hepatocellular carcinoma cell lines (Huh7 and Hep3B) treated with 7 polypeptide samples were detected; Figure 6 In Figure C, the binding affinity evaluation diagram of HPDP with HNRNPC and PD-L1;

[0029] Figure 7 In Figure A, the immunoprecipitation experiment diagram of the inhibition of the HNRNP / PD-L1 axis by HPDP in Example 3; Figure 7 In Figures B and C, the experimental diagrams of the related effects of HPDP on Huh7 cells; Figure 7 In Figures D and E, the diagrams of the effect of HPDP on the proliferation cycle of T cells in HCC and the inhibitory effect on migration;

[0030] Figure 8 In Figures A and B, the schematic diagrams of direct injection into subcutaneous tumors / orthotopic tumors in mice in Example 4; Figure 9 In Figures C-F, the effect diagrams of subcutaneous tumors, body weight, volume and survival after HPDP treatment; Figure 10 In Figure G, the effect diagram of detecting the expression of PD-L1 in subcutaneous tumors by IHC; Figure 10 In Figures H-J, the effect diagrams of orthotopic inoculated tumors, body weight and survival after HPDP treatment; Figure 10 In Figure K, the effect diagram of detecting the expression of PD-L1 in orthotopic inoculated tumors by IHC;

[0031] Figure 11 It is the flow cytometer analysis diagram of the effect of HPDP on immune cells in Example 5;

[0032] Figure 12 It is the hematoxylin-eosin (H&E) staining observation diagram in Example 6. Detailed implementation manners

[0033] The endpoints and any values within the ranges disclosed herein are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0034] The first aspect of the present invention provides a polypeptide, which is the polypeptide described in (a) or (b):

[0035] (a) A polypeptide with the amino acid sequence shown in SEQ ID NO.1;

[0036] (b) A derivative polypeptide obtained by modifying the polypeptide with the amino acid sequence shown in SEQ ID NO.1 and having the same activity as before the modification.

[0037] The polypeptide provided by the present invention may be a derivative polypeptide obtained by modifying the above polypeptide in any existing manner in the art under the condition of the same activity. There are no specific limitations on the modification method, the specific sequence and characteristics of the modified derivative polypeptide.

[0038] According to a preferred embodiment of the present invention, the modification may include:

[0039] i. Performing at least one of substitution, deletion, and addition on one or several amino acid residues in the amino acid sequence shown in SEQ ID NO.1; and / or

[0040] ii. Connecting a tag facilitating purification to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO.1; and / or

[0041] iii. Connecting a signal peptide sequence beneficial to the secretion and expression of the polypeptide to the amino terminus of the amino acid sequence shown in SEQ ID NO.1.

[0042] The polypeptide provided by the present invention can be obtained by treating the amino acid sequence shown in SEQ ID NO.1 through any one or several combinations of the above modification methods i, ii, and iii, as long as the modified derivative polypeptide has the same activity as the amino acid sequence shown in SEQ ID NO.1.

[0043] Any existing tag in the art that can facilitate the purification of the polypeptide can be applied to the HPDP polypeptide provided by the present invention. Preferably, the tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc. There are no specific limitations on the specific amino acid sequence of the above tags. For example, it may be the sequence shown in Table 1 below.

[0044] Table 1 Sequences of tags facilitating purification

[0045]

[0046]

[0047] *Poly-Arg may consist of 5 - 6 arginine residues. Only the Poly-Arg tag composed of 5 arginine residues commonly used is listed in Table 1, but the Poly-Arg tag composed of 6 arginine residues is also applicable to the present invention.

[0048] **Poly-His can be composed of 2-10 histidine residues. Only the Poly-His tag composed of 6 histidine residues commonly used is listed in Table 1, but the Poly-His tags composed of 2-10 histidines are all applicable to the present invention.

[0049] Any signal peptide sequence existing in the art that can facilitate the secretion and expression of polypeptides can be applicable to the HPDP polypeptide provided by the present invention. Preferably, the signal peptide sequence has a basic amino terminus, a middle hydrophobic sequence, or a longer negatively charged C terminus.

