Creation of engineered escherichia coli expressing and secreting FGF19 and application of engineered escherichia coli in improvement of colitis
By inserting the FGF19 expression box into E. coli, the EcN FGF19-01 engineered bacteria was created, which solved the adverse reactions of existing IBD treatment drugs and limited effects of natural probiotics, and achieved effective improvements to colitis.
Patent Information
- Application Number
- CN202510593266.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-07-29
AI Technical Summary
Existing IBD therapeutic drugs such as salicylic acid, glucocorticoids and immunosuppressants have problems with adverse reactions and low compliance in long-term use. The therapeutic effects of natural probiotics are limited, and there is a lack of effective solutions for genetically engineered bacteria to improve colitis.
An engineered EcN FGF19-01 expressing and secreting FGF19 was created. By inserting the FGF19 expression frame consisting of the PfnrS promoter, ribosome binding site, ompA signal peptide and rrnB T1 terminator into the E.coli Nissle 1917 strain, the efficient expression and secretion of FGF19 was achieved, and used to improve colitis.
It significantly improves the weight and diarrhea index of colitis mice, reduces intestinal mucosal damage, and provides a safe and efficient treatment plan.
Smart Images

Figure CN120384033A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to the creation of an engineered Escherichia coli strain expressing and secreting FGF19 and its application in improving colitis. Background Art
[0002] Inflammatory bowel disease (IBD) is a chronic disease of the intestine of unknown origin, mainly including Crohn's disease (CD) and ulcerative colitis (UC). The cause is still unclear at present. Clinically, it often shows symptoms such as acute pain, diarrhea, and bloody stools, seriously affecting the quality of life of patients. In recent years, the incidence and prevalence of IBD have been on the rise around the world. At present, IBD is mainly treated with drugs, which are mainly used to relieve or maintain remission of symptoms, and there is no complete cure method yet.
[0003] The main clinical treatment drugs for IBD are salicylic acid drugs, glucocorticoid drugs, and immunosuppressive drugs. Salicylic acid drugs (such as 5-aminosalicylic acid) can play an anti-inflammatory role by reducing the release of pro-inflammatory factors in the intestine. Clinically, they are often used for patients with mild to moderate symptoms of enteritis. However, salicylic acid drugs have relatively serious adverse reactions such as gastrointestinal reactions, and it has also been reported that they may cause kidney damage; Glucocorticoid drugs (such as hydrocortisone, prednisone) relieve inflammation by inhibiting the release of pro-inflammatory substances (such as prostaglandins, leukotrienes). Clinically, they are often used for patients with moderate to severe symptoms of enteritis. However, long-term or large-dose use is likely to produce drug resistance and various adverse reactions; Immunosuppressive drugs such as azathioprine and tumor necrosis factor-α (TNF-α) inhibitors can inhibit the proliferation of inflammatory cells. Clinically, they are mainly used to induce remission or maintain remission of hormone-dependent Crohn's disease (CD) with difficult clinical treatment. However, patients are prone to adverse reactions such as nausea, vomiting, and diarrhea after taking them. In short, although drugs such as salicylic acid drugs, hormone drugs, or immunosuppressive drugs can relieve the clinical symptoms of IBD, they all have deficiencies such as easy recurrence after drug withdrawal and low patient compliance with long-term use.
[0004] Numerous studies in recent years have demonstrated that supplementation with probiotics or engineered bacteria has demonstrated promising results in the treatment of IBD, effectively alleviating its clinical symptoms. Due to their inherent gut affinity, probiotics are considered promising candidates for improving intestinal health. However, the therapeutic efficacy of naturally occurring strains is often limited. The rise of synthetic biology has provided innovative avenues for the development of genetically engineered bacteria, potentially offering a new strategy to address these challenges. Since its discovery in 1917, Escherichia coli Nissle 1917 (EcN) has been used in humans to treat a variety of gastrointestinal and metabolic diseases, including inflammatory bowel disease, irritable bowel syndrome, and phenylketonuria. EcN does not colonize the human body, and its presence is undetectable in feces one week after ingestion, demonstrating its excellent safety and genetic tractability. Furthermore, EcN has been approved for use as a base strain in the development of specific live bacterial drugs for the treatment of various diseases. For example, Praveschotinunt et al. constructed an engineered EcN that induced the expression of frizzled-fused trefoil factors (TFFs). Using arabinose as an inducer, they successfully induced EcN to secrete TFFs and significantly alleviated DSS-induced colitis.
