Application and product of Snord11 gene and Snord11 gene inhibitor

Abstract

The invention belongs to the technical field of biology, and relates to application and products of a snoRNA-Snord11 gene and a Snord11 gene inhibitor. When the heart ischemia reperfusion injury occurs, the mRNA expression level of the Snord11 is remarkably up-regulated and is highly related to the myocardial cell ferroptosis, and the occurrence of the myocardial cell ferroptosis can be remarkably inhibited by silencing the Snord11. The Snord11 gene provided by the invention can be used as a diagnostic marker and a therapeutic target of the heart ischemia-reperfusion injury, and the knock-down of Snord11 gene expression effectively alleviates the problems of poor prognosis of patients with the ischemia-reperfusion injury and heart disease treatment. The Snord11 gene inhibitor can be used as a therapeutic drug of the Snord11 gene inhibitor, and a new basis is provided for poor prognosis and heart disease treatment of patients suffering from heart ischemia-reperfusion injury.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the applications and products of a snoRNA-Snord11 gene and an inhibitor of the Snord11 gene. Background Art

[0002] Cardiovascular diseases have become the diseases with the highest mortality rate among Chinese residents, and ischemic heart disease is the leading cause of death from cardiovascular diseases in China. Timely reperfusion and improvement of blood supply during acute cardiac ischemia-reperfusion are essential steps in treatment. However, this process can cause severe myocardial injury, known as I / R injury, and there is a lack of effective clinical intervention measures. Therefore, it is crucial to explore the diagnosis and treatment options for cardiac ischemia-reperfusion.

[0003] SnoRNA is a class of highly conserved and abundant non-coding RNAs. With the development of high-throughput sequencing technology, more and more studies have confirmed that snoRNA is involved in the occurrence of cancer, metabolic diseases, neurodevelopmental disorders, and degenerative diseases. Because it is relatively stable and easy to detect in body fluids, it can be used as a biomarker for clinical diagnosis and prognosis. Recently, studies have confirmed the role of snoRNA in heart development and congenital heart diseases, as well as their dynamic regulation in cardiovascular diseases such as hypertrophic and dilated cardiomyopathy, coronary heart disease, cardiac ischemia-reperfusion, cardiac fibrosis, and heart failure.

[0004] As a member of snoRNA, Snord11 is enriched in the nucleolus, metabolically stable, usually interacts with core proteins to form ribonucleoprotein complexes, and then guides modification through interaction with complementary base repair. Snord11 can regulate cardiac-related signaling pathways, oxidative and metabolic cellular stress, gene expression, and cell-to-cell communication, fully demonstrating its potential as a biomarker for cardiovascular diseases and an innovative method for treating cardiac ischemia-reperfusion injury by targeting Snord11.

[0005] Ferroptosis is a new type of iron-dependent programmed cell death discovered by the Brent. R. Stockwell laboratory at Columbia University in 2012. It is induced by the excessive accumulation of peroxidized lipids, and its morphological characteristics, mode of action, and molecular mechanism are completely different from other programmed cell death methods. Since then, ferroptosis has become a new hot spot in the field of cell death research. Studies have found that the ferroptosis pathway in cells is involved in the occurrence process of cardiovascular system diseases, and the ferroptosis inhibitor Ferrostatin-1 can inhibit the ferroptosis pathway in cells and reduce the injury in a rat model of cardiac ischemia-reperfusion. Therefore, a new treatment method, based on cellular ferroptosis and relying on antisense oligonucleotides (ASO) as an inhibitor of the Snord11 gene, can effectively treat cardiac ischemia-reperfusion injury.

[0006] Intravenously injecting Snord11 ASO as an inhibitor of the Snord11 gene into the body and delivering it to the location of the heart disease lesion is a promising clinical intervention. Due to its specificity and gene silencing function, ASO is expected to become a fundamental method for treating various infectious, hematological malignancies, cardiovascular, and neurodegenerative diseases. ASO can bind complementarily to the target mRNA molecule, and through this binding, ASO can block the translation process of mRNA, thereby reducing or silencing the expression of specific proteins. Summary of the Invention

[0007] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide an application and product of snoRNA-Snord11 gene and Snord11 gene inhibitor.

[0008] An inhibitor of the Snord11 gene, the nucleic acid sequence of the Snord11 gene is shown as SEQ ID NO.1: SEQ ID NO.1: GTGTTCAATGATGATTTCTGATGCTTTGCCTGAGTTCTCTTTGAATAATGAGGGCAGCTTCAGTCACTACCTCTTCTGAGACAC; The Snord11 gene inhibitor is Snord11 ASO, and the nucleic acid sequence is shown as SEQ ID NO.2: SEQ ID NO.2: TTATTCAAAGAGAACTCAGG.

