Methods of treating cancer using anti-DDR1 antibodies

Abstract

Methods and dosage regimens for treating cancer using antibodies that specifically bind to human DDR1 are provided.

Description

[0001] Cross - reference to related applications

[0002] This application claims the priority of U.S. Provisional Application Serial No. 63 / 383,942, filed on November 16, 2022, and U.S. Provisional Application Serial No. 63 / 519,929, filed on August 16, 2023. The content of each of these related applications is hereby incorporated by reference in its entirety.

[0003] Reference to sequence listing

[0004] This application is filed with a sequence listing in electronic format. The sequence listing is provided as a file named INCEN010WOseqlist.xml, created on November 15, 2023, and having a size of 14,021 bytes. The information in the electronic format of the sequence listing is hereby incorporated by reference in its entirety into this application. Technical field

[0005] The present disclosure relates to methods of treating discoidin domain receptor tyrosine kinase 1 (DDR1)-related disorders by administering anti - DDR1 antibodies. Background art

[0006] Cancer immune exclusion is a cancer phenotype characterized by a spatial imbalance where more immune cells are proximal to the tumor, but fewer immune cells are in physical contact with tumor cells, and it is prevalent in a high proportion of tumors. Transforming immune - excluded tumors into immune - accessible ones is an active area of oncology research.

[0007] Accordingly, there remains an unmet medical need for treatment options for immune - excluded cancers. Summary of the invention

[0008] Discoidin domain receptor tyrosine kinase 1 (DDR1) is a receptor tyrosine kinase that is widely expressed in normal and transformed epithelial cells and is activated by various types of collagen. DDR1 autophosphorylation is achieved by all collagens (type I to type VI) tested to date. DDR1 is mainly expressed in normal epithelial cells and is aberrantly overexpressed in a variety of human cancers. Its expression is associated with tumor progression, including breast cancer, lung cancer, ovarian cancer, liver cancer, gastric cancer, and glioma. Elevated DDR1 signatures are associated with more immune - cold tumors and reduced responsiveness to immune checkpoint inhibitor therapy in non - small cell lung cancer.

[0009] 9H-1 is a first-in-class humanized monoclonal antibody targeting human DDR1 and is designed to disrupt the tumor stroma and allow the subject's own immune cells to infiltrate the tumor to destroy it. Robust single-agent activity has been observed in a variety of preclinical tumor models. Thus, 9H-1 may provide an effective treatment for cancers, particularly cancers with immune rejection.

[0010] Embodiments of the present disclosure relate to methods for reducing immune rejection of a tumor and / or reducing tumor burden in a subject in need thereof, the methods using an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1). Embodiments are also provided for specific dosing regimens for administering an antibody that specifically binds to human DDR1.

[0011] The present disclosure provides the following numbered embodiments: 1. A method for reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at a dose of 5 mg to 2000 mg.

[0012] 2. A method for reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at a dose of 5 mg to 2000 mg.

[0013] 3. The method according to embodiment 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 1600 mg.

[0014] 4. The method according to embodiment 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 800 mg.

[0015] 5. The method according to any one of embodiments 1-4, wherein the antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg or about 1600 mg.

[0016] 6. The method according to any one of embodiments 1-5, wherein the antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg or 1600 mg.

[0017] 7. The method according to any one of embodiments 1-6, wherein the antibody is administered intravenously.

[0018] 8. The method according to any one of embodiments 1-7, wherein the antibody is administered by intravenous infusion within 60 minutes.

[0019] 9. The method according to any one of embodiments 1-7, wherein the antibody is administered by intravenous infusion within 30 minutes.

[0020] 10. The method according to any one of embodiments 1-9, wherein the antibody is administered once a week.

[0021] 11. The method according to any one of embodiments 1-9, wherein the antibody is administered once every two weeks.

[0022] 12. The method according to any one of embodiments 1-9, wherein the antibody is administered once every three weeks.

[0023] 13. The method according to any one of embodiments 1-9, wherein the antibody is administered once every four weeks.

[0024] 14. The method according to any one of embodiments 1-9, wherein the antibody is administered once every eight weeks.

[0025] 15. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 8 mg once every three weeks.

[0026] 16. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 24 mg once every three weeks.

[0027] 17. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 80 mg once every three weeks.

[0028] 18. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 240 mg once every three weeks.

[0029] 19. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 400 mg once every three weeks.

[0030] 20. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 800 mg once every three weeks.

[0031] 21. The method according to any one of embodiments 1-9, wherein the antibody is administered intravenously at a dose of 1600 mg once every three weeks.

[0032] 22. The method according to any one of embodiments 1-21, wherein the dose is a therapeutically effective amount.

[0033] 23. The method according to any one of the foregoing embodiments, wherein the subject has cancer.

[0034] 24. The method according to embodiment 23, wherein the antibody is administered to treat the cancer in the subject.

[0035] 25. The method according to embodiment 23 or 24, wherein the cancer expresses DDR1.

[0036] 26. The method according to any one of embodiments 23-25, wherein the cancer is a solid cancer.

[0037] 27. The method according to any one of embodiments 23-26, wherein the cancer is locally advanced or metastatic solid cancer.

[0038] 28. The method according to any one of embodiments 23-27, wherein the cancer is unresectable.

[0039] 29. The method according to any one of embodiments 23-28, wherein the cancer is refractory to immunotherapy.

[0040] 30. The method according to embodiment 29, wherein the immunotherapy is an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM-3 antibody, an antagonist anti-LAG- 3 antibody, an antagonist anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody or an agonist anti-CD28 antibody.

[0041] 31. The method according to any one of embodiments 23-30, wherein the cancer is not sarcoma, hepatocellular carcinoma or glioma.

[0042] 32. The method according to any one of embodiments 23-31, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, intrahepatic cholangiocarcinoma (iCCA) or bone cancer.

[0043] 33. A method according to any one of embodiments 23 - 32, wherein the cancer is colorectal cancer, intrahepatic cholangiocarcinoma (iCCA), ovarian cancer, or non - small cell lung cancer.

[0044] 34. A method according to embodiment 33, wherein the colorectal cancer is microsatellite stable (MSS).

[0045] 35. A method according to any one of embodiments 23 - 34, wherein the subject is not a candidate for standard of care treatment.

[0046] 36. A method according to any one of embodiments 23 - 35, wherein the cancer is refractory to standard of care treatment.

[0047] 37. A method according to any one of embodiments 23 - 36, wherein the subject is intolerant to standard of care treatment.

[0048] 38. A method according to embodiment 36 or 37, wherein the standard of care treatment is chemotherapy or radiation.

[0049] 39. A method according to any one of embodiments 1 - 38, wherein administering the antibody reduces the tumor size in the subject.

[0050] 40. A method according to any one of the foregoing embodiments, wherein prior to administering the antibody, the subject: a) has confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically documented advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which no standard treatment is available for the cancer; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1; d) has an expected lifespan of ≥ 3 months; e) has one or more of the following: i) a calculated creatinine clearance rate (CrCL) ≥ 50 mL / min as calculated by the Cockcroft - Gault formula; ii) a total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) Hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 10 9 cells / L; or vi) Absolute neutrophil count ≥ 1.5 × 10 9 cells / L; f) Having a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) Not receiving other cancer treatments.

[0051] 41. The method according to any one of the foregoing embodiments, wherein prior to administering the antibody, the subject: a) Has not received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, the systemic agent including a radio-immunoconjugate, an antibody-drug conjugate, an immune / cytokine, or a monoclonal antibody; b) Does not have persistent toxicity from prior treatment; c) Has not undergone major surgery within < 3 months prior to administering the antibody; d) Has not received radiotherapy within < 28 days prior to administering the antibody; e) Has not undergone an organ transplant, an allogeneic stem cell transplant, or an autologous stem cell transplant; f) Has not received a diagnosis of primary or acquired immunodeficiency; g) Has not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administering the antibody; h) Does not have active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiotherapy; i) Does not have an active autoimmune disease or a history of such disease that requires immunosuppressive therapy; j) Does not have clinical symptoms of CNS metastases within 28 days prior to administering the antibody; and / or k) Does not have leptomeningeal carcinomatosis.

[0052] 42. The method according to any one of embodiments 1-41, wherein the antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant comprising 1 or 2 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant comprising 1 or 2 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.

[0053] 43. The method according to embodiment 42, wherein: (a) the VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising 1 or 2 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1 or 2 amino acid changes, and [[ID=eleven]]SEQ ID NO: 3, or a variant thereof comprising 1 or 2 amino acid changes; and / or (b) the VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof comprising 1 or 2 amino acid changes, SEQ ID NO: 5, or a variant thereof comprising 1 or 2 amino acid changes, and [[ID=eighteen]] SEQ ID NO: 6, or a variant thereof comprising 1 or 2 amino acid changes.

[0054] 44. The method according to embodiment 42 or 43, wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences respectively shown in SEQ ID NO: 1, 2, 3, 4, 5, and 6.

[0055] 45. The method according to any one of embodiments 1-44, wherein the antibody comprises: a VH comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 7; and / or a VL comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 8 or 9.

[0056] 46. The method according to embodiment 45, wherein the antibody comprises a VH and a VL, the VH comprising the amino acid sequence shown in SEQ ID NO: 7, and the VL comprising the amino acid sequence shown in SEQ ID NO: 8.

[0057] 47. The method according to embodiment 45, wherein the antibody comprises a VH and a VL, the VH comprising the amino acid sequence shown in SEQ ID NO: 7, and the VL comprising the amino acid sequence shown in SEQ ID NO: 9.

[0058] 48. The method according to any one of embodiments 1-47, wherein the antibody comprises a heavy chain and / or a light chain, the heavy chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 10 or 11, and the light chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 12.

[0059] 49. The method according to any one of the foregoing embodiments, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprising the amino acid sequence shown in SEQ ID NO: 12.