[0050] In the present invention, through phage display technology, polypeptides specifically binding to the target are screened out, and HPDP polypeptides that can significantly reduce the level of PD-L1 are screened out. By inhibiting the HNRNPC / PD-L1 axis, the HPDP polypeptides can significantly inhibit the proliferation and invasion ability of cancer cells, increase the proportion of CD8 + T cells, and inhibit tumor growth, showing good medical prospects.

[0051] The polypeptides described in the present invention are obtained by well-known methods in the prior art. They can be chemically synthesized using a polypeptide synthesizer, or the nucleotide sequence can be deduced from the short peptide sequence and then cloned into a vector for biosynthesis, or they can be extracted and purified in large quantities from existing organisms. The synthesis of the HPDP polypeptides described in the present invention is entrusted to Nanjing Taopu Biotechnology Co., Ltd. for implementation.

[0052] In the present invention, the separation and purification can adopt conventional polypeptide separation methods in the art. In the present invention, the polypeptide preparation is purified and separated multiple times using a conventional cation exchange chromatography column kromasil C18-5 in the art. The specific operation is entrusted to Nanjing Taopu Biotechnology Co., Ltd. for implementation. The second aspect of the present invention provides a gene encoding a polypeptide, and this gene has a nucleotide sequence encoding the polypeptide as described above.

[0053] According to the present invention, preferably, the gene is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1.

[0054] According to the present invention, preferably, the gene has the nucleotide sequence shown in SEQ ID NO.2. In the present invention, the gene can only contain the sequence shown in SEQ ID NO.2, or it can be a DNA molecule with the sequence shown in SEQ ID NO.2 as the coding region and additionally adding other components. The other components can include any components required in the art for artificially synthesizing gene sequences and expressing them through expression vectors, such as promoters, enhancers, Kozak sequences, etc.

[0055] The amino acid sequence shown in SEQ ID NO.1 as described above and the nucleotide sequence shown in SEQ ID NO.2 as described above are shown in Table 2;

[0056] Table 2

[0057] Sequence Number TNYASMSAKGST SEQ ID NO.1 AGTCGAACCCTTAGCAGACATAGAAGCATAATTAGT SEQ ID NO.2

[0058] The nucleotide sequences provided by the present invention can generally be obtained by polymerase chain reaction (PCR) amplification, recombination, or artificial synthesis methods. Once the relevant nucleotide sequences are obtained, the relevant amino acid sequences can be obtained in large quantities by recombination methods. In addition, the relevant nucleotide sequences can also be synthesized by well-known artificial chemical synthesis methods. The nucleotide sequence shown in SEQ ID NO.2 of the present invention was commissioned to Nanjing Taopu Biotechnology Co., Ltd. for synthesis.

[0059] The third aspect of the present invention provides a polypeptide preparation, which contains the polypeptide as described above.

[0060] In the present invention, the polypeptide can be made into corresponding polypeptide preparations. Specifically, the polypeptide preparations can exist in solid, semi-solid or liquid forms. The polypeptide preparations can contain excipients or additives for preparing polypeptide preparations, etc., which can be selected by those skilled in the art according to needs and will not be elaborated here.

[0061] Based on the polypeptide provided by the present invention, it can significantly inhibit the proliferation and invasion ability of cancer cells, increase the immune ability, and inhibit tumor growth by inhibiting the HNRNPC / PD-L1 axis. The fourth aspect of the present invention provides the application of at least one of the polypeptide as described above, the gene as described above, and the polypeptide preparation as described above in the preparation of drugs.

[0062] According to the present invention, preferably, the drug is a drug that improves the binding affinity of HNRNPC and PD-L1. The polypeptide provided by the present invention blocks the binding effect of HNRNPC (Heterogeneous nuclear ribonucleoprotein C) and programmed death ligand 1 (PD-L1) on the surface of cancer cells by reducing the binding affinity of HNRNPC and PD-L1, and improves the anti-cancer effect of the drug.

