Construction method of recombinant human interferon alpha2b soluble expression engineering strain

CN120399997APending Publication Date: 2025-08-01HEILONGJIANG AGRICUTURAL ENGINEARING VOCATIONAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510317713.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

然而,复性过程极易导致蛋白质聚集、沉淀甚至失活

Benefits of technology

[0022] The present application provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain, including the following steps: S1. Obtain the human interferon α2b gene sequence and perform codon optimization for Escherichia coli; S2. PCR amplify the optimized human interferon α2b gene, perform double digestion on the pET-22b(+) vector, and ligate the double-digested products of the optimized human interferon α2b gene and the vector to obtain a recombinant plasmid; S3. Transform the recombinant plasmid into Escherichia coli competent cells to obtain an Escherichia coli engineering strain for soluble secretory expression of recombinant human interferon α2b. By selecting Escherichia coli as the host, on the one hand, through codon optimization of the human interferon α2b gene, it is made more suitable for expression in Escherichia coli, thereby increasing its yield. On the other hand, when constructing the vector, the secretion signal peptide PelB is introduced to secrete the recombinant human interferon α2b protein into the periplasmic cavity, thus solving the problems of protein inclusion body formation and difficult purification. After codon optimization of the Escherichia coli sequence, the expression level of the recombinant human interferon α2b target protein accounts for more than 50% of the total bacterial protein, and more than 70% exists in the form of soluble protein. For protein purification, after conventional purification steps such as ion exchange and molecular sieve, no denaturation and renaturation are required, and the obtained protein has high activity, reaching 3.5×10 8 IU/mg.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120399997A_ABST
    Figure CN120399997A_ABST
Patent Text Reader

Abstract

The invention provides a construction method of a recombinant human interferon alpha2b soluble expression engineering strain, and belongs to the field of human interferon. The method comprises the following steps: S1, obtaining a human interferon alpha2b gene sequence, and performing escherichia coli codon optimization; s2, carrying out PCR (Polymerase Chain Reaction) amplification on the optimized human interferon alpha2b gene, carrying out double enzyme digestion on a pET-22b (+) vector, and connecting the optimized human interferon alpha2b gene with a double enzyme digestion product of the vector to obtain a recombinant plasmid; s3, transforming the recombinant plasmid into escherichia coli competent cells to obtain an escherichia coli engineering strain for soluble secretory expression of the recombinant human interferon alpha2b. On one hand, through codon optimization of the interferon alpha2b gene, the interferon alpha2b gene is more suitable for expression in escherichia coli. On the other hand, a secretion signal peptide PelB is introduced, and the recombinant human interferon alpha2b protein is secreted into a periplasmic cavity, so that the problems that the protein forms an inclusion body and is difficult to purify are solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of human interferon, and particularly to a method for constructing a recombinant human interferon α2b soluble expression engineering strain. Background Art

[0002] Human interferon α2b (IFNα2b) is a protein composed of 165 amino acids with a molecular weight of 19.2 KD. Human interferon α2b is a biopharmaceutical with a wide range of antiviral, antitumor, and immunomodulatory effects. Clinically, it can be used to treat various viral infectious diseases and tumors.

[0003] However, most current production enterprises choose the Escherichia coli expression system because Escherichia coli has a clear genetic background, is easy to operate, has a short growth cycle, low cost, and is easy to culture on a large scale. However, as a prokaryote, directly introducing the unoptimized human gene sequence into the host will result in low expression efficiency of the gene in the heterologous host, seriously affecting the protein expression level. Therefore, enterprises urgently need to solve the problems of the stability and expression level of recombinant human interferon α2b in Escherichia coli. At the same time, as a protein drug, the purification process of recombinant human interferon α2b is particularly crucial. On the one hand, recombinant human interferon α2b is expressed intracellularly in Escherichia coli, and the target protein needs to be obtained through fragmentation treatment. Since the Escherichia coli expression system may contain various impurities, such as unexpressed host cell proteins, nucleic acid fragments, and culture medium components, the presence of these impurities will seriously affect the purification and safety of recombinant human interferon α2b. On the other hand, recombinant human interferon α2b protein will form inclusion bodies during the expression process and needs to be renatured to restore its biological activity. However, the renaturation process is extremely likely to cause protein aggregation, precipitation, and even inactivation. For the above reasons, enterprises face the dilemmas of complex steps, difficult purification, and high costs during the purification process of recombinant human interferon α2b. Summary of the Invention

[0004] This application provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain to solve the following technical problems: how to simultaneously improve the yield and purity of human interferon α2b produced by the Escherichia coli expression system.