[0060] 50. The method according to any one of embodiments 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the light chain comprising the amino acid sequence shown in SEQ ID NO: 12.

[0061] 51. The method according to any one of embodiments 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.

[0062] 52. The method according to any one of embodiments 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.

[0063] 53. The method according to any one of the foregoing embodiments, wherein administering the antibody prevents further growth of the tumor size in the subject.

[0064] 54. The method according to any one of the foregoing embodiments, wherein administering the antibody achieves at least disease stabilization in the subject.

[0065] 55. An antibody that specifically binds to human DDR1, which is used for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments.

[0066] 56. An antibody that specifically binds to human DDR1, which is used for preparing a drug for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments.

[0067] 57. Use of an antibody that specifically binds to human DDR1 for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 is a bar graph of an embodiment showing the binding of 9H-1 to cells at different concentrations in a flow cytometry assay.

[0069] Figure 2 is a graph of an embodiment showing the tumor volume in mice treated with 9H-1, 9H-1-LALAPG, or IgG control.

[0070] Figures 3A to 3D is a graph of an embodiment showing the concentration of 9H-1 in each cynomolgus monkey in all dose groups ( Figure 3A ), only in the low-dose group ( Figure 3B ), in the medium-dose group ( Figure 3C ), and only in the high-dose group ( Figure 3D ).

[0071] Figure 4It is a figure of an embodiment showing the simulated 9H-1 concentration at a dosing interval of every two weeks.

[0072] Figure 5 It is a figure of an embodiment showing the simulated 9H-1 concentration at a dosing interval of every three weeks.

[0073] Figures 6A to 6D It is a figure of an embodiment showing the change over time of individual tumor volume (mm 3 ) ( Figure 6A and Figure 6B )、average tumor volume (mm 3 ) ( Figure 6C ),and survival probability ( Figure 6D ) in B16F10 DDR1- / - tumors in C57BL / 6 mice within 23 days after inoculation.

[0074] Figures 7A to 7C It is a figure of an embodiment showing the individual tumor volume (mm 3 ) ( Figure 7A );average tumor volume (mm 3 ) ( Figure 7B );and body weight (g) ( Figure 7C ) in LLC1 DDR1- / - tumors in C57BL / 6 mice within 26 days after inoculation.

[0075] Figures 8A to 8C It is a figure of an embodiment showing the individual tumor volume (mm 3 ) ( Figure 8A );average tumor volume (mm 3 ) ( Figure 8B );and body weight (g) ( Figure 8C ) in E0771 DDR- / - tumors in C57BL / 6 mice within 31 days after inoculation.

[0076] Figures 9A to 9C It is a figure of an embodiment showing the individual tumor volume (mm 3 ) ( Figure 9A );average tumor volume (mm 3 ) ( Figure 9B );and body weight (g) ( Figure 9C ) in Renca DDR1- / - tumors in Balb / c mice within 31 days after inoculation.

[0077] Figures 10A to 10D It is a figure of an embodiment showing the individual tumor volume (mm 3 ) ( Figure 10A);Average tumor volume (mm 3 ) ( Figure 10B );Body weight (g) ( Figure 10C );And average body weight (g) ( Figure 10D ) for embodiments showing changes.

[0078] Figures 11A to 11C Is a graph showing individual tumor volume (mm 3 ) ( Figure 11A );Average tumor volume (mm 3 ) ( Figure 11B );And average body weight (g) ( Figure 11C ) for embodiments showing changes in EMT6 DDR1− / − tumors in Balb / c mice at 31 days post - inoculation.

[0079] Figures 12A to 12D Is a graph showing individual tumor volume (mm 3 ) ( Figure 12A );Average tumor volume (mm 3 ) ( Figure 12B );Individual tumor volume (mm 3 ) ( Figure 12C );And average body weight (g) ( Figure 12D ) for embodiments showing changes in CT26 DDR1− / − tumors in Balb / c mice at 38 days post - inoculation.

[0080] Figures 13A to 13D Is a graph showing individual tumor volume (mm 3 ) ( Figure 13A );Average tumor volume (mm 3 ) ( Figure 13B );Average body weight (g) ( Figure 13C );And survival probability ( Figure 13D ) for embodiments showing changes in MBT - 2 DDR1− / − tumors in C3H / HeN mice at 28 days post - inoculation.

[0081] Figure 14 Shows the study design of an embodiment for tumor kinetics studies using CT26 (wild - type (WT) and knockout (KO)) cell lines in BALB / c mice.

[0082] Figures 15A to 15B Is a graph showing changes in tumor volume (mm 3 ) ( Figure 15A ) and percentage change in body weight ( Figure 15B ) for embodiments in CT26 DDR1 WT + CT26 DDR1 KO (n = 10) at 42 days post - inoculation.

[0083] Figures 16A to 16B show the individual tumor volumes (mm Figure 16A ) of CT26 WT cell line ( Figure 16B ) and CT26 KO cell line ( 3 ) over time within 42 days after inoculation.

[0084] Figures 17A to 17C show flow cytometry analysis of CT26 parental line using isotype antibody control ( Figure 17A ) and using anti-DDR1 antibody ( Figure 17B ); and flow cytometry analysis of CT26 DDR1r line using anti-DDR1 antibody after fluorescence-activated cell sorting ( Figure 17C ).

[0085] Figures 18A to 18C show the results of a Phase 1 dose-escalation trial of 9H-1 (PRTH-101). Figure 18A summarize the trial progress of different patients at the indicated dose levels. Figure 18B are collections of scanned images showing cross-sections of tumors at different time points. Figure 18C are collections of graphs showing the pharmacokinetic (PK) profiles of 9H-1 (PRTH-101) for individual patients. DETAILED DESCRIPTION

[0086] Embodiments of the present disclosure relate to methods of treating cancer using antibodies that specifically bind to discoidin domain receptor tyrosine kinase 1 (DDR1), including human DDR1 (i.e., “specifically bind to human DDR1”). Embodiments are also provided for specific dosing regimens for administering antibodies that specifically bind to human DDR1. In some embodiments, the dosing regimens provided in the present disclosure provide serum exposure to anti-DDR1 antibodies in a human subject that is higher than necessary to inhibit DDR1 function.

[0087] TERMS

[0088] Unless otherwise defined, all technical and scientific terms used herein, when considered in light of the present disclosure, have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any claimed subject matter.

[0089] As used herein, the terms "antibody" and "antibodies" have their ordinary and accustomed meanings as understood in accordance with the specification, and unless otherwise specified, include full-length antibodies, antigen-binding fragments of full-length antibodies, and molecules comprising antibody CDRs, VH regions, and / or VL regions. Examples of antibodies include, but are not limited to, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chains and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain - antibody heavy chain pairs, intrabodies, heteroconjugate antibodies, antibody - drug conjugates, single-domain antibodies, monovalent antibodies, single-chain antibodies or single-chain Fvs (scFvs), camelized antibodies, affibodies, Fab fragments, F(ab’)2 fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies (including, for example, anti-anti-Id antibodies), and antigen-binding fragments of any of the foregoing. In certain embodiments, the antibodies described herein refer to a polyclonal antibody population. Antibodies can be of any type of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, or IgA2), or any subclass (e.g., IgG2a or IgG2b). In certain embodiments, the antibodies described herein are IgG antibodies or a class thereof (e.g., human IgG1 or IgG4) or a subclass thereof. In an embodiment, the antibody is a humanized monoclonal antibody. In an embodiment, the antibody is a human monoclonal antibody.

[0090] As used herein, the term “CDR” or “complementary determining region” has its ordinary and customary meaning as understood in accordance with the specification, and refers to the non - contiguous antigen - binding sites present within the variable regions of heavy and light chain polypeptides. These specific regions have been described, for example, by Kabat et al., J. Biol. Chem. 252, 6609 - 6616 (1977) and Kabat et al., “Sequences of Proteins of Immunological Interest.” (1991), Chothia et al., J. Mol. Biol. 196:901 - 917 (1987), and MacCallum et al., J. Mol. Biol. 262:732 - 745 (1996), which are hereby incorporated by reference in their entirety, wherein when compared to each other, the definitions include overlapping or subsets of amino acid residues (see Table 1). In certain embodiments, the term “CDR” is as defined by MacCallum et al., J. Mol. Biol. 262:732 - 745 (1996) and Martin A. “Protein Sequence and Structure Analysis of Antibody Variable Domains,” in Antibody Engineering, Kontermann and Dübel, eds., Chapter 31, pp. 422 - 439, Springer - Verlag, Berlin (2001). In certain embodiments, the term “CDR” is as defined by Kabat et al., J. Biol. Chem. 252, 6609 - 6616 (1977) and Kabat et al., “Sequences of Proteins of Immunological Interest.” (1991). In certain embodiments, different conventions are used to define the heavy - chain CDRs and light - chain CDRs of an antibody. In certain embodiments, the heavy - chain CDRs and / or light - chain CDRs are defined by performing a structural analysis of the antibody and identifying the residues in the variable regions that are predicted to contact the epitope region of a target molecule (e.g., human DDR1). CDRH1, CDRH2, and CDRH3 denote the heavy - chain CDRs, and CDRL1, CDRL2, and CDRL3 denote the light - chain CDRs.

[0091] Table 1. CDR Definitions.

[0092]

[0093] As used herein, the terms "variable region" and "variable domain" have their ordinary and customary meanings as understood in accordance with the specification, and are used interchangeably, and are common in the art. The variable region generally refers to a portion of an antibody, typically a portion of a light chain or a heavy chain, typically about 110 to 120 amino acids at the amino terminus, or 110 to 125 amino acids in a mature heavy chain, and about 90 to 115 amino acids in a mature light chain, which varies significantly in the sequence of an antibody and is used for the binding and specificity of a particular antibody to its particular antigen. The variability of the sequence is concentrated in regions called complementarity determining regions (CDRs), while the more highly conserved regions in the variable region are called framework regions (FRs). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with the antigen. In certain embodiments, the variable region is a human variable region. In certain embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In an embodiment, the variable region is a primate (e.g., non-human primate) variable region. In an embodiment, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs).