[0063] According to the present invention, preferably, the drug is an anti-tumor disease drug. Further preferably, the anti-tumor disease drug is at least one of a drug that inhibits the proliferation and / or invasion and metastasis of cancer cells, a drug that enhances the regulation of immune cells, and a drug that inhibits the growth of tumors in vivo.

[0064] According to the present invention, the tumor disease is selected from any one of liver cancer, rectal cancer, colon cancer, breast cancer, cholangiocarcinoma, glioma, endometrial cancer, lung cancer, and gastric adenocarcinoma. Preferably, the tumor disease is liver cancer.

[0065] The fifth aspect of the present invention provides a pharmaceutical composition, which contains the polypeptide and / or the polypeptide preparation as described above.

[0066] According to the present invention, preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient, carrier, solvent, or a combination thereof.

[0067] According to the present invention, preferably, the excipient is selected from at least one of diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, wetting agents, emulsifiers, chelating agents, antioxidants, preservatives, stabilizers, and coating agents.

[0068] The present invention will be described in detail below through examples.

[0069] In the following examples, PBST buffer was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; ER2738 host bacteria and the prefabricated peptide library mother liquor were purchased from Tianjin Cemed BioScience Co., Ltd.; Biotin-PDL1 was purchased from Tianjin Cemed BioScience Co., Ltd.; mice were purchased from Jicuiyaokang Biotechnology Co., Ltd. The remaining reagents and raw materials were all conventional commercially available products.

[0070] Example 1

[0071] This example illustrates the synthesis of HPDP polypeptide.

[0072] 1. Use the peptide phage display library for primary screening. (The flow chart of screening, amplifying, purifying, sequencing, and synthesizing HPDP polypeptide using phage display technology and NGS sequencing is as Figure 1 shown)

[0073] (1) Antigen coating: Using PBS as the coating buffer, dilute the HNRNPC protein / antigen, and coat 5 μg / well in 4 wells on the enzyme-linked immunosorbent assay (ELISA) plate, coat overnight at 4°C or for 2 h at 37°C;

[0074] (2) Blocking: Invert the ELISA plate containing the HNRNPC protein on a clean paper towel, tap it forcefully to remove the residual solution, add 400 μL of blocking solution, and let it stand at room temperature for 1 h;

[0075] (3) Washing: Invert the ELISA plate filled with the blocking solution on a clean paper towel, and vigorously tap to remove the residual solution. Then, quickly wash the plate with 200 μL of 0.01 M PBST buffer (phosphate-buffered saline-Tween buffer) (manually shake the plate each time after adding PBST to ensure that the bottom and edges of the wells are washed). Pour out the buffer, invert the plate on a clean paper towel, and vigorously tap to remove the residual solution. Repeat this process 3 times.

[0076] (4) Coating the prefabricated peptide library stock solution: Mix 90 μL of 0.01 M PBS buffer and 10 μL of the peptide library stock solution, and add the mixture to the washed wells. Shake on an ELISA plate shaker at room temperature for 1 h.

[0077] (5) Washing: Use a pipette to aspirate the liquid in the wells of the ELISA plate coated with the peptide library stock solution and transfer it to a 1.5 mL centrifuge tube (sterilized in advance). Invert the ELISA plate on a clean paper towel, and vigorously tap to remove the residual solution. Then, quickly wash the plate with 200 μL of 0.01 M PBST buffer (manually shake the plate each time after adding PBST to ensure that the bottom and edges of the wells are washed). Pour out the buffer, invert the plate on a clean paper towel (change to a clean paper towel each time to prevent cross-contamination), and vigorously tap to remove the residual solution. Repeat this process 5 times.