[0005] In the first aspect, this application provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain, including the following steps:

[0006] S1. Obtain the human interferon α2b gene sequence and perform codon optimization for Escherichia coli;

[0007] S2. Optimize the human interferon α2b gene by PCR amplification, perform double digestion on the pET-22b(+) vector, and ligate the double-digested products of the optimized human interferon α2b gene and the vector to obtain a recombinant plasmid;

[0008] S3. Transform the recombinant plasmid into Escherichia coli competent cells to obtain an Escherichia coli engineering strain that can solubly secrete and express recombinant human interferon α2b.

[0009] Optionally, the nucleotide sequence of the optimized human interferon α2b gene is as shown in SEQ ID NO.1.

[0010] Optionally, the nucleotide sequences of the upstream and downstream primers of the optimized human interferon α2b gene are as shown in SEQ ID NO.2 to SEQ ID NO.13.

[0011] Optionally, the restriction endonucleases used for double digestion are BamH I and Xho I.

[0012] Optionally, the transformation is carried out by the calcium chloride method or the electroporation method.

[0013] Optionally, after step S3, the method further includes:

[0014] S4. Screen out Escherichia coli clones containing the recombinant plasmid through antibiotic resistance;

[0015] S5. After confirming the positive clones, induce the expression of recombinant human interferon α2b using IPTG, and then detect the secretory expression of recombinant human interferon α2b by sodium dodecyl sulfate-polyacrylamide gel electrophoresis technology.

[0016] Optionally, the method for preparing the Escherichia coli competent cells includes:

[0017] Inoculate Escherichia coli into LB medium for cultivation. When the bacteria grow to the late logarithmic growth phase, take the bacterial liquid and inoculate it into LB medium for cultivation for 1.5 - 2 h, then add CaCl2 solution and continue to cultivate for 10 - 15 min to obtain Escherichia coli competent cells.

[0018] In a second aspect, the present application provides an Escherichia coli engineering strain that solubly secretes and expresses recombinant human interferon α2b constructed by the method according to any one of the first aspect, and the Escherichia coli engineering strain includes a recombinant plasmid that solubly secretes and expresses recombinant human interferon α2b.

[0019] Optionally, the recombinant plasmid includes a T7 promoter, a coding gene for the signal peptide PelB, and an optimized human interferon α2b gene arranged in sequence.

[0020] In a third aspect, the present application provides an application of the Escherichia coli engineering strain for soluble secretory expression of recombinant human interferon α2b described in the embodiments of the second aspect, and the Escherichia coli engineering strain is used for producing human interferon α2b.

[0021] The above technical solutions provided by the embodiments of the present application have the following advantages compared with the prior art:

[0022] The present application provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain, including the following steps: S1. Obtain the human interferon α2b gene sequence and perform codon optimization for Escherichia coli; S2. PCR amplify the optimized human interferon α2b gene, perform double digestion on the pET-22b(+) vector, and ligate the double-digested products of the optimized human interferon α2b gene and the vector to obtain a recombinant plasmid; S3. Transform the recombinant plasmid into Escherichia coli competent cells to obtain an Escherichia coli engineering strain for soluble secretory expression of recombinant human interferon α2b. By selecting Escherichia coli as the host, on the one hand, through codon optimization of the human interferon α2b gene, it is made more suitable for expression in Escherichia coli, thereby increasing its yield. On the other hand, when constructing the vector, the secretion signal peptide PelB is introduced to secrete the recombinant human interferon α2b protein into the periplasmic cavity, thus solving the problems of protein inclusion body formation and difficult purification. After codon optimization of the Escherichia coli sequence, the expression level of the recombinant human interferon α2b target protein accounts for more than 50% of the total bacterial protein, and more than 70% exists in the form of soluble protein. For protein purification, after conventional purification steps such as ion exchange and molecular sieve, no denaturation and renaturation are required, and the obtained protein has high activity, reaching 3.5×10 8 IU / mg. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings here are incorporated into the specification and form a part of this specification, showing embodiments consistent with the present application and used together with the specification to explain the principles of the present application.