[0094] As used herein, the terms "VH" and "VL" have their ordinary and customary meanings as understood in accordance with the specification, and refer respectively to the variable regions of the heavy and light chains of an antibody, as described in Kabat et al., (1991) "Sequences of Proteins of Immunological Interest", which is incorporated herein by reference in its entirety.

[0095] As used herein, the term "constant region" has its ordinary and customary meaning as understood in accordance with the specification, and is common in the art. The constant region is a portion of the antibody, e.g., the carboxyl-terminal portion of the light chain and / or heavy chain, which is not directly involved in the binding of the antibody to the antigen, but which can exhibit various effector functions, such as interaction with Fc receptors (e.g., Fcγ receptors).

[0096] As used herein, the term "heavy chain" has its ordinary and customary meaning as understood in accordance with the specification when used in reference to an antibody, and can refer to any of the different types based on the amino acid sequence of the constant region, e.g., alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (μ), which give rise to IgA, IgD, IgE, IgG, and IgM classes of antibodies, including subclasses of IgG, e.g., IgG1, IgG2, IgG3, and IgG4.

[0097] As used herein, the term "light chain," when used in reference to an antibody, has its ordinary and customary meaning as understood in accordance with the specification, and can refer to any of the different types based on the amino acid sequence of the constant region, e.g., kappa (κ) or lambda (λ). Light chain amino acid sequences are well known in the art. In an embodiment, the light chain is a human light chain.

[0098] As used herein, the terms "specifically bind," "specifically recognize," "immunologically specifically bind," and "immunologically specifically recognize" have their ordinary and customary meanings as understood in accordance with the specification, and are similar terms in the context of an antibody, and refer to a molecule that binds to an antigen (e.g., an epitope or an immune complex), such binding being as understood by one of ordinary skill in the art. For example, a molecule that specifically binds an antigen may bind other peptides or polypeptides, generally with lower affinity, the affinity being determined by, e.g., immunoassays, BIAcore®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In an embodiment, the KA of a molecule that specifically binds an antigen to the antigen is at least 2 logs (e.g., a multiple of 10), 2.5 logs, 3 logs, 4 logs, or more higher than the KA of the molecule when non-specifically binding to another antigen. Unless otherwise expressly stated, an antibody or fragment thereof that is said to "specifically bind" an antigen (where the antigen is identified as being from a particular species (e.g., human)) can bind to the same antigen of another species with the same or similar affinity. For example, an antibody or fragment thereof that "specifically binds" human DDR1 can bind to mouse DDR1 with similar affinity.

[0099] As used herein, the term "EU numbering system" has its ordinary and customary meaning as understood in accordance with the specification, and refers to the EU numbering convention for antibody constant regions, as described in Edelman G.M. et al., Proc. Natl. Acad.USA, 63, 78-85 (1969) and Kabat et al., "Sequences of Proteins of Immunological Interest", 1991, each of which is incorporated herein by reference in its entirety.

[0100] As used herein, the term "subject" has its ordinary and customary meaning as understood in accordance with the specification, and includes any human or non-human animal. In an embodiment, the subject is a human. In some embodiments, "subject" and "patient" may be used interchangeably.

[0101] As used herein, the term "cancer" has its ordinary and customary meaning as understood in accordance with the specification, and refers to any disorder characterized by the uncontrolled division of abnormal cells in the body. For example, a mutation may occur in a cell, causing it to lose the ability to regulate cell division and resulting in the formation of one or more tumors. Cancer can be benign, pre-cancerous, or malignant. Cancer occurs in a variety of cells and tissues, including but not limited to, the oral cavity (e.g., mouth, tongue, pharynx, etc.), digestive system (e.g., esophagus, stomach, small intestine, colon, rectum, liver, bile duct, gallbladder, pancreas, etc.), respiratory system (e.g., larynx, lung, bronchi, etc.), bone, joints, skin (e.g., basal cell, squamous cell, meningioma, etc.), breast, reproductive system (e.g., uterus, ovaries, prostate, testicles, etc.), urinary system (e.g., bladder, kidneys, ureters, etc.), eyes, nervous system (e.g., brain, etc.), endocrine system (e.g., thyroid, etc.), soft tissues (e.g., muscle, fat, etc.), and hematopoietic system (e.g., lymphoma, myeloma, leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, etc.).

[0102] As used herein, the term "solid cancer" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a cancer that results in a malignant solid tumor. Solid tumors include sarcomas and carcinomas. Blood cancers generally do not form solid tumors.

[0103] As used herein, the term "unresectable" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a tumor that cannot be treated by surgical removal.

[0104] As used herein, the term "locally advanced" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a cancer that has high vascular involvement and / or has grown outside the body part or organ where it originated but has not metastasized.

[0105] As used herein, the term "refractory" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a cancer that does not respond to treatment.

[0106] As used herein, the terms "treat", "treating", and "treatment" have their ordinary and customary meanings as understood in light of the specification, and refer to the therapeutic or prophylactic measures described herein. A method of "treatment" involves administering an antibody to a subject having cancer to prevent, cure, retard, reduce the severity of, or ameliorate one or more symptoms of the cancer or recurrent cancer, or to extend the survival time of the subject beyond that expected in the absence of such treatment. In some embodiments, "treatment" includes achieving a complete response, a partial response, or disease stabilization. In some embodiments, "treatment" includes at least achieving disease stabilization.

[0107] As used herein, the term "effective amount" has its ordinary and customary meaning as understood in light of the specification in the context of administering a treatment to a subject, and refers to the amount of the treatment that achieves the desired prophylactic or therapeutic effect.

[0108] As used herein, the term "about", when referring to a measurable value (e.g., a dosage), includes a variation of ±5% of the given value or range.

[0109] As used herein with respect to an antibody, the term "isolated" has its ordinary and customary meaning as understood in light of the specification, and refers to an antibody that is separated from one or more contaminants (e.g., polypeptides, polynucleotides, lipids, host cells, or carbohydrates, etc.) that are present in the natural source of the antibody. All instances of "antibody" described herein are additionally considered to be isolated antibodies, but need not be isolated antibodies.

[0110] The determination of the "percentage identity" between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be accomplished using mathematical algorithms. Non-limiting examples of mathematical algorithms for comparing two sequences are the algorithms of Karlin S & Altschul SF (1990) PNAS 87: 2264-2268 as modified in Karlin S & Altschul SF (1993) PNAS 90: 5873-5877, each of which is incorporated herein by reference in its entirety. This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul SF et al., (1990) J Mol Biol 215: 403, which are incorporated herein by reference in their entirety. The NBLAST nucleotide program parameters can be used, e.g., score = 100, wordlength = 12, for BLAST nucleotide searches to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. The XBLAST program parameters can be used, e.g., score 50, wordlength = 3, for BLAST protein searches to obtain amino acid sequences homologous to the protein molecules described herein. To obtain a gapped alignment for comparison purposes, gapped BLAST can be used as described in Altschul SF et al., (1997) Nuc Acids Res 25: 3389-3402, which is incorporated herein by reference in its entirety. Optionally, an iterative search can be performed with PSI-BLAST, which detects distant relationships between molecules (ibid). When using the BLAST, gapped BLAST, and PSI-BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see, e.g., the National Center for Biotechnology Information (NCBI) on the World Wide Web, ncbi.nlm.nih.gov). Another non-limiting example of a mathematical algorithm for sequence comparison is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17, which is incorporated herein by reference in its entirety. This algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0111] The percentage identity between two sequences can be determined using techniques similar to those described above, whether or not gaps are allowed. When calculating the percentage identity, generally only exact matches are counted. In some embodiments, the percentage identity is calculated using only exact matches without introducing gaps.

[0112] As used herein, the term "amino acid change" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a substitution or insertion of an amino acid at a position in an amino acid sequence.

[0113] Anti-DDR1 antibody

[0114] In one aspect, any antibody that specifically binds to DDR1 (i.e., anti-DDR1 antibody) is useful in the methods and uses provided herein.

[0115] In embodiments, the amino acid sequences of the CDRs, VH / VL, and the heavy and light chain sequences of exemplary antibodies that specifically bind to DDR1 are shown in Tables 2, 3, and 4, respectively.

[0116]

[0117] In embodiments, the antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant comprising 1-5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant comprising 1-5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.

[0118] In embodiments, (a) VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are the following sequences, respectively: SEQ ID NO: 1, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1-3 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1-5 amino acid changes; and / or (b) VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are the following sequences, respectively: SEQ ID NO: 4, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 5, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 6, or a variant thereof comprising 1-5 amino acid changes.

[0119] In an embodiment, (a) the VH comprises CDRH1, CDRH2, and CDRH3 amino acid sequences that are, respectively, the sequences of SEQ ID NO: 1, or a variant thereof having 1 or 2 amino acid changes, SEQ ID NO: 2, or a variant thereof having 1 or 2 amino acid changes, and SEQ ID NO: 3, or a variant thereof having 1 or 2 amino acid changes; and / or (b) the VL comprises CDRL1, CDRL2, and CDRL3 amino acid sequences that are, respectively, the sequences of SEQ ID NO: 4, or a variant thereof having 1 or 2 amino acid changes, SEQ ID NO: 5, or a variant thereof having 1 or 2 amino acid changes, and SEQ ID NO: 6, or a variant thereof having 1 or 2 amino acid changes.