[0009] The product is a kit for detecting ferroptosis of cardiomyocytes, and the kit includes primers for amplifying the RNA transcribed by the Snord11 gene: Snord11-F and Snord11-R, and the nucleic acid sequences are shown as SEQ ID NO.3 and SEQ ID NO.4: SEQ ID NO.3 GTTCAATGATGATTTCTGATGCTTTGC; SEQ ID NO.4 GTGTCTCAGAAGAGGTAGTGACTG.

[0010] The present invention also provides the application of the above Snord11 gene inhibitor in a drug for diagnosing and / or treating heart diseases.

[0011] Compared with the prior art, the present invention has the following beneficial effects: It has been found through research that during the occurrence of cardiac ischemia-reperfusion injury, the mRNA expression level of snoRNA-Snord11 is significantly upregulated and highly correlated with ferroptosis of cardiomyocytes; silencing Snord11 can significantly inhibit cardiac ischemia-reperfusion injury. Therefore, Snord11 plays an important role in the regulation of cardiomyocyte death.

[0012] The Snord11 gene provided by the present invention can be used as a marker for the occurrence of ferroptosis in cardiomyocytes and in a kit for detecting ferroptosis of cardiomyocytes. An inhibitor of the Snord11 gene can be used as a therapeutic drug for cardiac ischemia-reperfusion injury. Silencing Snord11 can significantly reduce cardiomyocyte death and activate the repair of damaged myocardial tissue. Knockdown of the expression of the Snord11 gene effectively alleviates the problems of poor prognosis in patients with ischemia-reperfusion injury and the treatment of heart diseases. Based on Snord11 ASO, an inhibitor of the Snord11 gene was constructed and delivered to the location of the heart disease lesion, which can be used as a drug for treating myocardial ischemia-reperfusion to achieve effective treatment of the lesion. Brief Description of the Drawings

[0013] Figure 1 It shows the mRNA expression level of Snord11 in the hypoxia / reoxygenation (H / R) model of primary cardiomyocytes from neonatal rats and the ischemia-reperfusion injury model established in adult mice; Figure 2 It shows the mRNA expression level of Snord11 in primary cardiomyocytes after silencing Snord11 in primary cardiomyocytes; Figure 3 It shows the mortality rate of cardiomyocytes after primary cardiomyocytes were treated with H / R and Snord11 was silenced; Figure 4 It shows the level of reactive oxygen species (ROS) in cardiomyocytes after primary cardiomyocytes were treated with H / R and Snord11 was silenced; Figure 5 It shows the level of malondialdehyde (MDA) in cells after primary cardiomyocytes were treated with H / R and Snord11 was silenced; Figure 6 It shows the level of Fe ions in cells after primary cardiomyocytes were treated with H / R and Snord11 was silenced; Figure 7 It shows the expression level of ferroptosis-related proteins in cells after primary cardiomyocytes were treated with H / R and Snord11 was silenced. Detailed Embodiments

[0014] The embodiments of the present invention will be described in detail below in combination with the embodiments and examples. However, those skilled in the art will understand that the following embodiments and examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention. Those not specified in specific conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not specified in the manufacturer are all conventional products that can be obtained through commercial purchase.

[0015] The endpoints and any values disclosed in this text are not limited to the exact range or value. These ranges or values should be understood to include values close to these ranges.

[0016] Example 1: The mRNA expression level of Snord11 in primary neonatal cardiomyocytes and adult mice with ischemia-reperfusion injury model.

[0017] (1) Culture of primary neonatal cardiomyocytes Cardiomyocytes were isolated from 1- to 2-day-old neonatal mice (C57BL / 6). The neonatal mice were washed with 75% alcohol. In a sterile environment, the heart was removed with surgical scissors and placed in a petri dish containing pre-cooled PBS. The heart was washed three times with PBS. The heart tissue was minced with surgical scissors and transferred to 10 mL of digestive solution (1.2 mg / mL trypsin and 0.14 mg / mL collagenase II). It was gently shaken in a 37°C water bath for 6 min. After each digestion, the supernatant was transferred to a centrifuge tube containing serum, and the centrifuge tube was stored on ice. Fresh digestive solution was added again until the heart tissue disappeared. Centrifuge at 1000 rpm / min for 10 min, take the supernatant, resuspend it with F12 / DMEM containing 10% serum, centrifuge again at 1000 rpm / min for 10 min, take the supernatant, filter it through a 70-mesh cell strainer. The filtered cardiomyocytes were placed in a 10 cm petri dish and cultured in a 5% CO2 humidified incubator at 37°C for 1.5 h. The fibroblasts adhered to the wall. The medium containing cardiomyocytes was collected into a new centrifuge tube, centrifuged at 1000 rpm / min for 10 min, discard the supernatant, resuspend it with a new medium containing serum, and add 0.1 mM bromodeoxyuridine (BrdU). Plate according to the experimental design and place it in a 5% CO2 humidified incubator at 37°C for culture. The next day, change the medium in the petri dish and continue to culture for one more day.