[0078] (6) Eluting the product: Add 200 μL of elution buffer (Tris-Hcl with pH 3.0) to the wells of the eluted ELISA plate, and shake at room temperature on an ELISA plate shaker for 10 min. Transfer the elution buffer to a 1.5 mL centrifuge tube, and add 15 μL of Tris-Hcl with pH 8.0 to neutralize the eluate, which is the first-round elution product (as shown in A in the first-round product elution diagram), and store it at 4°C. (The first-round elution product contains phages that have a certain binding ability to the antigen (HNRNPC protein), and the polypeptides carried by these phages are potentially polypeptides that can specifically bind to the antigen). Figure 2 as shown in A), and store it at 4°C. (The first-round elution product contains phages that have a certain binding ability to the antigen (HNRNPC protein), and the polypeptides carried by these phages are potentially polypeptides that can specifically bind to the antigen).

[0079] 2. Concentration and purification of phage particles (the above first-round elution product)

[0080] (1) Activating ER2738 host bacteria: Take two 10 mL centrifuge tubes, pour 3 mL of LB liquid medium into them, add 3 μL of 100 mg / mL tetracycline. Add a single colony picked from the ER2738 plate to one of the tubes, and use the other tube as a blank control. Culture them in a shaker at 37°C and 210 rpm for 4 h.

[0081] (2) Infection: Take a 10 mL centrifuge tube, add 200 μL of activated ER2738 and 20 μL of the first-round elution product, and incubate at 37°C for 1.5 h.

[0082] (3) Add the infected bacterial solution into a 200 mL conical flask containing about 30 mL of LB liquid medium, and culture it in a shaker at 37 °C and 250 rpm for 4.5 h (foam appears and does not dissipate in a short time);

[0083] (4) Take out the medium and transfer it into a 50 mL (sterile) centrifuge tube, centrifuge at 6000 rpm for 10 min; transfer the supernatant into another 50 mL centrifuge tube, add 1 / 5 volume of (polyethylene glycol 6000) PEG6000 + NaCl, seal it in a bag, and place it at 4 °C for precipitation overnight;

[0084] (5) Take out the centrifuge tube from 4 °C, centrifuge at 6000 rpm for 20 min; discard the supernatant (pour the supernatant into a waste tube and seal it), and dissolve the precipitate with 1 mL of PBS;

[0085] (6) Centrifuge at 12000 rpm for 5 min, transfer the supernatant into another 1.5 mL centrifuge tube, add 1 / 5 volume of PEG6000 + NaCl, seal it in a bag, and precipitate at 4 °C for 1 h (it can also be precipitated overnight, but at least precipitate for 1 h);

[0086] (7) Centrifuge at 12000 rpm for 10 min, discard the supernatant (pour the supernatant into a waste tube and seal it), and dissolve the precipitate with 200 μL of PBS;

[0087] (8) Centrifuge at 12000 rpm for 10 min, transfer the supernatant into another 1.5 mL centrifuge tube, which is the amplified phage / the product of the first round of enrichment (its core component is the phage with a certain binding ability to the target antigen (HNRNPC protein)), and store it at 4 °C.

[0088] 3. Titer determination of the concentrated phage particle product

[0089] (1) Activate the ER2738 host bacteria: Take two 10 mL centrifuge tubes, pour 3 mL of LB liquid medium into them, add 3 μL of 50 mg / mL tetracycline. Add a single colony picked from the ER2738 streaked plate (used within one week after streaking) into one tube, and use the other tube as a blank control. Culture them in a shaker at 37 °C and 250 rpm until OD 600 = 0.3 - 0.4;

[0090] (2) Dilute the enrichment product: Take a sterile 1.5 mL centrifuge tube, add 180 μL of low-salt LB liquid medium into it respectively. Add 20 μL of the enrichment product into the first tube and mix well; Take out 20 μL from the first tube and add it into the second tube, mix well, and then take out 20 μL from the second tube and add it into the third tube, mix well, and so on.