[0005] Human fibroblast growth factor 19 (FGF19) is a 24 kDa protein that is specifically synthesized and secreted in the terminal ileum. It is a specialized member of the FGF family and is homologous to rodent FGF15; the two share similar tissue distribution and are sometimes referred to as FGF15 / 19. FGF19 was originally discovered in the fetal brain and is thought to play a key role in early neuronal development. Subsequent studies in transgenic mice expressing FGF19 revealed increased metabolic rate and reduced adiposity, revealing FGF19's involvement in metabolic regulation. Further studies have revealed that FGF19 participates in feedback inhibition of the bile acid biosynthesis pathway. FGF15 / 19 is expressed and secreted in the ileum in response to bile acid absorption. Bile acids released into the ileum bind to the farnesoid X receptor (FXR), which in turn promotes FGF15 / 19 transcription. FGF19 enters the portal circulation and negatively inhibits hepatic bile acid synthesis by reducing the activity of hepatic CYP7A1, which catalyzes the conversion of cholesterol to 7α-hydroxycholesterol, the first rate-limiting step in bile acid synthesis.
[0006] Studies have shown that in a mouse colitis model induced by DSS, the expression of FGF15 in the ileum decreased significantly (Nature Communications 2014, 5: 4573); serum FGF19 was significantly reduced in patients who underwent ileal resection or patients with Crohn's disease (Journal of Crohns & Colitis 2015, 9: 125 - 31). Studies have shown that knocking out FGF15, FGFr4 or Klb in mice will lead to an increase in the content of bile acids in feces and induce diarrhea (Cell Metabolism 2005, 2: 217 - 25). In the state of enteritis, the expression of intestinal FXR decreased significantly, disrupting the bile acid negative feedback pathway FXR - FGF19 / 15. Supplementation with low - dose human recombinant FGF19 restored intestinal bile acid homeostasis and alleviated the occurrence and development of DSS - induced chronic enteritis (Nature Communications 2020, 11: 3612). The above studies indicate that abnormal expression and secretion of FGF19 and disorders in bile acid synthesis and metabolism are key factors in the occurrence and development of chronic enteritis. Therefore, intervening by genes and drugs or enhancing the role of FGF19 seems to be a potential and effective means to improve chronic colitis.
[0007] In summary, the present invention aims to create an engineered Escherichia coli strain that expresses and secretes FGF19, and to explore its application value in improving colitis. Summary of the Invention
[0008] The object of the present invention is to provide the creation of an engineered Escherichia coli strain that expresses and secretes FGF19 and its application in improving colitis. The engineered Escherichia coli EcN FGF19 - 01 of the present invention is used for preparing pharmaceutical compositions, health products and feed additives for alleviating colitis, and has a very broad application prospect.
[0009] The specific technical solution for achieving the object of the present invention is as follows: An engineered Escherichia coli EcN FGF19 - 01 that expresses and secretes FGF19, wherein the engineered Escherichia coli uses the wild - type strain of E.coli Nissle 1917 as the starting strain, and a 1020 - bp PfnrS - FGF19 expression cassette nucleotide sequence composed of an anaerobic promoter (PfnrS), a ribosome - binding site (RBS), an Escherichia coli ompA signal peptide, a human - derived FGF19 coding region sequence (CDS) and an rrnB T1 terminator sequence is inserted at the exo / cea locus of its genome.
[0010] The nucleotide sequence of the PfnrS promoter is shown as SEQ ID NO.1, the nucleotide sequence of the RBS is shown as SEQ ID NO.2, the nucleotide sequence of the ompA signal peptide is shown as SEQ ID NO.3, the nucleotide sequence of the FGF19 CDS is shown as SEQ ID NO.4, and the nucleotide sequence of the rrnB T1 terminator sequence is shown as SEQ ID NO.5.