[0018] (2) Cardiomyocyte H / R model According to the experimental grouping, the cells that need to be hypoxic were placed in a hypoxic incubator for 18 hours, and then the normal culture medium was replaced and the cells were reoxygenated in the normal culture medium for 6 hours, followed by subsequent experiments.

[0019] (3) Mouse myocardial ischemia-reperfusion model 8-week-old male C57BL / 6J mice were purchased from Jinan Pengyue Laboratory Animal Breeding Center in Shandong Province. All animal experiments were completed under the guidance of the Ethics Committee of the Laboratory Animal Center of Qingdao University. The animals had free access to food during the experiment. All animal studies complied with the European Parliament Directive 2010 / 63 / EU and had been approved by the Biomedical Research Ethics Committee of Qingdao University (Permit No.: 20200610C576620221208124). After the mice were anesthetized with anesthetic, a ventilator was inserted for ventilation. The parameters of the ventilator were set according to the physiological conditions of the mice. At the same time, an electric blanket was placed on the back to maintain the body temperature of the mice. The chest hair of the mice was removed, and a small gap was carefully made between the third and fourth ribs with micro forceps. After seeing the heart, the pericardium was slowly dissected. The heart was gently moved to the side, and the blood vessel was ligated with a 6-0 suture at the left anterior descending branch of the coronary artery. After 45 min, the suture was loosened to allow the heart to reperfuse. Subsequently, the third and fourth ribs, skin, and muscle were sutured with a 4-0 suture, and the mice were allowed to continue breathing on the ventilator for more than 30 min. The limbs of the mice were gently pinched until the mice responded, and then the ventilator was removed.

[0020] (4) Real-time fluorescence quantitative PCR (RT-qPCR) Total RNA was extracted from mouse cardiomyocytes or tissues using TRIzol reagent, and the concentration and purity of the total RNA were measured using a nanodrop One. The total RNA was converted into cDNA using an AG Evo M-MLV RT Kit reverse transcription kit. Fluorescence quantitative PCR was performed using a SYBR Green Kit. RT-qPCR was performed using a CFX96 real-time fluorescence quantitative PCR detection system. Reaction conditions: 95°C for 10 min; 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles. The experimental results were qualitatively analyzed for relative expression levels using the 2 -△△Ct method. The qPCR primer sequences were as follows: Note: Snord11-F and Snord11-R were used for the amplification of RNA transcribed from the Snord11 gene; GAPDH-F and GAPDH-R were used for the amplification of RNA transcribed from the GAPDH gene.

[0021] Results: As Figure 1As shown, compared with the control group, the mRNA expression level of Snord11 gene was significantly up-regulated in the primary cardiomyocyte H / R model of neonatal mice (p<0.001), and it was also significantly up-regulated in the cardiac ischemia-reperfusion injury model of experimental mice (p<0.001).

[0022] Example 2: Expression level of Snord11 mRNA after silencing Snord11 in primary cardiomyocytes.

[0023] (1) Construction of ASO The nucleic acid sequence of the Snord11 gene inhibitor (Snord11 ASO) is shown in SEQ ID NO.2 and was synthesized by GenePharma Co., Ltd.

[0024] (2) Cell transfection mediated by Lipofectamine® 3000 ① Isolate primary cardiomyocytes from neonatal mice, and wait for treatment after changing the medium. ② Take a 1.5 mL EP tube, make a label, aspirate 1 mL of high-glucose DMEM medium and add it to the 1.5 mL EP tube, add 5 μL of ASO, add 3.75 μL of Lipofectamine® 3000, gently pipette and mix well, and let it stand at room temperature.

[0025] ③ Take out the six-well plate from the cell culture incubator, discard the original medium, and rinse with PBS.

[0026] ④ Add the solution in ③ to the corresponding six-well plate, and place the six-well plate in the incubator for 6 h.