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0025] Figure 1 It is a schematic flow chart of a method for constructing a recombinant human interferon α2b soluble expression engineering strain provided by an embodiment of the present application;

[0026] Figure 2Agarose gel electrophoresis pattern of PCR amplification of human interferon α2b gene provided by an embodiment of the present application; Lane N is the negative control of the PCR experiment, Lane 1 is the amplification result (510bp) of the human interferon α2b gene after codon optimization in Escherichia coli, and M is the DNA molecular weight marker;

[0027] Figure 3 Agarose gel electrophoresis pattern of double digestion identification provided by an embodiment of the present application; Lanes 1 and 2 are pET-22b(+)-IFNα2b (510bp + 5600bp), and M is the DNA molecular weight marker;

[0028] Figure 4 Agarose gel electrophoresis pattern of colony PCR screening for positive recombinants provided by an embodiment of the present application; Lanes 1, 2, 3, and 4 are the amplification results (510bp) of colony PCR, Lane N is the negative control of colony PCR amplification, and M is the DNA molecular weight marker;

[0029] Figure 5 Escherichia coli clone map after transformation provided by an embodiment of the present application;

[0030] Figure 6 Agarose gel electrophoresis pattern of SDS-PAGE detection of secreted expression of recombinant human interferon α2b provided by an embodiment of the present application; Lane 1 represents the result of non-induced expression of the recombinant plasmid pET22b(+)-IFNα2b in Escherichia coli BL21(DE3) strain; Lane 2 represents the induced expression result of the recombinant plasmid pET22b(+)-IFNα2b in Escherichia coli BL21(DE3) strain; Lane 3 represents the supernatant after centrifugation of the sonicated bacteria after induced expression; Lane 4 represents the precipitate after centrifugation of the sonicated bacteria after induced expression, and M is the protein molecular weight marker. Detailed implementation manners

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are some, but not all, of the embodiments of the present application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present application without creative efforts shall fall within the protection scope of the present application.

[0032] Unless otherwise specifically stated, all kinds of raw materials, reagents, instruments, and equipment used in the present application can be obtained through market purchase or can be prepared by existing methods.

[0033] As Figure 1 shown, the present application provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain, which includes the following steps:

[0034] S1. Obtain the human interferon α2b gene sequence and perform codon optimization for Escherichia coli.

[0035] As a representative of prokaryotes, Escherichia coli has certain preferences in the use of genetic codons. This preference is not only reflected among different genes but may also be closely related to factors such as gene expression level, translation efficiency, and stability. Therefore, during the synthesis of the human interferon α2b gene, codon optimization was carried out in the embodiments of this application. Referring to the codon usage frequency table of Escherichia coli, the codon preferences in Escherichia coli were found, and a codon optimization strategy was designed. During the codon optimization process, it was ensured that the amino acid sequence remained unchanged, and only the codons encoding these amino acids were changed. Moreover, rare codons were replaced with more commonly used codons, increasing the expression level of recombinant human interferon α2b.

[0036] Therefore, this application fully considers the codon preference of Escherichia coli and replaces rare codons in the foreign gene with codons preferred by Escherichia coli to improve the gene expression level and protein yield.

[0037] S2. PCR amplify the optimized human interferon α2b gene, perform double digestion on the pET-22b(+) vector, and ligate the double-digested products of the optimized human interferon α2b gene and the vector to obtain a recombinant plasmid.

[0038] The pET-22b(+) vector is a commonly used prokaryotic expression vector and has wide applications in expressing foreign genes in prokaryotic cells such as Escherichia coli. The pET-22b(+) vector contains a T7 promoter, which is a strong promoter and can efficiently initiate the transcription and translation of foreign genes under the action of T7 RNA polymerase. This vector also carries an N-terminal PelB signal peptide sequence, which can localize the expressed target protein in the periplasmic cavity of the cell. This secretory expression method helps to reduce the interference of the complex intracellular environment, improving the expression efficiency and purity of the protein.

[0039] In the embodiments of this application, in order to achieve the secretory expression of the target protein, a PelB signal peptide sequence was added before the gene sequence of the target protein. This signal peptide is a short peptide chain that can direct the newly synthesized polypeptide chain to transfer to a specific organelle or be secreted from the cell to the outside of the cell. Using the signal peptide PelB (the leader peptide of α-mating factor from yeast) can retain the authenticity of the protein N-terminus, reduce the metabolic burden of the host, thus simplifying the subsequent purification steps, greatly solving the protein purification problems of existing enterprises and the protein denaturation problems caused by the renaturation of inclusion bodies, and saving production costs.