[0011] SEQ ID NO.1: TGTTCTTATTGGTGGTGTTGCTTTATGGTTGCATCGTAGTAAATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAAACGCCGTAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCTTGCAGGTGAATGCAACGTCAAGCGATGGGCGTTGCGCTCCATATTGTCT SEQ ID NO.2: TAAAAAGGGAGGCCAAATATAATGAAAAATATGAATGACAATGATGTT SEQ ID NO.3: ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC SEQ ID NO.4: CGCCCACTGGCCTTCTCAGACGCGGGTCCACACGTGCACTACGGCTGGGGCGACCCAATCCGCCTGCGTCACCTGTACACCTCCGGCCCACACGGTCTGTCCAGCTGCTTCCTGCGCATCCGTGCCGACGGCGTCGTGGACTGCGCGCGTGGCCAGAGCGCGCACAGCTTACTGGAGATCAAGGCAGTCGCTCTGCGTACCGTGGCCATCAAGGGCGTGCACAGCGTGCGTTACCTGTGCATGGGCGCCGACGGCAAGATGCAGGGTCTGCTGCAGTACTCAGAGGAAGACTGTGCTTTCGAGGAGGAGATCCGCCCAGATGGCTACAATGTGTACCGTTCCGAGAAGCACCGCCTGCCGGTCTCCCTGAGCAGCGCCAAACAGCGTCAGCTGTACAAGAACCGTGGCTTTCTGCCACTGTCTCATTTCCTGCCAATGCTGCCTATGGTCCCAGAGGAGCCTGAGGACCTGCGTGGCCACTTAGAATCTGACATGTTCTCTTCACCACTGGAGACCGACAGCATGGACCCATTTGGTCTGGTCACCGGTCTGGAGGCCGTGCGTAGCCCAAGCTTTGAGAAGTAA SEQ ID NO.5: TTTGATCTTTTCTACGGCGCGCCCAGCTGTCTAGGGCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTG Furthermore, the engineered Escherichia coli is constructed according to the following steps: Entrust Boshang Biotechnology (Shanghai) Co., Ltd. to synthesize the above 1020 bp PfnrS-FGF19 expression cassette nucleotide sequence; using the wild-type strain of E. coli Nissle 1917 as the chassis strain, design a sgRNA sequence (exo / cea-sgRNA) according to its genomic exo / cea sequence, and insert the exo / cea-sgRNA sequence into the pTargetF plasmid through experimental steps such as double digestion and ligation to construct the recombinant plasmid pTargetF-exo / cea-sgRNA; design primers, PCR amplify the upstream and downstream homologous arm sequences of the exo / cea locus, named exo / cea-LHA and exo / cea-RHA, with lengths of 1020 bp and 1008 bp respectively; connect the 1020 bp PfnrS-FGF19 expression cassette nucleotide sequence with exo / cea-LHA and exo / cea-RHA sequences by Overlap-PCR, and then insert them into the recombinant plasmid pTargetF-exo / cea-sgRNA through double digestion and ligation to construct the plasmid pTargetF-exo / cea-sgRNA-FGF19; co-electroporate the plasmid pTargetF-exo / cea-sgRNA-FGF19 and the plasmid pCas into the competent strain of E. coli Nissle 1917 (EcN) for gene editing, and then pick single colonies from the LB plate; then design primers for PCR identification of positive strains; create the engineered E. coli strain EcN FGF19-01; The nucleotide sequence of the exo / cea-sgRNA is shown in SEQ ID NO.6, the nucleotide sequence of the upstream homologous arm exo / cea-LHA is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream homologous arm exo / cea-RHA is shown in SEQ ID NO.8.
[0012] SEQ ID NO.6: GGAACTACATTAGGTATCTGGTTTTAGAGCTAGAAATAGCAAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGAATTCTCTAGAGTCGACCTGCAG SEQ ID NO.7: SEQ ID NO.8: Use of the above-mentioned engineered Escherichia coli EcN FGF19-01 in expressing and producing FGF19.
[0013] A microbial preparation or microcapsule preparation containing the above-mentioned engineered Escherichia coli EcN FGF19-01.
[0014] Use of the above-mentioned microbial preparation or microcapsule preparation in preparing FGF19.
[0015] A method for expressing and secreting FGF19, which uses the above-mentioned engineered Escherichia coli EcN FGF19-01 or the above-mentioned microbial preparation or microcapsule preparation to express and secrete FGF19.
[0016] Use of the above-mentioned engineered Escherichia coli EcN FGF19-01 or the above-mentioned microbial preparation or microcapsule preparation in preparing a product for preventing and / or improving colitis. The product is a pharmaceutical composition or a feed additive.