[0091] (3) Infection: Place the lower layer of gel in a pre-warmed state at 37°C in the dark. Take a 10 mL sterile centrifuge tube and add 200 μL of ER2738 bacterial solution with OD 600 = 0.3 - 0.4, and 200 μL of the diluted elution product (one tube for each dilution). Incubate in a shaker at 37°C and 150 rpm for 1.5 h;

[0092] (4) Pouring the plate (operating in the dark): According to the preparation method of the upper layer of gel, dissolve the low-salt LB solid medium (prepared with agarose), cool it to 60°C, add X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) with a final concentration of 40 μg / mL and IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 1 mM, and mix well. At the same time, take a beaker or glass cylinder and add an appropriate amount of hot water. When the upper layer of gel cools to about 37°C and the hot water cools to about 45°C, pour the bacterial solution in the 10 mL tube into 3 - 4 mL of the upper layer of gel, quickly tap the bottom of the tube on the table to mix evenly, insert it into the 45°C warm water, and mix at most 6 tubes each time (if more, the temperature drops and the upper layer of gel is likely to solidify in the centrifuge tube). Tap the bottom of the tube on the table again to mix evenly, quickly pour it onto the lower layer of gel plate, place it upright in the dark for 10 min, then invert it and place it in a 37°C incubator for overnight incubation in the dark;

[0093] (5) Observe the next day to see if blue plaques appear (the appearance of blue plaques on the plate means that the bacteria on the plate contain phages expressing β-galactosidase. By observing the number of blue plaques, researchers can perform plaque counting, and then calculate the phage titer to evaluate the number and activity of phages);

[0094] (6) Repeat steps 4.2 - 4.5 to complete the subsequent experiments: Second-round elution (as shown in B in Figure 2 ) → Titration of the second-round elution product → Second-round enrichment → Titration of the second-round enrichment product → Third-round elution (as shown in C in Figure 2 ) → Titration of the third-round elution product (Multiple rounds of screening can expand the scope and depth of screening, allowing more phages with different sequences to participate in the screening process, and thus it is possible to obtain more types of specific polypeptide sequences). As Figure 2 shows, the elution titer of the first-round elution product is 5.5×10 5 PFU / mL, the elution gradient of the second-round elution product is 6.5×10 7 PFU / m, and the elution gradient of the third-round elution product is 6.3×10 9PFU / mL, which indicates that as the number of elution rounds increases, the number of phages in the eluate rises significantly, meaning that phages specifically binding to the antigen are effectively enriched. Since the washing step before each round of elution removes unbound or weakly bound phages, and the phages that can remain and be detected in subsequent elutions are mostly those with stronger antigen-binding ability, the increase in their number proves that the screening process is continuously enriching the target phages (which can specifically bind to the HNRNPC protein). The data of screening the dodecapeptide library using the HNRNPC protein as the antigen are shown in Table 3;

[0095] Table 3

[0096]

[0097] "Input (pfu)" in Table 3 is the number of phages added in each round of screening (in units of pfu, where pfu is plaque-forming unit); "output (pfu)" is the number of phages eluted after each round of screening; "O / I" is the ratio of the number of phages eluted to the number of phages added, which is used to measure the enrichment efficiency of the screening process for phages specifically binding to the antigen. It can be seen that as the number of screening rounds increases, both the output phage number and the O / I value increase significantly, indicating that each round of screening enriches phages specifically binding to the HNRNPC protein, and the screening effect enhances round by round.

[0098] 4. A total of 80 monoclonal colonies were picked from the plates after three rounds of screening and entrusted to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The sequencing primer was the reverse primer of 96II (the primer sequence is CCCTCATAGTTAGCGTAACG), and a total of 7 specific sequences were obtained. Except for the amino acid sequence shown in SEQ ID NO.1 and the corresponding nucleotide sequence (as shown in SEQ ID NO.2) in Table 2, the amino acid sequences corresponding to the other 6 specific sequences are shown in Table 4;

[0099] Table 4

[0100] Sequence Number SLTSGNASPILL SEQ ID NO.8 LGQTNMDVMREF SEQ ID NO.9 GYSPAIVVGNHS SEQ ID NO.10 NYLPDFFYYGRT SEQ ID NO.11 GPSTVSHPLRVL SEQ ID NO.12 TIPNLTRVSNIV SEQ ID NO.13