[0120] In an embodiment, (a) the VH comprises CDRH1, CDRH2, and CDRH3 amino acid sequences that are, respectively, the sequences of SEQ ID NO: 1, or a variant thereof having 1 amino acid change, SEQ ID NO: 2, or a variant thereof having 1 amino acid change, and SEQ ID NO: 3, or a variant thereof having 1 amino acid change; and / or (b) the VL comprises CDRL1, CDRL2, and CDRL3 amino acid sequences that are, respectively, the sequences of SEQ ID NO: 4, or a variant thereof having 1 amino acid change, SEQ ID NO: 5, or a variant thereof having 1 amino acid change, and SEQ ID NO: 6, or a variant thereof having 1 amino acid change.

[0121] In an embodiment, the antibody comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively.

[0122] In an embodiment, the antibody comprises: a VH that comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or a VL that comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.

[0123] In an embodiment, the antibody comprises a VH and a VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 8. In an embodiment, the amino acid sequence of the VH consists of the amino acid sequence shown in SEQ ID NO: 7, and the amino acid sequence of the VL consists of the amino acid sequence shown in SEQ ID NO: 8.

[0124] In an embodiment, the antibody comprises a VH and a VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 9. In an embodiment, the amino acid sequence of the VH consists of the amino acid sequence shown in SEQ ID NO: 7, and the amino acid sequence of the VL consists of the amino acid sequence shown in SEQ ID NO: 9.

[0125] In an embodiment, the antibody comprises a heavy chain and / or a light chain, wherein the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 12.

[0126] In an embodiment, the antibody comprises a heavy chain and a light chain, wherein the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12. In an embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 10, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12.

[0127] In an embodiment, the antibody comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence shown in SEQ ID NO: 11 and the light chain comprising the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without the terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12. In an embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 11, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12, which is referred to herein as the antibody "9H-1". In some embodiments, the heavy chain of 9H-1 does not contain the terminal lysine of SEQ ID NO: 11.

[0128] In some embodiments, the antibody is 9H-1 (PRTH-101) provided by Incendia Therapeutics, Inc. (Boston, MA).

[0129] Also provided herein are compositions (e.g., pharmaceutical compositions) comprising at least one anti-DDR1 antibody of the present disclosure. The composition can comprise an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1); and a pharmaceutically acceptable carrier. Any suitable pharmaceutically acceptable carrier can be used. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for the delivery of the antibodies disclosed herein. Generally, the nature of the carrier will depend on the particular mode of administration employed. For example, parenteral formulations can contain injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, saline, balanced salt solutions, dextrose aqueous solutions, glycerol, etc. as a vehicle. In addition to the biocompatible carrier, the pharmaceutical composition to be administered can contain small amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, such as sodium acetate or sorbitan monolaurate.

[0130] The compositions of the present disclosure may be in the form of solutions, suspensions, emulsions, and the like. Examples of suitable medicaments are described in "Remington's Pharmaceutical Sciences." Such compositions may contain a prophylactically or therapeutically effective amount of an antibody or fragment thereof (preferably in purified form) and an appropriate amount of a carrier to provide a form suitable for administration to the patient. The formulation may be suitable for administration, which may be oral, intravenous, intraarterial, intraoral, intranasal, nebulized, bronchial inhalation, or delivered via mechanical ventilation.

[0131] Antibodies of the present disclosure as described herein can be formulated for parenteral administration, e.g., for injection via intradermal, intravenous, intramuscular, subcutaneous, intratumoral, or even intraperitoneal routes. The antibodies can alternatively be administered directly to the mucosa via a topical route, e.g., by nasal drops, inhalation, or by nebulizer.

[0132] Typically, the ingredients of the compositions of the present disclosure can be provided separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or anhydrous concentrate in a sealed container such as an ampoule or sachet labeled with the amount of active agent. When the composition is to be administered by infusion, it can be dispensed using an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is to be administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed before administration.

[0133] Methods and Dosage Regimens

[0134] The present disclosure relates to methods for reducing immune rejection of tumors in subjects in need thereof and methods for reducing tumor burden using antibodies that specifically bind to human DDR1 (i.e., anti-DDR1 antibodies). Also provided herein are specific dosage regimens for administering anti-DDR1 antibodies that result in reduced tumor size and increased response to immunotherapy in subjects with solid cancers (e.g., colorectal cancer, ovarian cancer, or non-small cell lung cancer).

[0135] In one aspect, provided herein are methods of reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject 5 mg to 2000 mg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).

[0136] In one aspect, provided herein are methods of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject 5 mg to 2000 mg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).

[0137] In embodiments, the subject has cancer. In embodiments, the antibody treats cancer in the subject.

[0138] In an embodiment, the antibody is administered at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0139] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.

[0140] In an embodiment, the antibody is administered intravenously or subcutaneously.

[0141] In an embodiment, the antibody is administered once a week. In some embodiments, the frequency of administering the antibody does not exceed once a week. In an embodiment, the antibody is administered once every 2 weeks. In some embodiments, the frequency of administering the antibody is no more than once every 2 weeks. In an embodiment, the antibody is administered once every 3 weeks. In some embodiments, the frequency of administering the antibody is no more than once every 3 weeks. In an embodiment, the antibody is administered once every 4 weeks. In some embodiments, the frequency of administering the antibody is no more than once every 4 weeks. In an embodiment, the antibody is administered once every 5 weeks. In some embodiments, the frequency of administering the antibody does not exceed once every 5 weeks. In an embodiment, the antibody is administered once every 6 weeks. In some embodiments, the frequency of administering the antibody is no more than once every 6 weeks. In an embodiment, the antibody is administered once every 7 weeks. In some embodiments, the frequency of administering the antibody does not exceed once every 7 weeks. In an embodiment, the antibody is administered once every 8 weeks. In some embodiments, the frequency of administering the antibody is no more than once every 8 weeks.

[0142] In an embodiment, the antibody is administered once a week at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once a week at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once a week at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0143] In an embodiment, the antibody is administered once a week at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.

[0144] In an embodiment, the antibody is administered at a dose of about 5 mg to about 2000 mg once every two weeks. In an embodiment, the antibody is administered at a dose of about 8 mg to about 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of about 8 mg to about 800 mg once every two weeks. In an embodiment, the antibody is administered at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg once every two weeks.

[0145] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every two weeks.

[0146] In an embodiment, the antibody is administered once every 3 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 3 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 3 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 3 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 3 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0147] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every three weeks.

[0148] In an embodiment, the antibody is administered once every 4 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 45 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0149] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 4 weeks.

[0150] In an embodiment, the antibody is administered once every 5 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0151] In an embodiment, the antibody is administered once every 5 weeks at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.

[0152] In an embodiment, the antibody is administered once every 6 weeks at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0153] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 6 weeks.

[0154] In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0155] In an embodiment, the antibody is administered once every 7 weeks at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.

[0156] In an embodiment, the antibody is administered once every 8 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.

[0157] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 8 weeks.

[0158] In an embodiment, the antibody is administered intravenously at a dose of 8 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 24 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 25 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 75 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 80 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 240 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 250 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 400 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 800 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 1600 mg once every 3 weeks.

[0159] In an embodiment, the antibody is administered intravenously. In an embodiment, the antibody is administered via intravenous infusion within 60 minutes. In an embodiment, the antibody is administered via intravenous infusion within 30 minutes. In some embodiments, the antibody is administered intratumorally.

[0160] In an embodiment, the dose is a therapeutically effective amount.

[0161] In some embodiments, the antibody is administered using a flat dose (e.g., the amount of the antibody administered is not based on the body weight of the subject).

[0162] In one aspect, provided herein is a method of reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at 0.1 mg / kg to 100 mg / kg.

[0163] In one aspect, provided herein is a method of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at 0.1 mg / kg to 100 mg / kg.

[0164] In an embodiment, the subject has cancer. In an embodiment, the antibody treats the cancer in the subject.

[0165] In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.

[0166] In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.

[0167] In an embodiment, the antibody is administered intravenously or subcutaneously. In some embodiments, the antibody is administered intratumorally.

[0168] In an embodiment, the antibody is administered once a week. In some embodiments, the frequency of antibody administration does not exceed once a week. In an embodiment, the antibody is administered once every two weeks. In an embodiment, the frequency of antibody administration does not exceed once every two weeks. In an embodiment, the antibody is administered once every three weeks. In an embodiment, the frequency of antibody administration does not exceed once every three weeks. In an embodiment, the antibody is administered once every four weeks. In an embodiment, the frequency of antibody administration does not exceed once every four weeks. In an embodiment, the antibody is administered once every five weeks. In an embodiment, the frequency of antibody administration does not exceed once every five weeks. In an embodiment, the antibody is administered once every six weeks. In an embodiment, the frequency of antibody administration does not exceed once every six weeks. In an embodiment, the antibody is administered once every seven weeks. In an embodiment, the frequency of antibody administration does not exceed once every seven weeks. In an embodiment, the antibody is administered once every eight weeks. In an embodiment, the frequency of antibody administration does not exceed once every eight weeks.

[0169] In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0170] In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.

[0171] In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0172] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every two weeks.

[0173] In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0174] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every three weeks.

[0175] In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg once every 4 weeks.

[0176] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 4 weeks.

[0177] In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0178] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 5 weeks.

[0179] In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 50 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 25 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 20 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg once every 6 weeks.

[0180] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 6 weeks.

[0181] In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0182] In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.

[0183] In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.

[0184] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 8 weeks.

[0185] In an embodiment, the antibody is administered intravenously at a dose of 0.1 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 0.3 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 1 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 3 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 10 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 20 mg / kg once every 3 weeks.

[0186] In an embodiment, prior to administering the antibody, the subject: a) has measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1, with confirmed metastatic or advanced, unresectable cancer; b) has pathologically documented advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard therapies known to confer benefit, or for which no standard therapy is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) platelets ≥ 100 × 109 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 109 cells / L; f) has a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) has not received other cancer therapies.