[0017] The engineered Escherichia coli EcN FGF19-01 created by the present invention has the function of highly expressing and secreting FGF19, and can significantly improve the body weight of colitis mice, reduce the diarrhea index and intestinal mucosal damage. Description of the Drawings
[0018] Figure 1 : Schematic diagram of the engineered strain EcN FGF19-01; Figure 2 : Determination of the growth curves of EcN FGF19-01 and EcN WT strains; Figure 3 : FGF19 mRNA and protein expression levels of EcN FGF19-01 and EcN WT strains under aerobic and anaerobic culture conditions respectively; Figure 4 : Content of FGF19 protein produced in the supernatant of EcN FGF19-01 and EcN WT strains at different culture times; Figure 5 : Changes in body weight and diarrhea index of colitis mice supplemented with the engineered strain EcN FGF19-01; Figure 6 : Colon length and HE staining morphology of colitis mice supplemented with the engineered strain EcN FGF19-01; Figure 7 : Changes in body weight and diarrhea index of colitis mice supplemented with the microcapsules of the engineered strain EcN FGF19-01; Figure 8 : Colon length and HE staining morphology of colitis mice supplemented with the microcapsules of the engineered strain EcN FGF19-01; Data in the figures are presented as mean ± SEM. One-way or two-way ANOVA was used to analyze the significance between more than two groups. *P < 0.05, **P < 0.01, ***P < 0.001 indicate significance compared with the control group. Detailed implementation mode
[0019] The present invention will be described in detail below with reference to the accompanying drawings and embodiments. Embodiment
[0020] 1. Cultivation of Escherichia coli EcN Escherichia coli was cultured using LB (Luria-Bertani) medium. Preparation of LB liquid medium (1 L): Add 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl to 950 mL of ddH2O. Adjust the pH value to 7.0 with 1 M NaOH. Add 15 g of agar powder to the solid medium; make up the volume to 1 L with ddH2O. Autoclave at 121 °C for 20 min. The whole process of bacterial culture was carried out in a laminar flow hood. Escherichia coli was inoculated at a ratio of 1:100 and grew to the logarithmic phase in 8 - 12 h. After centrifugation, the bacteria were collected and stored in PBS containing 20% glycerol.
[0021] Determination of viable bacteria concentration: The bacteria were thawed in a 37 °C water bath. The bacterial solution was diluted 10-fold with PBS to 10-2, 10-3, 10-4, 10-5, 10-6, 10-7, 10-8, respectively. Then, the bacterial solutions with concentrations of 10-7 and 10-8 were spread on solid culture dishes; after 24 h, the number of colonies was counted, and the viable bacteria count of the original bacterial solution was calculated according to the dilution factor. The total number of bacterial communities per unit volume was expressed as colony-forming units (CFU).
[0022] 2. Design of engineered EcN expressing FGF19 The promoter of endogenous FnrS in bacteria (PfnrS) is inactive in the presence of oxygen, but is activated by binding to FNR under anaerobic or microaerobic conditions; based on this, the PfnrS promoter was used to drive the expression of FGF19, so that the engineered bacteria could initiate the expression of the target gene under anaerobic / microaerobic conditions deep in the intestine after oral gavage. The CDS sequence of the human FGF19 gene was codon-optimized (E. coli Codon Usage Analyzer 2.1) and then ligated to the signal peptide sequence of the bacterial endogenous ompA, and then together with the rrnB T1 terminator sequence to form an expression cassette of PfnrS + ompA signal peptide + FGF19 CDS + rrnB T1 terminator, with a full length of 1020 bp nucleotides. This design will enable the engineered bacteria to efficiently express FGF19 in the hypoxic environment of the intestine and secrete it outside the cells to effectively contact and act on the intestinal mucosa. The working mode of the engineered bacteria is shown in Figure 1 .