[0101] 5. The polypeptides corresponding to the 7 specific sequences were entrusted to Nanjing Taopu Biotechnology Co., Ltd. for solid-phase synthesis, and the HNRNPC protein was entrusted to Carmed Biotechnology (Tianjin) Co., Ltd. for genetic engineering expression; among them, the polypeptide with the amino acid sequence shown in SEQ ID NO.1 is 4607 naked peptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.3 is 4599 naked peptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.4 is 4601 naked peptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.5 is 4603 naked peptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.6 is 4605 naked peptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.7 is 4609 naked peptide, and the polypeptide with the amino acid sequence shown in SEQ ID NO.8 is 4611 naked peptide.

[0102] Example 2

[0103] This example illustrates the binding assay of the 7 polypeptides prepared in Example 1 with HNRNPC protein and PD-L1.

[0104] The present invention entrusted Carmed to conduct competitive EC50 identification and competitive ELISA detection identification on HNRNPC recombinant protein and 8 polypeptide molecules (7 polypeptides prepared in Example 1 and control polypeptide Biotin-PDL1).

[0105] The results of the competitive EC50 identification are as Figures 3 to 5 shown. In the competitive binding experiment, the lower the EC50 value, the stronger the competitive binding ability of the polypeptide with the HNRNPC protein. Among the polypeptides prepared in Example 1, the 4607 polypeptide (hereinafter referred to as HPDP) has the strongest competitive binding ability with the HNRNPC protein.

[0106] The curve fitting diagram of the relationship between the concentration of HPDP (4607 polypeptide) and the absorbance value (OD 450nm ) is as shown in A of Figure 6 . It can be seen from the figure that the optimal concentration of HPDP is determined to be 976.69 nM.

[0107] Figure 6 B in

[0108] Figure 6 shows the expression of PD-L1 and HNRNPC protein in two human hepatocellular carcinoma cell lines (Huh7 and Hep3B) treated with the 7 polypeptide samples prepared in Example 1, with GAPDH as the internal reference protein. It can be seen from the figure that in the experimental group, HPDP (4607 polypeptide, the polypeptide with the amino acid sequence shown in SEQ ID NO.1) can significantly reduce the level of PD-L1.Figure C shows the evaluation of the binding affinity of HPDP with HNRNPC and PD-L1, and the binding affinities are -8.6 kcal / mol and -2.7 kcal / mol respectively.

[0109] The following HPDPs are all polypeptides (4607 polypeptide) with the amino acid sequence shown in SEQ ID NO.1 screened in this example.

[0110] Example 3

[0111] This example illustrates the effect of HPDP on the proliferation and invasion ability of liver cancer T cells.

[0112] The inhibitory effect of HPDP on the HNRNP / PD-L1 axis was demonstrated by immunoprecipitation experiments, and the experimental results are as shown in Figure 7 Figure A in. This figure is mainly used to study whether there is an interaction between PD-L1 and HNRNPC proteins. Among them, the "IP: Myc" part in the figure indicates immunoprecipitation using an antibody against the Myc tag to detect the proteins that interact with the Myc-tagged fusion protein (Myc-HNRNPC), and the interaction with Flag-PD-L1 is judged by the "Flag" band; the "Input" part is the cell lysate sample before precipitation, which is used as a control to show the original expression of each protein; "GAPDH" is an internal reference protein used to standardize the sample loading amount. From Figure 7 the immunoprecipitation experiment in Figure A, it can be seen that HPDP can reduce the binding of HNRNPC to PD-L1 and weaken the expression of PD-L1 protein induced by overexpression of HNRNPC.