[0040] In some embodiments, the nucleotide sequence of the optimized human interferon α2b gene is as shown in SEQ ID NO.1.

[0041] In some embodiments, the upstream and downstream primer nucleotide sequences of the optimized human interferon α2b gene are as shown in SEQ ID NO.2 to SEQ ID NO.13.

[0042] In some embodiments, the restriction endonucleases used for double digestion are BamH I and Xho I.

[0043] S3. Transform the recombinant plasmid into Escherichia coli competent cells to obtain an Escherichia coli engineering strain that soluble secretes and expresses recombinant human interferon α2b.

[0044] In some embodiments, the transformation is carried out by the calcium chloride method or the electroporation method.

[0045] In some embodiments, after step S3, the method further includes:

[0046] S4. Screen out Escherichia coli clones containing the recombinant plasmid through antibiotic resistance;

[0047] S5. After confirming the positive clone, induce the expression of recombinant human interferon α2b with IPTG, and then detect the secretory expression of recombinant human interferon α2b by sodium dodecyl sulfate-polyacrylamide gel electrophoresis technology.

[0048] In some embodiments, the method for preparing the Escherichia coli competent cells includes:

[0049] Inoculate Escherichia coli into LB medium for cultivation. When the bacteria grow to the late logarithmic growth phase, take the bacterial liquid and inoculate it into LB medium for cultivation for 1.5 - 2 h, and then add CaCl2 solution and continue to cultivate for 10 - 15 min to obtain Escherichia coli competent cells.

[0050] In a second aspect, the present application provides an Escherichia coli engineering strain that soluble secretes and expresses recombinant human interferon α2b constructed by the method according to any one of the first aspect. The Escherichia coli engineering strain includes a recombinant plasmid that soluble secretes and expresses recombinant human interferon α2b.

[0051] In some embodiments, the recombinant plasmid includes a T7 promoter, a coding gene of the signal peptide PelB, and an optimized human interferon α2b gene arranged in sequence.

[0052] In a third aspect, the present application provides an application of the Escherichia coli engineering strain that soluble secretes and expresses recombinant human interferon α2b according to the embodiment of the second aspect. The Escherichia coli engineering strain is used for producing human interferon α2b.

[0053] The present application will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods without specific conditions noted in the following embodiments are generally determined according to industry standards. If there is no corresponding industry standard, they are carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer.

[0054] This embodiment provides a method for constructing a recombinant human interferon α2b soluble expression engineering strain, comprising the following steps:

[0055] S1. Obtain the human interferon α2b gene sequence in NCBI and perform codon optimization for Escherichia coli. The optimized human interferon α2b gene is shown as SEQ ID NO.1 below;

[0056] TGCGACCTGCCGCAGACCCACTCCCTGGGTAGCCGTCGTACCCTGATGCTGCTGGCGCAGATGCGTCGTATCAGCCTGTTCAGCTGCCTGAAAGATCGTCATGACTTCGGTTTCCCGCAGGAAGAGTTCGGCAACCAGTTCCAGAAAGCGGAAACCATCCCGGTTCTGCACGAAATGATCCAGCAGATCTTCAACCTGTTCTCTACCAAAGACAGCAGCGCGGCGTGGGATGAAACGCTGCTGGACAAATTCTATACCGAACTGTACCAGCAGCTGAACGATCTGGAAGCGTGCGTTATCCAGGGCGTTGGCGTTACCGAAAC CCCGCTGATGAAAGAAGATAGCATCCTGGCGGTTCGTAAATACTTCCAGCGTATCACCCTGTACCTGAAAGAGAAAAAGTACAGCCCGTGTGCGTGGGAAGTTGTGCGCGCGGAAATCATGCGCTCCTTCTCCCTGTCTACCAACCTGCAGGAAAGCCTGCGTAGCAAAGAA

[0057] S2. Design upstream and downstream primers according to the nucleotide sequence of the optimized human interferon α2b gene, and synthesize the human interferon α2b gene sequence by overlapping PCR. The designed primer sequences are shown in Table 1:

[0058] Table 1 Primer design table for optimized modification of the recombinant human interferon α2b coding gene

[0059]

[0060] Mix the 12 primers designed and synthesized in Table 1 and perform a PCR pre-reaction with Taq DNA Polymerase (Takara, Code No. 639208). The PCR reaction system is shown in Table 2.