[0023] 3. Construction steps of engineered Escherichia coli EcN FGF19-01 Bacterial gene editing uses a two-plasmid system (pCas, addgene #62225; pTargetF, addgene #62226). The exo / cea gene locus of the EcN genome was selected as the editing insertion region because this locus has been proven to be a safe site that does not induce genotoxicity and does not affect the survival of the bacteria themselves. First, the pCas plasmid was electrotransformed into EcN competent cells, and positive strains were screened and named EcN Cas9+; then, a recombinant plasmid pTargetF-exo / cea-sgRNA-FGF19 carrying the exo / cea-sgRNA, upstream and downstream homologous arms, and the PfnrS-FGF19 expression cassette sequence was constructed; the steps are as follows: Using the gRNA design web tool (https: / / www.genscript.com / gRNA-design-tool.html), a 20-bp gRNA sequence (GGAACTACATTAGGTATCTG) was designed for the exo / cea gene locus sequence of the EcN genome, and then primers exo / cea-sgRNA-F and exo / cea-sgRNA-R with SpeI / PstI double digestion sites were designed. Using the pTargetF plasmid as a template, the exo / cea-sgRNA sequence was amplified by PCR, and then inserted into the pTargetF plasmid to obtain the pTargetF-exo / cea-sgRNA recombinant plasmid; the above 1020-bp PfnrS-FGF19 expression cassette nucleotide sequence was synthesized by Biosense Technologies (Shanghai) Co., Ltd.; primers were designed to amplify the upstream and downstream homologous arm sequences of the exo / cea locus, named exo / cea-LHA and exo / cea-RHA, with lengths of 1040 bp and 1010 bp respectively; the 1020-bp PfnrS-FGF19 expression cassette nucleotide sequence was ligated with the exo / cea-LHA and exo / cea-RHA sequences by Overlap-PCR, and then digested and ligated with BglII / XhoI and inserted into the recombinant plasmid pTargetF-exo / cea-sgRNA to finally obtain the recombinant plasmid pTargetF-exo / cea-sgRNA-FGF19.
[0024] Furthermore, the recombinant plasmid pTargetF-exo / cea-sgRNA-FGF19 was electrotransformed into the EcN Cas9+ competent strain; the strains were screened by adding 10 mM arabinose and Spe / Kan double resistance in the LB plate solid medium. The positive strains were gene-edited, and then single colonies were picked from the LB plate; then, the positive strains were identified by PCR, and the positive mutant strains were screened by sequencing.
[0025] Finally, eliminate the pCas and pTargetF-exo / cea-sgRNA-FGF19 plasmids from the successfully edited positive strains. Inoculate the bacteria into 1.5 mL of LB medium containing kanamycin (50 μg / mL) and IPTG (0.5 mM), incubate for 8 - 16 h, then dilute and spread on a plate containing kanamycin (50 μg / mL). Then pick monoclonal strains for PCR identification to screen for positive strains that have eliminated the pTargetF-exo / cea-sgRNA-FGF19 plasmid. Finally, inoculate the strains into antibiotic-free LB medium, culture overnight at 37 °C, then dilute and spread on an antibiotic-free plate. Then pick monoclonal strains for PCR identification. Ultimately, obtain positive engineered Escherichia coli strains that have been successfully edited and do not carry the pCas and pTargetF-exo / cea-sgRNA-FGF19 plasmids, and name them EcN FGF19-01; name the wild-type strain EcN WT.
[0026] Table 1: sgRNA and homologous arm primer sequences
[0027] 4. Determination of the growth curves of the engineered bacteria EcN FGF19-01 and the wild-type strain EcN WT Culture the EcN FGF19-01 and EcN WT monoclonal strains overnight in LB medium. In the morning of the next day, inoculate them at a ratio of 1:100 respectively, and then measure the OD600 values at 0, 2, 4, 6, 8, 10, and 12 h respectively, and plot the growth curves. The results show that there is no significant difference in the growth curves of the EcN FGF19-01 and EcN WT strains, as shown in Figure 2 .
[0028] 5. RNA extraction and real-time quantitative fluorescence PCR Total RNA was extracted according to the operating steps of Trizol reagent (Invitrogin), and the extracted total RNA was purified to remove DNA using the RNA purification kit TURBO DNA-freeTM Kit (AM1907, Applied Biosystems), and the operation was carried out according to the instructions. The qRT-PCR reaction was completed on a real-time quantitative PCR detection system (EBI, 7900). The 10 μL reaction system was: 5 μL SYBR Premix, 4 μL DNA, 0.5 μL upstream primer, 0.5 μL downstream primer. The program was: 95°C for 3 min, (95 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s + reading the plate) for 40 cycles, (rising from 55 °C to 95 °C, reading for 5 s every 0.5 °C) for the melting curve. The total bacterial 16S was used as an internal reference for calibration between samples, and the results were calculated by the 2-ΔΔCt method to detect the expression of FGF19 in the mutant strains. The results showed that the EcN FGF19-01 strain significantly highly expressed FGF19 mRNA under anaerobic conditions, as shown in Figure 3 A.