[0187] In an embodiment, prior to administering the antibody, the subject: a) has not received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, where the systemic agent includes a radio-immunoconjugate, an antibody-drug conjugate, an immune / cytokine, or a monoclonal antibody; b) does not have ongoing toxicity from prior treatment; c) has not undergone major surgery within < 3 months prior to administering the antibody; d) has not received radiotherapy within < 28 days prior to administering the antibody; e) has not undergone an organ transplant, an allogeneic stem cell transplant, or an autologous stem cell transplant; f) has not received a diagnosis of primary or acquired immunodeficiency; g) has not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administering the antibody; h) does not have active central nervous system (CNS) tumor involvement that is not definitively treated with surgery or radiotherapy; i) does not have an active autoimmune disease or a history of such disease that requires immunosuppressive therapy; j) does not have clinical symptoms of CNS metastases within 28 days prior to administering the antibody; and / or k) does not have leptomeningeal carcinomatosis.

[0188] In an embodiment of the methods described herein, the cancer is associated with elevated DDR1 phosphorylation. Exemplary cancer tissues that may be associated with elevated DDR1 phosphorylation include, but are not limited to, cancers or cancer cells of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, intestine, gingiva, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, pancreas, testis, tongue, cervix, or uterus.

[0189] Exemplary histological types of cancers that may be associated with elevated DDR1 phosphorylation include, but are not limited to, malignant tumors; carcinoma; undifferentiated carcinoma; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; epitheliolymphocytic carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; intrahepatic cholangiocarcinoma (iCCA); trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; familial polyposis adenocarcinoma; solid carcinoma; malignant carcinoid tumor; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe cell carcinoma; oxyphilic cell carcinoma; eosinophilic adenocarcinoma; basophilic cell carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulated sclerosing carcinoma; adrenocortical carcinoma; endometrial carcinoma; skin appendage carcinoma; sweat gland adenocarcinoma; sebaceous gland carcinoma; ceruminous gland adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma (bookmark ring cell carcinoma); invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget’s disease of the breast; acinar cell carcinoma; adenosquamous cell carcinoma; adenocarcinoma with squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; malignant testicular blastoma; Sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipoma; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant congenital nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; fibrous histiocytoma; mixed tumor; Mullerian mixed tumor; Wilms tumor; hepatoblastoma; malignant mesenchymoma; malignant Brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; struma ovarii carcinoma; choriocarcinoma; malignant mesonephric duct tumor; hemangioendothelioma, hemangiopericytoma; chondroblastoma; giant cell tumor of bone; malignant odontogenic tumor; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal tumor; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant granular cell tumor; malignant lymphoma; Hodgkin disease; paragranuloma; small lymphocyte lymphoma;Diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocytic leukemia; and hairy cell leukemia.

[0190] In embodiments, the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, intrahepatic cholangiocarcinoma (iCCA) or bone cancer. In embodiments, the cancer is colorectal cancer, ovarian cancer or non-small cell lung cancer. In embodiments, the colorectal cancer is microsatellite stable (MSS). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer does not include breast cancer.

[0191] In embodiments, the cancer is not sarcoma, hepatocellular carcinoma or glioma.

[0192] In embodiments, the cancer expresses DDR1. In embodiments, the cancer is a solid cancer. In embodiments, the cancer is locally advanced or metastatic solid cancer. In embodiments, the cancer is unresectable.

[0193] In embodiments, the cancer is refractory to immunotherapy. In embodiments, the cancer is refractory to antagonist anti-PD-1 antibody, antagonist anti-PD-L1 antibody, antagonist anti-PD-L2 antibody, antagonist anti-CTLA-4 antibody, antagonist anti-BTLA antibody, antagonist anti-TREMR antibody, antagonist anti-TIGIT antibody, antagonist anti-VISTA antibody, antagonist anti-TIM-3 antibody, antagonist anti-LAG-3 antibody, antagonist anti-CEACAM1 antibody, agonist anti-GITR antibody, agonist anti-OX40 antibody and agonist anti-CD137 antibody, agonist anti-DR3 antibody, agonist anti-TNFSF14 antibody, agonist anti-CD27 antibody, agonist anti-ICOS antibody or agonist anti-CD28 antibody.

[0194] In embodiments, the subject is not a candidate for standard of care treatment. In embodiments, the subject is intolerant to standard of care treatment.

[0195] In an embodiment, the cancer is refractory to standard of care treatment. In an embodiment, the standard of care treatment is chemotherapy and / or radiation. In an embodiment, the standard of care treatment is a chemotherapeutic agent selected from the following: abiraterone acetate, afatinib, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminoglutethimide, anagrelide, anastrozole, arsenic trioxide, asparaginase, azacitidine, azathioprine, bendamustine, bevacizumab, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carmustine, cetuximab, chlorambucil, cisplatin, cladribine, crizotinib, cyclophosphamide, cytarabine, dacarbazine, actinomycin D, dasatinib, daunorubicin, denileukindiftitox, decitabine, docetaxel, dexamethasone, doxifluridine, doxorubicin, epirubicin, epoetin alpha, epothilone, erlotinib, estramustine, entinostat, etoposide, everolimus, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil, fluoxymesterone, flutamide, folate-linked alkaloid, gefitinib, gemcitabine, gemtuzumab ozogamicinozogamicin), GM-CT-01, goserelin, hexamethylmelamine, hydroxyureas, ibritumomab, idarubicin, ifosfamide, imatinib, interferon-α, interferon-β, irinotecan, ixabepilone, lapatinib, leucovorin, leuprolide, lenalidomide, letrozole, lomustine, mechlorethamine, megestrol acetate, melphalan, mercaptopurine, methotrexate, mitomycin, mitoxantrone, nelarabine, nilotinib, nilutamide, octreotide, ofatumumab, oprelvekin, oxaliplatin, paclitaxel, panitumumab, pemetrexed, pentostatin, galectin inhibitor, procarbazine, raloxifene, retinoic acid, rituximab, romiplostim, sargramostim, sorafenib, streptozocin, sunitinib, tamoxifen, temsirolimus, temozolomide, teniposide, thalidomide, thioguanine, thiotepa, tioguanine, topotecan, toremifene, tositumomab, trametinib, trastuzumab, tretinoin, valrubicin, VEGF inhibitor and trap, vinblastine, vincristine, vindesine, vinorelbine, vintafolide(EC145) and vorinostat.

[0196] In some embodiments, administering an antibody that specifically binds to human DDR1 to a subject achieves at least disease stabilization (e.g., disease stabilization of cancer). In some embodiments, administering an antibody that specifically binds to human DDR1 to a subject prevents further development of cancer in the subject. In some embodiments, administering an antibody that specifically binds to human DDR1 to a subject prevents further growth of tumor size in the subject. In some embodiments, after administering the antibody, the tumor size does not increase by more than or is not more than about 30%, 25%, 20%, 15%, 10%, 5%, 3%, 1% or is not more than a percentage within the range defined by any two of the foregoing values (e.g., 1-30%, 3-25%, 5-20%, 1-20%, 1-10%, 1-5%, etc.), or when the size does not increase, further growth of the tumor size is prevented. In some embodiments, the cancer is NSCLC, papillary thyroid carcinoma, colorectal cancer, thymic carcinoma or rectal cancer. In some embodiments, administering an antibody that specifically binds to human DDR1 to a subject achieves a complete response (e.g., elimination of the tumor). In some embodiments, administering an antibody that specifically binds to human DDR1 to a subject achieves at least a partial response (e.g., tumor shrinkage of about 50% or more).

[0197] In one aspect, provided herein are antibodies that specifically bind to human DDR1 for use in treating cancer, wherein the treatment is carried out according to the methods disclosed herein.

[0198] In one aspect, provided herein are antibodies that specifically bind to human DDR1 for use in preparing a medicament for treating cancer, wherein the treatment is carried out according to the methods disclosed herein.

[0199] Kit

[0200] Also provided herein is a kit for treating cancer in a subject, wherein the kit comprises at least one anti-DDR1 antibody of the present disclosure. In some embodiments, the kit comprises a container containing the anti-DDR1 antibody. Any suitable container can be used. Suitable containers include but are not limited to vials, test tubes, flasks, bottles, syringes or other container tools in which the antibody can be placed, or preferably, suitably dispensed therein. In some embodiments, the kit comprises a pre-filled syringe containing the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured to deliver a unit dose (e.g., a therapeutically effective amount) of the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured for single-use delivery of a unit dose of the anti-DDR1 antibody. In some embodiments, the kit comprises instructions for use.

[0201] Additional embodiments

[0202] Additional non - limiting embodiments of the present disclosure are provided according to the numbered embodiments below.

[0203] 1. A method of reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.

[0204] 2. A method of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.

[0205] 3. The method according to embodiment 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 1600 mg.

[0206] 4. The method according to embodiment 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 800 mg.

[0207] 5. The method according to any one of embodiments 1 - 4, wherein the antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg or about 1600 mg.

[0208] 6. The method according to any one of embodiments 1 - 5, wherein the antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg or 1600 mg.

[0209] 7. The method according to any one of embodiments 1 - 6, wherein the antibody is administered intravenously.

[0210] 8. The method according to any one of embodiments 1 - 7, wherein the antibody is administered by intravenous infusion within 60 minutes.

[0211] 9. The method according to any one of embodiments 1 - 7, wherein the antibody is administered by intravenous infusion within 30 minutes.

[0212] 10. The method according to any one of embodiments 1 - 9, wherein the antibody is administered once a week.

[0213] 11. The method according to any one of embodiments 1 - 9, wherein the antibody is administered once every 2 weeks.

[0214] 12. The method according to any one of aspects 1-9, wherein the antibody is administered once every 3 weeks.

[0215] 13. The method according to any one of aspects 1-9, wherein the antibody is administered once every 4 weeks.

[0216] 14. The method according to any one of aspects 1-9, wherein the antibody is administered once every 8 weeks.