[0061] Table 2 PCR reaction system

[0062]

[0063]

[0064] Perform the reaction using a JS-G9612 PCR instrument from Shanghai Peiqing Technology Co., Ltd. The PCR cycling conditions are shown in Table 3.

[0065] Table 3 PCR cycling conditions

[0066]

[0067] Specific amplified product fragments of approximately 510 bp were obtained by PCR amplification, namely the IFN-α2b gene after codon optimization of Escherichia coli, as Figure 2 shown. Gel extraction and purification were performed on the PCR products.

[0068] The purified fragment was double digested with BamH I (Takara, Code No. 1010S) and Xho I (Takara, Code No. 1094S). The recombinant expression vector pET-22b(+) plasmid (Novagen, Catalog No. 70765-M) was also double digested with BamH I and Xho I. The digestion system is shown in Table 4.

[0069] Table 4 Digestion system

[0070]

[0071]

[0072] Ligate the digested and purified IFN-α2b fragment with the prokaryotic expression vector pET-22b(+) plasmid digested with the same enzymes using T4 DNA ligase (Takara, Code.No. 2011A). Mix the above system, centrifuge briefly, and incubate at 16 °C overnight. The ligation reaction system is shown in Table 5:

[0073] Table 5 Ligation reaction system

[0074] Component Volume 10×T4DNA ligase buffer 2.0 μl Digested IFN-α2b fragment 2.0 μl Digested pET-22b(+) plasmid 10.0 μl T4DNA ligase 1.0 μl ddH2O 5.0 μl Total volume 20.0 μl

[0075] S3. Take the E. coli TOP10 strain cultured overnight with shaking at 37°C, inoculate it into LB liquid medium, and culture it overnight with shaking at 37°C; the next day, transfer it again into LB liquid medium with an inoculation amount of 0.1%, and culture it with shaking at 37°C for 2 h until the OD600 of the bacterial liquid is 0.4 - 0.6; after ice-bathing for 30 min; after ice-bathing, centrifuge at 4°C and 4000 rpm for 10 min to collect the bacteria. Suspend the cells with pre-cooled 0.1 M CaCl2 solution, centrifuge again to collect the cells, and suspend the cells again with pre-cooled 0.1 M CaCl2 solution to obtain E. coli TOP10 competent cells; use the calcium chloride method to transform the recombinant plasmid into the E. coli competent cells. The ligation product is transformed into E. coli TOP10 competent cells, spread on an LB screening plate containing 100 mg / L Amp, pick monoclonal colonies, extract the plasmid after culturing and amplification, and perform double digestion identification with BamH I and Xho I. For the recombinant plasmid with the correct size, as shown in Figure 3 shown, send it to BGI for gene sequence determination. The recombinant plasmid with correct sequencing is named pET-22b(+)-IFNα2b. Transform the recombinant plasmid pET-22b(+)-IFNα2b with correct sequencing into the competent cells of the E. coli expression strain BL21(DE3) (Novagen, Catalog No. 69450), and spread on an LB screening plate containing 100 mg / L Amp. The expression strains are respectively named BL21(DE3) / pET-22b(+)-IFNα2b.

[0076] S4. The transformed E. coli cells are screened by colony PCR, and the results are as shown in Figure 4 shown to confirm whether the recombinant plasmid has been successfully introduced and used for subsequent protein expression experiments. The transformed E. coli clone map is as shown in Figure 5 shown.

[0077] S5. After confirming the positive clones, IPTG was used to induce the expression of recombinant human interferon α2b, and then Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis was used to detect the secretory expression of recombinant human interferon α2b. Single colonies of BL21(DE3) / pET-22b(+)IFNα2b were picked from an LB plate containing 100 mg / L Amp and inoculated into a 5-ml LB liquid test tube medium containing 100 mg / L Amp. The culture was carried out at 37 °C and 180 rpm until the OD value reached approximately 0.6. IPTG (final concentration of 1 mM) was added, and the induction expression was carried out at 30 °C and 180 rpm. At the same time, a control bacterium without IPTG was set. After 8 hours, the cells were harvested by centrifugation at 4000 rpm for 4 min. After washing twice with PBS buffer, protein loading buffer was added, and the mixture was boiled in a boiling water bath for 5 min. After centrifugation at 12000 rpm for 2 min, the supernatant was used for SDS-PAGE detection. A 12% polyacrylamide gel was prepared, and the above-treated samples were added. The upper gel was electrophoresed at a voltage of 8 V / cm, and the separating gel was electrophoresed at a voltage of 15 V / cm. When the bromophenol blue reached the bottom of the separating gel, the electrophoresis was stopped. The separating gel was cut off, stained with Coomassie Brilliant Blue for 1 h, and then decolorized with a decolorizing solution. After the protein bands were clear, they were photographed. The electrophoresis pattern of SDS-PAGE for detecting the secretory expression of recombinant human interferon α2b is as shown in Figure 6 . After optimizing the codon sequence of Escherichia coli, the expression level of the recombinant human interferon α2b target protein accounted for more than 50% of the total bacterial protein, and more than 70% existed in the form of soluble protein. For the purification of the protein, after conventional purification steps such as ion exchange and molecular sieve, no denaturation and renaturation were required, and the obtained protein had high activity, reaching 3.5×10 8 IU / mg.