[0029] Table 2: qPCR primer sequences
[0030] 6. Protein extraction and immunoblotting Extraction of bacterial proteins: Take an appropriate amount of bacterial liquid, centrifuge to collect the bacterial liquid and the supernatant medium respectively. Add an appropriate volume of denaturing RIPA lysis buffer (150 mM NaCl, 10 mM Tris pH 7.2, 0.1% SDS, 1% Triton X-100, 1% Deoxycholate and 5 mM EDTA) mixed with protease inhibitors and phospholipase inhibitors to the bacterial liquid, and ultrasonically disrupt it at ice bath for 10 s / 10 s. After 10 min, centrifuge at 4 °C and 12000 rmp for 20 minutes, and take the supernatant to obtain the bacterial protein solution.
[0031] Extraction of supernatant proteins from the medium: Take an appropriate amount of supernatant from the medium, add 4 times the volume of methanol, mix well and let it stand at 4 °C for 3 h. Centrifuge at 4 °C and 10000 rmp for 10 minutes, then discard the supernatant, collect the protein precipitate, wash the precipitated protein 3 times with guanidine hydrochloride ethanol solution for 20 min each time, and dissolve the protein with 1% SDS solution containing protease inhibitors to obtain the supernatant protein solution from the medium.
[0032] Western blot: The protein concentration was measured using the BCA Kit from Pierce. After measuring the concentration, 5×SDS loading buffer (200 mM Tris-Cl, pH 6.8, 8% SDS, 0.4% bromophenol blue, 40% glycerol, and 400 mM DTT) was added, and the mixture was boiled at 100 °C for 10 minutes. Immediately, the sample was loaded for immunoblotting detection or stored at -20 °C for later use.
[0033] A 10% discontinuous denaturing polyacrylamide gel (SDS-PAGE) was used for vertical electrophoresis. Electrophoresis was initially carried out at a voltage of 80 V. After the dye front entered the separating gel, the voltage was increased to 120 V and electrophoresis continued until the bromophenol blue reached the bottom of the separating gel (10× electrophoresis buffer: 30 g Tris, 144 g glycine, 10 g SDS, made up to 1 L with ddH2O). The PVDF membrane was soaked in methanol for 15 sec and then equilibrated with the gel in the transfer buffer for 15 min (10× transfer buffer: 30 g Tris, 144 g glycine, 200 ml methanol, made up to 1 L with water); then, it was arranged in the order of anode - sponge - filter paper - PVDF membrane - gel - filter paper - sponge - cathode, placed in the transfer container, and transferred at 4 °C and 380 mA. The transfer time varied according to the molecular weight, generally 1 - 2 h. After the transfer was completed, the PVDF membrane was taken out, marked with the direction and marker, and cut as needed. It was blocked with 10% skim milk at room temperature for 1 h and washed three times with TBST for 10 min each time (10× TBS: 24.2 g Tris, 80 g NaCl, adjusted to pH 7.6 with concentrated HCl; TBST: 1× TBS and 0.1% Tween-20). The primary antibody reaction was carried out. The antibody was prepared in 1×TBST + 5% BSA, incubated at room temperature for 1 - 2 h or overnight at 4 °C. The antibody was recovered and stored at 4 °C. The PVDF membrane was then washed three times with TBST for 10 min each time, and the secondary antibody reaction was carried out. After 1 h at room temperature, the membrane was washed three times with TBST for 10 min each time. ECL (Amersham Biosciences) was used for development. The primary antibodies anti-FGF19 and anti-GAPDH were both purchased from Cell Signaling Technology. The results showed that under anaerobic conditions, the EcN FGF19-01 strain significantly overexpressed the FGF19 protein, as shown in Figure 3 Figure B.