[0217] 15. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 8 mg once every 3 weeks.

[0218] 16. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 24 mg once every 3 weeks.

[0219] 17. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 80 mg once every 3 weeks.

[0220] 18. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 240 mg once every 3 weeks.

[0221] 19. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 400 mg once every 3 weeks.

[0222] 20. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 800 mg once every 3 weeks.

[0223] 21. The method according to any one of aspects 1-9, wherein the antibody is administered intravenously at a dose of 1600 mg once every 3 weeks.

[0224] 22. The method according to any one of aspects 1-21, wherein the dose is a therapeutically effective amount.

[0225] 23. The method according to any one of the foregoing aspects, wherein the subject has cancer.

[0226] 24. The method according to aspect 23, wherein the administration of the antibody treats the cancer in the subject.

[0227] 25. The method according to aspect 23 or 24, wherein the cancer expresses DDR1.

[0228] 26. The method according to any one of aspects 23-25, wherein the cancer is a solid cancer.

[0229] 27. The method according to any one of aspects 23 - 26, wherein the cancer is locally advanced or metastatic solid cancer.

[0230] 28. The method according to any one of aspects 23 - 27, wherein the cancer is unresectable.

[0231] 29. The method according to any one of aspects 23 - 28, wherein the cancer is refractory to immunotherapy.

[0232] 30. The method according to aspect 29, wherein the immunotherapy is an antagonist anti - PD - 1 antibody, an antagonist anti - PD - L1 antibody, an antagonist anti - PD - L2 antibody, an antagonist anti - CTLA - 4 antibody, an antagonist anti - BTLA antibody, an antagonist anti - TREMR antibody, an antagonist anti - TIGIT antibody, an antagonist anti - VISTA antibody, an antagonist anti - TIM - 3 antibody, an antagonist anti - LAG - 3 antibody, an antagonist anti - CEACAM1 antibody, an agonist anti - GITR antibody, an agonist anti - OX40 antibody, an agonist anti - CD137 antibody, an agonist anti - DR3 antibody, an agonist anti - TNFSF14 antibody, an agonist anti - CD27 antibody, an agonist anti - ICOS antibody or an agonist anti - CD28 antibody.

[0233] 31. The method according to any one of aspects 23 - 30, wherein the cancer is not sarcoma, hepatocellular carcinoma or glioma.

[0234] 32. The method according to any one of aspects 23 - 31, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non - small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, intrahepatic cholangiocarcinoma (iCCA) or bone cancer.

[0235] 33. The method according to any one of aspects 23 - 32, wherein the cancer is colorectal cancer, intrahepatic cholangiocarcinoma (iCCA), ovarian cancer or non - small cell lung cancer.

[0236] 34. The method according to aspect 33, wherein the colorectal cancer is microsatellite stable (MSS).

[0237] 35. The method according to any one of aspects 23 - 34, wherein the subject is not a candidate for standard of care treatment.

[0238] 36. The method according to any one of aspects 23 - 35, wherein the cancer is refractory to standard of care treatment.

[0239] 37. The method according to any one of aspects 23-36, wherein the subject is intolerant to standard of care treatment.

[0240] 38. The method according to aspect 36 or 37, wherein the standard of care treatment is chemotherapy or radiation.

[0241] 39. The method according to any one of aspects 1-38, wherein administration of the antibody reduces tumor size in the subject.

[0242] 40. The method according to any one of the foregoing aspects, wherein prior to administration of the antibody, the subject: a) has confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically documented advanced, unresectable or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which no standard treatment is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) a calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) platelets ≥ 100 × 109 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 109 cells / L; f) has a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) has not received other cancer treatments.

[0243] 41. The method according to any one of the foregoing aspects, wherein prior to administration of the antibody, the subject: a) has not received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, wherein the systemic agent includes a radio-immunoconjugate, an antibody-drug conjugate, an immune / cytokine, or a monoclonal antibody; b) does not have persistent toxicity from prior treatment; c) Have not undergone major surgery within < 3 months before administration of the antibody; d) Have not received radiotherapy within < 28 days before administration of the antibody; e) Have not undergone organ transplantation, allogeneic stem cell transplantation or autologous stem cell transplantation; f) Have not received a diagnosis of primary or acquired immunodeficiency; g) Have not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days before administration of the antibody; h) Do not have active central nervous system (CNS) tumor involvement without explicitly using surgery or radiotherapy; i) Do not have an active autoimmune disease or a history of such a disease that requires immunosuppressive therapy; j) Do not have clinical symptoms of CNS metastasis within 28 days before administration of the antibody; and / or k) Do not have leptomeningeal carcinomatosis.

[0244] 42. The method according to any one of aspects 1-41, wherein the antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2 and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant comprising 1 or 2 amino acid changes in any one of the CDRH1, CDRH2 or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2 and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant comprising 1 or 2 amino acid changes in any one of the CDRL1, CDRL2 or CDRL3 amino acid sequences.

[0245] 43. The method according to aspect 42, wherein: (a) The VH comprises the CDRH1, CDRH2 and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising 1 or 2 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1 or 2 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1 or 2 amino acid changes; and / or (b) The VL comprises the CDRL1, CDRL2 and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof comprising one or two amino acid changes, SEQ ID NO: 5, or a variant thereof comprising one or two amino acid changes, and SEQ ID NO: 6, or a variant thereof comprising one or two amino acid changes.

[0246] 44. The method according to embodiment 42 or 43, wherein the antibody comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively.

[0247] 45. The method according to any one of embodiments 1-44, wherein the antibody comprises: VH, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or VL, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.

[0248] 46. The method according to embodiment 45, wherein the antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 8.

[0249] 47. The method according to embodiment 45, wherein the antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 9.

[0250] 48. The method according to any one of embodiments 1-47, wherein the antibody comprises a heavy chain and / or a light chain, the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 1, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 12.

[0251] 49. The method according to embodiment 48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.

[0252] 50. The method according to embodiment 48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.

[0253] 51. An antibody that specifically binds to human DDR1 and is used for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments.

[0254] 52. An antibody that specifically binds to human DDR1 and is used for preparing a drug for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments.

[0255] 53. Use of an antibody that specifically binds to human DDR1 for treating cancer, wherein the treatment is carried out according to the method described in any one of the foregoing embodiments.

[0256] Examples

[0257] Example 1 - Binding Characteristics and Antitumor Activity of Anti-DDR1 Antibody 9H-1

[0258] Test the binding characteristics of anti-DDR1 antibody 9H-1 in various species and its ability to inhibit tumor growth in vivo in a mouse cancer model.

[0259] A. Binding Characteristics

[0260] First, test the affinity of 9H-1 for DDR1 proteins from human, mouse, rat, and cynomolgus monkey. Biacore assays were used to determine the affinity of 9H-1 for the extracellular domain of DDR1 from human, mouse, rat, and cynomolgus monkey. Table 5 shows that 9H-1 binds to DDR1 from various species with high affinity.

[0261] Table 5. Affinity of 9H-1 for DDR1 from Different Species

[0262] Next, test the ability of 9H-1 to bind to human cells expressing DDR1. Flow cytometry analysis showed that 9H-1 binds significantly more T47D cells (DDR1 high / DDR2 low) compared to BT549 cells (DDR1 low / DDR2 high) (see Figure 1 ).

[0263] B. Antitumor Activity

[0264] Briefly, mice were inoculated with E0771 mouse Ddr1- / - cells expressing human DDR1 (engineered triple-negative breast cancer cell line). Every other day, mice were treated with 10 mg / kg 9H-1, 9H-1-LALAPG (which contains the heavy chain of SEQ ID NO: 11 with the following mutations: L238A, L239A, P333G, numbered according to SEQ ID NO: 11), or IgG control. Tumors were measured every two weeks.

[0265] Figure 2 The results shown indicate that 9H-1 significantly inhibited tumor growth in mice compared to mice treated with IgG control.

[0266] Example 2 - In Vivo Pharmacokinetics of Anti-DDR1 Antibody 9H-1 at Modeled FIH Dose

[0267] To determine the first-in-human (FIH) dose of the anti-DDR1 antibody 9H-1, a single dose of the antibody was administered to cynomolgus monkeys for pharmacokinetic modeling.

[0268] According to Table 6, the 9H-1 antibody was administered to cynomolgus monkeys at low, medium, and high doses via an intravenous infusion pump. Serum samples were collected before dosing and at 0.25 hours, 8 hours, 24 hours, 72 hours, 120 hours, 168 hours, 240 hours, 288 hours, 336 hours, 504 hours, 576 hours, 672 hours, 840 hours, and 1008 hours. Analysis was performed by antigen capture ELISA, and the individual concentrations of 9H-1 in each animal are shown in Figures 3A to 3D in.

[0269] Table 6. Dose Levels of 9H-1 in Cynomolgus Monkeys

[0270] A two-compartment model with first-order elimination was selected to fit the PK data from the cynomolgus monkey study. During modeling, a three-compartment structure resulted in a slightly lower AIC; however, the two-compartment model was selected to reduce the risk of overparameterization.

[0271] The goodness-of-fit of the three-compartment model was included for comparison. The parameters were scaled using the following equations: Vh = tvV (BWh / BWm)^1 V2h = tvV2 (BWh / BWm)^1 Clh = tvCl (BWh / BWm)^0.8 Cl2h = tvCl2 (BWh / BWm)^0.8 The average body weight of cynomolgus monkeys is 2.15 kg, while 80 kg was used as the estimated human body weight. Due to the significantly irregular PK profile indicating anti-drug antibodies, some animals and time points were excluded from the modeling database. The following animals and time points were included in the modeling: P0101: 0.25 - 240 hours P0102: 0.25 - 240 hours P0103: 0.25 - 240 hours P0201: 0.25 - 504 hours P0202: 0.25 - 504 hours P0203: 0.25 - 1008 hours Table 7 below shows the scaled human model parameters: Table 7. Scaled human model parameters

[0272] The model based on cynomolgus monkey data and scaled human parameters, Figure 4 and Figure 5 showed simulated concentrations of 9H-1 administered at a fixed dose of 8 - 1600 mg every two weeks (Q2W, Figure 4 ) or every three weeks (Q3W, Figure 5 ). These data indicate that when the antibody is administered at any fixed dose Q2W or Q3W, the concentration of 9H-1 remains above the concentration sufficient to bind to human DDR1 and inhibit DDR1 function. Table 8 shows the steady-state parameters of simulated human 9H-1 exposure.