[0027] ⑤ After culturing for six hours, discard the original medium, add fresh medium, and place the six-well plate in the incubator for continued culture for 24 - 48 h.

[0028] Results: As Figure 2 shown, Snord11 ASO was designed, and the expression level of Snord11 mRNA was detected by RT-qPCR to detect its silencing efficiency. Compared with the control group, the expression level of Snord11 gene in the cells was significantly down-regulated (p<0.001). The results showed that ASO was successfully constructed in the cell model.

[0029] Example 3: Cell viability of primary cardiomyocytes after H / R treatment and silencing of Snord11 gene.

[0030] Detection of cell viability Cell viability was detected using a commercial CCK-8 assay kit purchased from TargetMol (Shanghai, China). When isolating primary cardiomyocytes, the primary cardiomyocytes obtained from each neonatal mouse were sufficient to seed 10 wells of a 96-well plate. After the cells were transfected and subjected to H / R treatment for the required time, the medium in the 96-well plate was discarded, and 90 μL of DMEM / F12 and 10 μL of CCK-8 mixture were added to each well. The 96-well plate was then placed back into the cell culture incubator and cultured for 2 - 4 h. Subsequently, the absorbance at 450 nm was measured using a microplate reader. Cell viability = (experimental well / control well) * 100%.

[0031] Results: As Figure 3 shown, when detected using the CCK-8 cell viability assay kit, compared with the control group, the viability of primary neonatal cardiomyocytes decreased after the addition of ferroptosis inducer (p < 0.001). After transfection with Snord11 ASO, the cell viability increased compared with that of the inducer-treated group (p < 0.001). After H / R, the cell viability decreased significantly compared with the control group (p < 0.001), but after transfection with Snord11 ASO, the cell viability increased significantly (p < 0.001). These results demonstrated that Snord11 gene was closely associated with ferroptosis in cardiomyocytes.

[0032] Example 4: Expression level of ROS in primary cardiomyocytes after H / R treatment and silencing of Snord11 gene.

[0033] Detection of lipid ROS Lipid ROS in cells and tissues was detected using the C11-BODIPY probe purchased from Abbkine (Wuhan, China). C11-BODIPY was diluted with PBS to a final concentration of 10 μM, and 50 μL of the staining solution was added to each well and stained at 37 °C for 1 h. 1 mL of PBS was added to the 24-well plate for washing, and the washing was repeated 3 times. After DAPI staining and washing with PBS, the coverslip was sealed. Relevant fluorescence signal images were collected using a laser confocal fluorescence microscope under excitation at 488 nm and 565 nm. When C11-BODIPY is excited by blue laser (488 nm), its emission wavelength is 595 nm. Once the lipids in the cells are oxidized, the fluorescence will migrate from 595 nm to 510 nm, which is proportional to the production of lipid oxidation reactive oxygen species. For heart tissue, the heart tissue was cryosectioned, and after rewarming, it was washed 3 times with PBS, followed by C11-BODIPY staining and DAPI counterstaining.

[0034] Results: As Figure 4As shown, cells will undergo peroxidation after hypoxia / reoxygenation, leading to an increase in intracellular ROS levels. After detection with the ROS kit, compared with the control group, the ROS levels in primary neonatal rat cardiomyocytes were significantly increased after H / R treatment (p<0.001). After transfection with the ASO of Snord11, the ROS levels in the cells were significantly decreased compared with those after H / R treatment (p<0.001).

[0035] Example 5: Levels of MDA in primary cardiomyocytes after H / R treatment and after silencing the Snord11 gene

[0036] Detection of MDA content The MDA detection kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd. According to the kit operation instructions, a TBA storage solution with a final concentration of 0.37% was prepared with TBA preparation solution. The MDA working solution was prepared according to the number of test samples, with the volume ratio of TBA diluent: TBA storage solution: antioxidant being 150:50:3, and vortexed vigorously at 70 °C to dissolve the MDA detection working solution. MDA standards were taken and serially diluted according to the instructions, with concentrations of 0, 1, 2, 5, 10, and 20 μM, respectively, to plot the standard curve. Cardiomyocytes were digested with lysis buffer to measure the total protein content. 100 μL of the test sample and 200 μL of the MDA working solution were mixed in a 1.5 mL EP tube and boiled for 15 min. When boiling, a metal block was used to press on the centrifugal tube mouth to prevent liquid from boiling over and sample loss. The EP tube was placed on a floating device and placed in water to cool slowly. Centrifuge at 1000 g for 10 min. Take 200 μL of the supernatant and transfer it to a 96-well plate, and measure the absorbance at 562 nm with an enzyme-linked immunosorbent assay (ELISA) reader. A standard curve of y (OD value)=kx (concentration)+b was made based on the OD value and the concentration of MDA. The OD value measured for the sample was substituted into the standard curve formula to calculate the concentration of MDA. Finally, the content of MDA was expressed as the concentration of MDA contained in a unit mass of the sample.