[0034] 7. Determination of FGF19 protein content using an Elisa kit Determination of FGF19 content in bacterial supernatant: After the bacteria were thawed and activated in a 37°C water bath, they were inoculated at a ratio of 1:100 and cultured with shaking overnight. The next day, they were inoculated at a ratio of 1:100 into EP tubes and cultured with shaking under anaerobic conditions. The culture medium was collected at 0, 2, 4, 6, 8, 10, and 12 h, respectively. After centrifugation, the supernatant was taken, and the FGF19 protein content of the standard product and the bacterial supernatant was measured according to the instructions of the Elisa kit (proteintech, Human FGF19 ELISA Kit, KE00243). The results showed that EcN FGF19-01 could secrete FGF19 protein into the culture medium supernatant, and the secretion amount was the highest at 6 h (exceeding 8 ng / ml), as shown in Figure 4 .
[0035] 8. Preparation of engineered bacteria EcN FGF19-01 microcapsules The microcapsules are composed of alginate-polylysine-alginate, and the preparation steps are as follows: 1) Equipment connection. Inject 225 ml of sterile polymerization buffer into the reaction vessel, then fix it on the control unit of the microcapsule granulator on the workbench, and set the parameters on the control unit (vibration frequency is 1300 Hz, voltage is 1100 v, rotation speed is 75 rmp); 2) Bacteria collection. Take 20 mL each of EcN FGF19 and wild-type EcN bacterial solutions at 5x109 CFU / mL, discard the supernatant after centrifugation, wash twice with PBS and then centrifuge to collect the bacterial cells in a 50 mL centrifuge tube. The collected bacterial solution is resuspended with 1 mL of sterile MPOS (3-morpholinopropanesulfonic acid) washing buffer, and then 20 mL of 1.5% sodium alginate solution is added and mixed to form a cell-alginate suspension; 3) Droplet solidification. The cell-alginate suspension is transferred to a 20 mL syringe, which is connected to the reaction vessel in a laminar flow hood, then push the syringe, and the suspension immediately enters the nozzle. Use the set parameters to quickly disperse the droplets ejected from the nozzle and enter the polymerization solution, and stir to form the droplets; 4) Alginate diaphragm formation. After the droplets are solidified for 5 min, stop stirring and drain the polymerization solution, then add 75 mL of 0.1% polylysine solution and stir for 10 min; 5) Washing. After draining the 0.05% polylysine solution, for the first wash, add 200 mL of MPOS washing solution and stir for 1 min and then drain, and then for the second wash, add 200 mL of MPOS washing solution and stir for 5 min and then drain; 6) External alginate diaphragm formation. Add 100 mL of 0.03% alginate solution, stir for 5 min to form the external alginate diaphragm, and then drain the alginate solution; 7) Washing. Add 200 mL of MPOS washing solution and stir for 1 min and then drain; 8) Depolymerization. Add 200 ml of depolymerization solution and stir for about 10 min to dissolve the alginate in the core material of the droplets, and then drain the depolymerization solution; 9) Capsule collection. Add 200 mL of MPOS washing solution, resuspend the capsules and transfer them to a collection bottle for collection. The microcapsules are named EcN@FGF19-01 and EcN@WT respectively.
[0036] 9. Experimental animal treatment Wild-type male C57BL / 6 mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. After 7 days of adaptation, the mice were given drinking water containing Abx. After 5 days, the drinking water was changed to normal water. After weighing, the mice were divided into 3 groups with comparable body weights. The experimental groups began to drink 3.5% DSS aqueous solution and were respectively gavaged with viable EcN FGF19-01 bacteria and EcN WT bacteria (1*109 CFU / mouse), or were respectively gavaged with EcN@FGF19-01 and EcN@WT microcapsules. Each mouse was gavaged with 200 μL of bacterial solution or microcapsules once a day for 1 week. During the experiment, the body weights of the mice were measured every day, and diarrhea scores (0-4) were performed. The mice were housed in a SPF-class animal room with a breeding temperature of 25 °C and a 12-hour day-night cycle. Before the experiment, the mice were fed with food and water that met international standards. After the experiment, the mice were sacrificed with carbon dioxide, various tissues were collected, frozen in liquid nitrogen, and stored in a -80 °C refrigerator for later use. Figures 5 - 8 The results showed that gavage with engineered Escherichia coli EcN FGF19-01 or microcapsules encapsulating EcN FGF19-01 could significantly improve the body weight of colitis mice, reduce the diarrhea index and intestinal mucosal damage.