[0273] Table 8. Simulated human 9H-1 pharmacokinetics

[0274] Example 3 - Study of the safety, pharmacokinetics, pharmacodynamics, and activity of 9H-1 in adult subjects with locally advanced or metastatic solid tumors

[0275] This example describes an open-label, Phase 1 dose-escalation and expansion trial to evaluate the safety and tolerability, efficacy, pharmacokinetics (PK), pharmacodynamics (PD), and activity of the dose regimen of 9H-1 (humanized anti-DDR1 monoclonal antibody) in adults with advanced solid cancer. 9H-1 is a first-in-class humanized monoclonal antibody targeting DDR1, which is designed to disrupt the collagen arrangement in the tumor stroma and allow the subject's own immune cells to infiltrate the tumor.

[0276] DDR1-targeted therapy has the potential to benefit a wide number of cancer subjects. Analysis of tumor biopsies from various cancer types has confirmed some measurable level of DDR1 expression in a range of malignancies, with some notable exceptions. Low expression of DDR1 in hepatocellular carcinoma and sarcomas was noted, which is why they were excluded from enrollment in the trial. To understand the DDR1 expression levels associated with benefit and to better understand the cancer types that may potentially benefit, enrollment in the trial included all solid tumors, except hepatocellular carcinoma and sarcomas as described above, and gliomas due to the uncertainty of blood-brain barrier penetration.

[0277] A. Study Design

[0278] Overall Design

[0279] The purpose of the dose escalation schedule is to determine the safety, tolerability, optimal dose, and optimal dosing schedule of 9H-1.

[0280] This study will include five cohorts of subjects to whom 9H-1 will be administered intravenously at a dose of 8 mg (cohort 1), 24 mg (cohort 2), 80 mg (cohort 3), 240 mg (cohort 4), 400 mg (cohort 5), 800 mg (cohort 6), or 1600 mg (cohort 7) every three weeks. Subjects in cohorts 1 and 2 may have their dose escalated to the dose level of cohort 3 if, after 90 days of treatment, they do not have a related adverse event of grade ≥ 2 and the dose level 3 has not been dropped according to the dose escalation design described below.

[0281] 9H-1 as a diluted solution will be administered intravenously (IV) over 1 hour using an intravenous injection line containing a sterile, non-pyrogenic, low-protein-binding 0.2-micron to 5-micron in-line or add-on filter. After the first two doses have been given to each subject without any signs of infusion reaction, and with the permission of the study site PI, the infusion time may be reduced to 30 minutes. If an infusion reaction is observed, the SRC may adjust the premedication and infusion duration.

[0282] Starting from Dose Group 4, up to 10 biomarker backfill slots will be available for subjects who wish to enroll in the trial. The backfill points will be available after the dose group has been fully enrolled and is considered safe to continue escalating or has been determined to be the Recommended Phase 2 Dose (RP2D). Pretreatment archival tissue or fresh pretreatment biopsies and post-treatment biopsies 6 weeks after treatment initiation will be mandatory. Pretreatment and post-treatment CD8 PET scans will be mandatory if the functionality of the enrolling study site is available. The specific number of slots available for biomarker backfill and the specific histological types to be included or excluded will be determined based on available data.

[0283] Concomitant medications

[0284] Any medications or vaccines (including over-the-counter (OTC) or prescription drugs, vitamins, and / or herbal supplements) that participants receive at the time of enrollment or during the study must be recorded along with the reason for use, the administration dates (including start and end dates), and the dose information (including dose and frequency).

[0285] If there are any questions regarding concomitant or prior treatments, the Medical Monitor should be contacted. During the course of the trial, medications or immunizations specifically prohibited in the exclusion criteria are not allowed. If there are clinical indications for any medications or immunizations specifically prohibited during the trial, it may be necessary to interrupt study treatment or immunization. The investigator will discuss the prohibited medications and immunizations with the Sponsor's Clinical Director. The final decision regarding any supportive treatments or immunizations is made by the investigator and / or the subject's attending physician. However, the decision to continue the subject's study treatment requires the mutual agreement of the investigator, the Sponsor, and the subject.

[0286] The following medications and immunizations are prohibited during the study: - Anti-tumor systemic chemotherapy or biotherapy - Immunotherapy not specified in this protocol - Chemotherapy not specified in this protocol - Investigational agents other than 9H-1 - Radiation therapy (radiation therapy for symptomatic solitary lesions or to the brain may be permitted at the discretion of the investigator) - Live vaccines or live attenuated vaccines within 30 days prior to the first dose of study treatment and while participating in the study (inactivated vaccines are permitted). Note: Any licensed COVID-19 vaccines (including those for emergency use) in a specific country are permitted in the study as long as they are mRNA vaccines, adenovirus vaccines, or inactivated vaccines. These vaccines will be treated only as any other concomitant treatment. Investigational vaccines (i.e., those not licensed or approved for emergency use) are not permitted.

[0287] - Systemic glucocorticoids, unless used for the following purposes: To regulate symptoms of AEs suspected to have an immunological etiology To prevent vomiting As premedication for IV contrast allergy To treat COPD exacerbations (only short-term orally or IV at > 10 mg / day of prednisone equivalent) For chronic systemic replacement at no more than 10 mg / day of prednisone equivalent Other glucocorticoid uses, unless used for the following purposes: For topical or ophthalmic use Intra-articular joint use For inhalation in the treatment of asthma or chronic obstructive pulmonary disease Note: Inhaled steroids are permitted for the treatment of asthma.

[0288] If the investigator determines that the subject requires any of the above treatments for any reason, 9H-1 must be interrupted.

[0289] All treatments that the investigator deems necessary for the welfare of the subject may be administered at the discretion of the investigator in accordance with community standards of medical care.

[0290] All concomitant medications will be recorded on the eCRF, including all prescription, over-the-counter products, herbal supplements, and IV medications and fluids. If there are changes during the study, the recording of drug dose, frequency, route, and date should also be included on the eCRF.

[0291] All concomitant medications received within 28 days before the first dose of study treatment and up to 30 days after the last dose of study treatment should be recorded. All concomitant medications administered during an SAE or ECIS should be recorded.

[0292] BOIN design for dose escalation

[0293] The Bayesian optimal interval (BOIN) design will be used to explore the maximum tolerated dose (MTD). The BOIN design is implemented in a simple way similar to the traditional 3 + 3 design, but is more flexible and has stronger operating characteristics compared to more complex model-based designs (such as the continual reassessment method (CRM)). Dose-limiting toxicities (DLTs) occurring in the first cycle will be used for dose exploration.

[0294] The steps to implement the BOIN design are described as follows: 1. Accelerated titration is performed as follows up to dose level 3 (1 mg / kg): Treat the first subject at dose level 1. If no DLT is observed, increase the dose to the next higher level. Continue this dose escalation process with one subject per dose until either of the following events is observed: (i) the first instance of DLT, or (ii) the second instance of moderate (grade 2) toxicity. Then treat two additional subjects at the current dose level. Thereafter, treat subjects in groups of three as described in Steps 2 and 3. In the case where titration reaches dose level 3 without observing (i) or (ii), treat subjects in groups of three starting from dose level 4.

[0295] 2. To assign the dose to the next group of subjects, dose escalation / de-escalation is performed according to the rules shown in Table 5. When using Table 5, note the following: 3. “Elimination” means eliminating the current and higher doses from the trial to prevent treating any future subjects at these doses as they are overly toxic.

[0296] 4. When we eliminate a dose, the dose is automatically de-escalated to the next lower level. When the lowest dose is eliminated, the trial is stopped for safety. In this case, no dose should be selected as the MTD.

[0297] 5. If no action is triggered (i.e., escalation, de-escalation, or elimination), treat new subjects at the current dose.

[0298] 6. If the current dose is the lowest dose and the rule indicates dose de-escalation, treat new subjects at the lowest dose unless the number of DLTs reaches the elimination boundary (at which point the trial is terminated for safety).

[0299] 7. If the current dose is the highest dose and the rule indicates dose escalation, treat new subjects at the highest dose.

[0300] 8. Repeat Step 2 until the maximum sample size of 30 is reached, or stop the trial if the number of evaluable subjects treated at the current dose reaches 9 and the decision according to Table 9 will be to remain at the current dose.

[0301] Table 9. Dose escalation / de-escalation rules for the BOIN design.

[0302]

[0303] The “# of DLTs” is the number of subjects with at least 1 DLT. When no action is triggered (i.e., escalation, de-escalation, or elimination), maintain the current dose for treating the next group of subjects.

[0304] "NA" means that the dose cannot be escalated until three DLT - evaluable subjects have been treated.

[0305] All adverse events (AEs) specified in Table 10 should be counted as DLTs, except those clearly due to disease progression or external causes.

[0306] Table 10. Adverse Events.

[0307]

[0308] Long - term extension phase

[0309] Subjects will receive treatment with 9H - 1 until they meet the criteria for study discontinuation. When the RP2D is determined, subjects in the dose - escalation part of the trial will be able to transition from their assigned dose cohort to receive the RP2D.

[0310] Study termination

[0311] The end of the study is defined as the primary completion date, which is defined as the date when the last subject completes the last visit (phone contact is also considered a visit), or when the sponsor decides to terminate the study, whichever occurs first.