[0037] Results: As Figure 5 shown, compared with the control group, the MDA levels in primary neonatal rat cardiomyocytes were significantly increased after H / R treatment (p<0.001). After transfection with the ASO of Snord11, the MDA levels in the cells were significantly decreased compared with those after H / R treatment (p<0.001).

[0038] Example 6: Levels of Fe ions in primary cardiomyocytes after H / R treatment and after silencing the Snord11 gene

[0039] Prussian blue iron ion staining When performing Prussian blue staining, we used a commercial kit purchased from Solarbio. The cut tissue sections should be transferred from room temperature to an environment of 60 °C, which is beneficial for the subsequent dewaxing process. Immerse the sections in a staining jar containing two baths of xylene for 20 min. Immerse the sections in a staining jar containing two baths of alcohol for 10 min. Then soak them in gradient alcohol for 3 min each. Finally, place them in pure water and let stand for 1 min. Mix equal amounts of Prussian blue solution A and B as the Prussian blue staining solution. Drop an appropriate amount of Prussian blue staining solution on each slide, cover with plastic wrap and stain for 30 min. Slowly wash with single-distilled water for 5 min to remove the unbound Prussian blue staining solution, then add 200 μL of nuclear fast red dye and stain for 5 min, and rinse with tap water for 5 min. Subsequently, re-immerse the slides in gradient ethanol for 15 s and xylene for 15 s. Dip a blue pipette tip into neutral gum and drop it on the glass slide. Use a whole coverslip and clamp it with forceps and slowly cover it from the side in contact with the neutral gum, taking care not to produce bubbles. After the neutral gum has solidified, place it under an optical microscope and take bright-field photos. For Prussian blue iron ion staining of cells, after the cells are fixed, the subsequent steps are the same as those for tissue staining.

[0040] Results: As Figure 6 shown, after hypoxia / reoxygenation treatment of the cells, the intracellular Fe ion level changed. After detection with the Fe ion kit, compared with the control group, the Fe ion level in primary neonatal rat cardiomyocytes was significantly increased after H / R treatment (p < 0.001). After transfection with the ASO of Snord11, the Fe ion level in the cells was significantly decreased compared with that after H / R treatment (p < 0.001).

[0041] Example 7: Expression levels of ferroptosis-related proteins in primary cardiomyocytes after H / R treatment and silencing of the Snord11 gene.

[0042] Western blot assay Extract total proteins from cardiomyocytes or tissues using RIPA and PMSF. Measure the total protein concentration with a BCA kit and read the OD value with an enzyme-linked immunosorbent assay reader. Add protein loading buffer to the protein samples according to the concentration, at 95 °C for 10 min. Perform SDS-PAGE electrophoresis on the protein samples and transfer them to a PVDF membrane, and use specific antibodies to detect protein expression. The antibodies used are as follows: Glutathione Peroxidase 4 (GPX4) (Zheneng Bio, Cat: 381958, 1:1000); GAPDH (ABclonal, Cat: A19056, 1:5000).

[0043] Results: As Figure 7As shown, in order to verify the occurrence of ferroptosis in cardiomyocytes during cardiac ischemia-reperfusion injury, GPX4 is a marker protein of ferroptosis. It was detected by Western Blot. Compared with the control group, the protein level of GPX4 in primary cardiomyocytes of neonatal rats was significantly increased after H / R treatment (p<0.05). However, after transfection with the ASO of Snord11, the protein level of GPX4 in the cells was significantly decreased compared with that after H / R treatment (p<0.001), and ferroptosis of cardiomyocytes was alleviated.

[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An inhibitor of the Snord11 gene, characterized in that, The nucleic acid sequence of the Snord1l gene is shown in SEQ ID NO.1; the Snord11 gene inhibitor is Snord11 ASO, and the nucleic acid sequence is shown in SEQ ID NO.

2.

2. A kit for detecting ferroptosis of cardiomyocytes, characterized in that, The kit includes primers for amplifying the RNA transcribed by the Snord11 gene: Snord11-F and Snord11-R, and the nucleic acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. Use of the Snord11 gene inhibitor according to claim 1 in a medicament for diagnosing and / or treating heart diseases.

Images