[0113] Figure 7 Figures B and C in show the experimental diagrams of the related effects of HPDP on Huh7 cells. Figure 7 Figure B in studies the changes in the concentration of human interferon γ (IFN-γ) related to Huh7 cells under different treatments (conditions such as Vector, HPDP, co-culture with T cells, etc.) to explore the effect of HPDP and its interaction with T cells on the secretion of IFN-γ. ("Vector" usually refers to the vector control group, which is a DNA molecule that does not carry a target gene with a specific function (here relative to HPDP) and is used to compare with the experimental group (such as the HPDP treatment group) to observe and analyze the effect of HPDP on the secretion of human IFN-γ by Huh7 cells. Generally, it can maintain basic biological processes in cells but will not produce special effects brought by the introduction of specific functional genes.). From Figure 7As can be seen from Figure B, when Huh7 cells were treated with Vector or HPDP alone, there was no significant difference in the concentration of human IFN-γ (ns indicates no statistical significance). However, when co-cultured with T cells, the concentration of human IFN-γ in the HPDP + Tcell group was significantly higher than that in the Vector + Tcell group (**** indicates extremely significant difference), indicating that when HPDP acts together with T cells, it can significantly promote the secretion of human IFN-γ by Huh7 cells.

[0114] Figure 7 Figure C shows the relative mRNA expression levels of tumor necrosis factor α (TNF-α) and interferon γ (IFN-γ) in Huh7 cells after treatment with Vector and HPDP under conditions such as co-culture with T cells, to judge the effect of HPDP on the gene expression of related cytokines. Figure 7 As can be seen from Figure C, compared with the Vector group, HPDP treatment significantly increased the mRNA expression levels of both TNF-α and IFN-γ, indicating that HPDP can promote the transcription of TNF-α and IFN-γ related genes in Huh7 cells.

[0115] To determine the effect of HPDP on the proliferation cycle of T cells in HCC and its inhibitory effect on migration, a colony formation assay and a Transwell assay were performed on the co-cultured cells of HPDP and T cells for verification. The colony formation assay was divided into 2 groups, namely the DMSO (dimethyl sulfoxide) + T cell control group and the HPDP + T cell experimental group. 500 cells were seeded per well in a 6-well plate and cultured for 14 days. Subsequently, the medium was discarded, and the cells were fixed with 4 wt% paraformaldehyde for 20 minutes and stained with 0.5 wt% crystal violet for 20 minutes. The colonies were washed and photographed. The number of colonies was calculated by Image j. For quantification, 3 independent determinations were performed for each condition. The Transwell assay was also divided into the DMSO + T cell control group and the HPDP + T cell experimental group. Specifically, 4 Hepatoma cells were suspended in 200 μL of serum-free medium and then transferred into a transwell chamber with Matrigel (Corning, NY, USA) and placed in a 12-well plate. 600 μL of DMEM medium containing 15 wt% fetal bovine serum was added to the bottom of the 12-well plate. After incubation for 24 h, the cells were fixed with 4 wt% paraformaldehyde for 20 min, then stained with 0.1 wt% crystal violet for 20 min, and the number of cells was recorded under an inverted microscope. The experimental results are shown in Figure 7 Figures D and E, showing that compared with the DMSO + T cell group, the proliferation ability of hepatoma cells in the HPDP + T cell group was significantly inhibited. The above results indicate that HPDP can significantly inhibit the proliferation and invasion and metastasis of HCC cells.

[0116] Example 4

[0117] This example demonstrates the in vivo efficacy evaluation of HPDP.

[0118] Subcutaneous and orthotopic liver cancer models were established in mice, and the specific procedures are as Figure 8 shown in A and B below. The tumor size was measured every 3 days, and the tumor volume calculation formula is as follows: Volume (mm 3 ) = 0.5 × L × W 2 , where L is the longest diameter and W is the shortest diameter. The detection results are as Figure 9 shown in C - F below and Figure 10 shown in G below. Compared with the control group, the HPDP group significantly inhibited tumor growth and prolonged the survival period. At the same time, Figure 10 shown in H - J below, in the orthotopic liver cancer inoculation tumor model of immunocompetent mice, the tumor growth in the HPDP treatment group was significantly inhibited and the survival period was significantly prolonged. Figure 10 K below shows that the expression of PD - L1 in the HPDP treatment group decreased significantly.