[0078] The various embodiments of the present application may exist in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be construed as a rigid limitation on the scope of the present application; therefore, it should be considered that the described range description has specifically disclosed all possible sub-ranges and single values within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any cited number (fraction or integer) within the indicated range.

[0079] In addition, in the description of the specification of this application, terms such as "include" and "comprise" mean "include but not limited to". In this text, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. In this text, "and / or" describes the associated relationship of associated objects and indicates that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. Where A and B can be singular or plural. In this text, "at least one" means one or more, and "a plurality" means two or more. "At least one kind", "at least one of the following items" or similar expressions refer to any combination of these items, including any combination of single item or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can both represent: a, b, c, a - b (i.e., a and b), a - c, b - c, or a - b - c, where a, b, and c can be single or multiple respectively.

[0080] The above are only specific embodiments of this application, enabling those skilled in the art to understand or implement this application. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of this application. Therefore, this application will not be limited to these embodiments shown herein, but rather to the broadest scope consistent with the principles and novel features claimed herein.

Claims

1. A method for constructing a recombinant human interferon α2b soluble expression engineering strain, characterized in that, It includes the following steps: S1. Obtain the human interferon α2b gene sequence and perform codon optimization for Escherichia coli; S2. PCR amplify the optimized human interferon α2b gene, perform double digestion on the pET-22b(+) vector, and ligate the double-digested products of the optimized human interferon α2b gene and the vector to obtain a recombinant plasmid; S3. Transform the recombinant plasmid into Escherichia coli competent cells to obtain an Escherichia coli engineering strain that can secrete and express recombinant human interferon α2b in a soluble manner.

2. The method according to claim 1, characterized in that, The nucleotide sequence of the optimized human interferon α2b gene is shown in SEQ ID NO.

1.

3. The method according to claim 1, wherein The nucleotide sequences of the upstream and downstream primers of the optimized human interferon α2b gene are shown in SEQ ID NO.2 to SEQ ID NO.

13.

4. The method according to claim 1, characterized in that The restriction endonucleases used for the double digestion are BamH I and Xho I.

5. The method according to claim 1, characterized in that, The transformation is carried out by the calcium chloride method or the electroporation method.

6. The method according to claim 1, characterized in that After step S3, the method further includes: S4. Screen out Escherichia coli clones containing the recombinant plasmid through antibiotic resistance; S5. After confirming the positive clones, induce the expression of recombinant human interferon α2b with IPTG, and then detect the secreted expression of recombinant human interferon α2b by sodium dodecyl sulfate-polyacrylamide gel electrophoresis technology.

7. The method according to claim 1, wherein The method for preparing the Escherichia coli competent cells includes: Inoculate Escherichia coli into LB medium and culture it. When the bacteria grow to the late logarithmic growth phase, take the bacterial liquid and inoculate it into LB medium for culture for 1.5 - 2 h, then add CaCl2 solution and continue to culture for 10 - 15 min to obtain Escherichia coli competent cells.

8. An Escherichia coli engineering strain for soluble secreted expression of recombinant human interferon α2b constructed by the method according to any one of claims 1 to 7, characterized in that, The Escherichia coli engineering strain includes a recombinant plasmid that can secrete and express recombinant human interferon α2b in a soluble manner.

9. The engineered Escherichia coli strain according to claim 7, characterized in that, The recombinant plasmid includes a T7 promoter, a coding gene for the signal peptide PelB, and the optimized human interferon α2b gene arranged in sequence.

10. Use of an engineered Escherichia coli strain for soluble secreted expression of recombinant human interferon α2b according to claim 8 or 9, characterized in that, The Escherichia coli engineering strain is used for the production of human interferon α2b.