[0037] 10. Histological analysis and scoring Hematoxylin and eosin (H&E) staining was performed using standard procedures for histological analysis of intestinal morphology, and then a double-blind score was performed on the intestinal damage.
[0038] 11. Statistical analysis The values were expressed as mean ± standard error. The statistical significance between two groups was detected by unpaired two-tailed t-test, and one-way or two-way ANOVA analysis was used for more than two groups. *P<0.05, **P<0.01, ***P<0.001 indicated statistical differences.
Claims
1. An engineered Escherichia coli EcN FGF19-01 expressing and secreting FGF19, characterized in that, The engineered Escherichia coli uses the wild-type strain of E. coli Nissle 1917 as the chassis bacterium, and a 1020 bp nucleotide sequence of the PfnrS-FGF19 expression cassette containing an anaerobic promoter (PfnrS), a ribosome binding site (RBS), the signal peptide of E. coli ompA, the coding region sequence (CDS) of human FGF19, and the rrnB T1 terminator sequence is inserted at the exo / cea locus of its genome; The nucleotide sequence of the anaerobic promoter (PfnrS) is shown in SEQ ID NO.1, the nucleotide sequence of the ribosome binding site (RBS) is shown in SEQ ID NO.2, the nucleotide sequence of the signal peptide of E. coli ompA is shown in SEQ ID NO.3, the nucleotide sequence of the coding region sequence (CDS) of human FGF19 is shown in SEQ ID NO.4, and the nucleotide sequence of the rrnB T1 terminator sequence is shown in SEQ ID NO.
5.
2. The engineered Escherichia coli EcN FGF19-01 according to claim 1, characterized in that, The engineered Escherichia coli is constructed according to the following steps: Entrust Bio Shang Biotechnology (Shanghai) Co., Ltd. to synthesize the 1020 bp nucleotide sequence of the PfnrS-FGF19 expression cassette; use the wild-type strain of E. coli Nissle 1917 as the chassis strain, design a sgRNA sequence (exo / cea-sgRNA) according to its genome exo / cea sequence, and insert the exo / cea-sgRNA sequence into the pTargetF plasmid through PCR, gel recovery, double digestion and ligation test steps to construct the recombinant plasmid pTargetF-exo / cea-sgRNA; Design primers, PCR amplify the upstream and downstream homologous arm sequences of the exo / cea locus, named exo / cea-LHA and exo / cea-RHA, with lengths of 1020 bp and 1008 bp respectively; connect the 1020 bp nucleotide sequence of the PfnrS-FGF19 expression cassette with the exo / cea-LHA and exo / cea-RHA sequences by Overlap-PCR, and then insert them into the recombinant plasmid pTargetF-exo / cea-sgRNA through double digestion and ligation to construct the plasmid pTargetF-exo / cea-sgRNA-FGF19; co-electroporate the plasmid pTargetF-exo / cea-sgRNA-FGF19 and the plasmid pCas into the competent strain of E. coli Nissle 1917 (EcN) for gene editing, and then pick single colonies from the LB plate; then design primers for PCR identification of positive strains; create the engineered Escherichia coli strain EcN FGF19-01; The nucleotide sequence of the exo / cea-sgRNA is shown in SEQ ID NO.6, the nucleotide sequence of the upstream homology arm exo / cea-LHA is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream homology arm exo / cea-RHA is shown in SEQ ID NO.
8.
3. Use of the engineered Escherichia coli EcN FGF19-01 according to claim 1 in the expression and production of FGF19.
4. A microbial preparation or microcapsule preparation containing the engineered Escherichia coli EcN FGF19-01 according to claim 1.
5. Use of the microbial preparation or microcapsule preparation according to claim 4 in the preparation of FGF19.
6. A method for expressing and secreting FGF19, characterized in that, Express and secrete FGF19 using the engineered Escherichia coli EcN FGF19-01 according to claim 1 or the microbial preparation or microcapsule preparation according to claim 4.
7. Use of the engineered Escherichia coli EcN FGF19-01 according to claim 1 or the microbial preparation or microcapsule preparation according to claim 4 in the preparation of a product for preventing and / or improving colitis.
8. The application according to claim 7, characterized in that The product is a pharmaceutical composition or a feed additive.