[0119] Example 5

[0120] This example demonstrates the effect of HPDP on immune cells.

[0121] HCC tumors excised from mice were dissociated into single - cell suspensions and then filtered through a 70 - mm filter; then the cells were stained with mouse CD8 (100722, Biolegend, 1.5:100) antibody for 30 min. Samples and data were analyzed using a flow cytometer (Beckman Cytoflex XR / Flowjo V10.8.1), and the analysis results are as Figure 11 shown below. The proportion of CD8 + T cells in the HPDP group increased, and the proportion of exhausted CD8 + T cells decreased. This example shows that HPDP may be an effective immunomodulatory substance and can be used as a lead compound to assist in the development of new cancer immunotherapy drugs. Researchers can further optimize the structure of HPDP based on this to improve its efficacy and safety.

[0122] Example 6

[0123] This example demonstrates the in vivo safety evaluation of HPDP.

[0124] Balb / c mice were evaluated for in - vivo toxicity using HDPD at doses of 0, 100, 200, 500 mg·kg -1 . After a 14 - day injection period, no mice died. Histological changes in the heart, liver, lung, kidney, and spleen of mice were observed by hematoxylin - eosin (H&E) staining. The experimental results are as Figure 12 shown below. At 0, 100, and 200 mg·kg-1 At this dosage, there are slight abnormalities in the tissue morphology of most organs. At 500 mg·kg -1 , lung and liver injuries can occur in mice. These data emphasize the high biocompatibility of HDPD.

[0125] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including the combination of each technical feature in any other suitable manner. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A polypeptide, characterized in that, The polypeptide is the polypeptide described in (a) or (b): (a) A polypeptide having an amino acid sequence as shown in SEQ ID NO.1; (b) A derivative polypeptide obtained by modifying the polypeptide having an amino acid sequence as shown in SEQ ID NO.1 and having the same activity as before the modification.

2. The polypeptide according to claim 1, wherein The modification includes: i. Performing at least one of substitution, deletion, and addition on one or several amino acid residues in the amino acid sequence shown in SEQ ID NO.1; and / or ii. Connecting a tag facilitating purification to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO.1; and / or iii. Connecting a signal peptide sequence beneficial for the secretion and expression of the polypeptide to the amino terminus of the amino acid sequence shown in SEQ ID NO.1; Preferably, the tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc, and more preferably Poly-His.

3. A gene encoding a polypeptide, characterized in that, This gene has a nucleotide sequence encoding the polypeptide described in claim 1 or 2.

4. The gene according to claim 3, characterized in that, The gene is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1; Preferably, the gene is the nucleotide sequence shown in SEQ ID NO.

2.

5. A polypeptide preparation, characterized in that, This polypeptide preparation contains the polypeptide described in claim 1 or 2.

6. Use of at least one of the polypeptide described in claim 1 or 2, the gene described in claim 3 or 4, and the polypeptide preparation described in claim 5 in the preparation of a drug.

7. The application according to claim 6, wherein The drug is a drug for increasing the binding affinity between HNRNPC and PD-L1.

8. The application according to claim 6 or 7, characterized in that, The drug is an anti-tumor disease drug; Preferably, the anti-tumor disease drug is at least one of a drug for inhibiting cancer cell proliferation and / or invasion and metastasis, a drug for enhancing immune cell regulation, and a drug for inhibiting in vivo tumor growth; Preferably, the tumor disease is liver cancer.

9. A pharmaceutical composition, characterized in that, This drug composition contains the polypeptide described in claim 1 or 2 and / or the polypeptide preparation described in claim 5.

10. The pharmaceutical composition according to claim 9, characterized in that, The drug composition further comprises a pharmaceutically acceptable excipient, carrier, solvent, or a combination thereof; Preferably, the excipient is selected from at least one of a diluent, a filler, a binder, a disintegrant, a lubricant, a glidant, a granulating agent, a wetting agent, an emulsifier, a chelating agent, an antioxidant, a preservative, a stabilizer, and a coating agent.