[0312] Enrollment will stop when one of the following occurs: - Before the expected number of subjects has been enrolled, the study treatment is considered too toxic to continue. This assessment will be made by the CTSC.

[0313] - The stated number of subjects to be enrolled is reached. This number may be increased to include replacement subjects for those not DLT - evaluable and subjects added to the intermediate dose or expansion cohorts.

[0314] - The stated objectives of the study are achieved.

[0315] - The sponsor decides.

[0316] Upon termination of the study, the sponsor and the investigator must ensure that adequate consideration is given to the protection of the subjects' interests.

[0317] If a subject has completed all phases of the study, including a 30 - day (±7 days) follow - up after receiving the last dose of their study treatment, he or she is considered to have completed the study, unless they are experiencing ongoing study treatment - related AEs or SAEs. For subjects with ongoing SAEs or study treatment - related AEs, follow - up continues at least every 4 weeks until resolution or return to baseline, stabilization of the event, subject loss to follow - up or withdrawal of consent, or as medically monitored as necessary, whichever occurs first. If a subject starts another anti - cancer treatment, safety follow - up will stop.

[0318] The total duration of the study from screening of the first participant to the end of the study is expected to be approximately 40 months.

[0319] B. Study Population

[0320] Inclusion Criteria

[0321] Participants are eligible for the study if the following criteria apply: 1. Willing to read, understand, and sign the informed consent form.

[0322] 2. Age ≥ 18 years.

[0323] 3. Measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1, biopsy-confirmed metastatic or advanced, unresectable malignant tumors, excluding sarcomas and gliomas.

[0324] 4. Have a pathologic record of advanced / unresectable or metastatic cancer that is refractory or intolerant to standard therapy known to confer benefit, or for which no standard therapy is available.

[0325] 5. Subjects must have an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1.

[0326] 6. Subjects must have a life expectancy of ≥ 3 months.

[0327] 7. Subjects must have the following laboratory values (obtained ≤ 28 days prior to enrollment)

[0328] a. Calculated creatinine clearance (CrCL) must be ≥ 50 mL / min as calculated by the Cockcroft - Gault formula.

[0329] b. Total bilirubin ≤ 1.5 × ULN, unless there is a history of known Gilbert's syndrome (in which case total bilirubin must ≤ 3 × ULN).

[0330] c. AST and ALT ≤ 2.5 × ULN.

[0331] d. Hemoglobin ≥ 9.0 g / dL.

[0332] e. Platelets ≥ 100 × 109 cells / L

[0333] f. Absolute neutrophil count ≥ 1.5 × 109 cells / L (without the use of hematopoietic growth factors).

[0334] 8. Corrected QT interval (QTc) ≤ 470 ms (calculated by Fridericia's correction formula).

[0335] 9. Women of childbearing potential (WOCBP) must have a negative urine pregnancy test within 72 hours prior to the first administration of 9H-1 and a negative urine pregnancy test on the first day of dosing.

[0336] 10. WOCBP and men with female partners of childbearing potential must agree to use appropriate birth control throughout their participation and for 90 days after the last dose of 9H-1.

[0337] 11. Subjects must be willing to comply with the study visit schedule and the prohibitions and restrictions specified in this protocol.

[0338] 12. Subjects must have a disease site that is acceptable for biopsy and be a candidate for tumor biopsy according to the guidelines of the treating institution, or have archived tissue available at the time of enrollment.

[0339] a. Subjects without an acceptable disease site for biopsy may be considered after discussion with the sponsor.

[0340] 13. Subjects are not enrolled in any other clinical trial and have not received other treatment for their malignancy.

[0341] Additional inclusion criteria for biomarker backfill subjects: 1. Subjects must have a disease site that is acceptable for biopsy and be a candidate for tumor biopsy according to the guidelines of the treating institution. Subjects must be willing to undergo a new tumor biopsy or have archived tissue available at the time of enrollment and be willing to undergo at least one biopsy during the study.

[0342] a. Subjects without an acceptable disease site for biopsy may be considered after discussion with the sponsor.

[0343] Exclusion criteria

[0344] If any of the following criteria apply, participants are excluded from the trial: 1. The subject has received prior treatment with a systemic agent within 28 days or five half-lives of the drug (whichever is shorter), where the systemic agent includes, but is not limited to, radio-immunoconjugates, antibody-drug conjugates, immun / cytokines, and monoclonal antibodies (e.g., anti-CTLA4, anti-PD-1, and anti-PD-L1) 2. According to CTCAE, the subject has persistent toxicity > Grade 1 from prior treatment and has the following a. Alopecia and vitiligo b. Neuropathy of grade ≤ 2 c. Well-controlled hypothyroidism / hyperthyroidism or other endocrine diseases well-controlled by hormone replacement 3. The subject has undergone major surgery (excluding minor surgeries such as placement of vascular access) < 3 months before administration of 9H-1.

[0345] 4. The subject has received radiotherapy < 28 days before administration of 9H-?.

[0346] a. Exception: Limited radiotherapy (e.g., for pain relief) is allowed before and during study treatment, provided there is no acute toxicity and the subject has measurable disease outside the radiotherapy field.

[0347] 5. The subject has undergone or is expected to undergo an organ transplant at any time, including allogeneic or autologous stem cell transplantation.

[0348] 6. The subject has a diagnosis of primary or acquired immunodeficiency.

[0349] 7. The subject has received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days before administration of 9H-1. Exception: Inhaled or topical (including mouthwash) steroids and adrenal replacement dosing are allowed in the absence of active autoimmune disease.

[0350] 8. The subject has an active autoimmune disease requiring immunosuppressive therapy or a previous history of autoimmune disease. Exceptions may apply.

[0351] 9. The subject has a known severe intolerance or hypersensitivity to monoclonal antibodies, Fc-bearing proteins (e.g., soluble receptors or other Fc fusion proteins), or IV immunoglobulin preparations; a previous history of human anti-human antibody response; a known allergy to any of the study drugs, their analogs, or excipients in various formulations of any agent.

[0352] 10. The subject has active central nervous system (CNS) tumor involvement (including signs of cerebral edema by magnetic resonance imaging (MRI) or progression from previous imaging studies) not definitively treated with surgery or radiotherapy, or has had any requirement for steroids or has had clinical symptoms of CNS metastases / clinical symptoms from CNS metastases within 28 days before study treatment.

[0353] 11. The subject has leptomeningeal carcinomatosis, regardless of treatment history.

[0354] 12. The subject currently has a second primary malignancy in other sites (Exception: non-melanoma skin cancer, appropriately treated carcinoma in situ (e.g., cervix), or asymptomatic prostate cancer under observation). History of other malignancies is permitted, provided that the subject has had no recurrence for ≥ 2 years, or if the subject has been treated with curative intent within the past 2 years and recurrence is not likely in the opinion of the investigator.

[0355] 13. The subject has an active and clinically significant bacterial, fungal, or viral infection, including known hepatitis A, B, or C or HIV (testing not required).

[0356] 14. The subject has received a live vaccine within the past 30 days (inactivated vaccines are permitted; seasonal vaccines administered > 30 days prior to the administration of 9H-1 should be up-to-date).

[0357] 15. Pregnant or breastfeeding women.

[0358] 16. History of any of the following within ≤ 6 months prior to the first dose: a. New York Heart Association class III or IV congestive heart failure, b. Unstable angina, c. Myocardial infarction, d. Unstable symptomatic ischemic heart disease, e. Hypertension that is uncontrolled despite appropriate medical treatment, f. Persistent symptomatic arrhythmia of grade ≥ 2, g. Pulmonary embolism or symptomatic cerebrovascular event, or any other severe cardiac condition (e.g., pericardial effusion or restrictive cardiomyopathy). Chronic atrial fibrillation on stable anticoagulation therapy is permitted.

[0359] 17. The subject has any contraindications to the imaging evaluations or other study procedures to which the subject will be subjected.

[0360] 18. The subject has any medical or social condition that, in the opinion of the investigator, may place the subject at increased risk, affect compliance, or confound safety or the interpretation of other clinical study data.

[0361] C. Efficacy assessment

[0362] Participants will undergo tumor assessments until loss of clinical benefit as determined by the investigator (unless the participant withdraws consent or the sponsor terminates the study). All participants who discontinue study intervention for reasons other than disease progression (e.g., adverse events) will continue tumor assessments until death, disease progression, initiation of another systemic anti-cancer therapy, loss to follow-up, withdrawal of consent, or study termination, whichever occurs first. Tumor assessments may be repeated at any time at the discretion of the investigator if progressive disease is suspected.

[0363] Measurable and evaluable lesions should be assessed and recorded at screening. Tumor assessments performed as standard of care prior to obtaining informed consent and within 30 days prior to enrollment need not be repeated at screening.

[0364] Screening assessments must include CT scans of the chest / abdomen and pelvis (using IV contrast unless contraindicated and oral contrast according to appropriate institutional standards). If a contrast-enhanced CT scan is contraindicated (i.e., in participants with contrast allergy or impaired renal clearance), a non-contrast CT scan of the chest may be performed and an MRI scan of the abdomen and pelvis should be performed. All subjects with neurological symptoms will require an MRI of the brain.

[0365] If a CT scan for tumor assessment is performed in a positron emission tomography (PET) / CT scanner, the CT acquisition must be consistent with the standards for a fully contrast-enhanced diagnostic CT scan.

[0366] If clinically indicated, a bone scan (technetium-99m [Tc-99m]) or sodium fluoride (NaF) PET should be performed at screening. If bone metastases are present at screening and not visible on CT or MRI scans, or if clinically indicated, repeat Tc-99m and NaF-PET bone scans should be performed at the time of complete response in the target disease or when progression in bone is suspected.

[0367] If clinically indicated, CT scans should also be performed of the neck or extremities and repeated throughout the study if there are signs of disease at screening.

[0368] CD8 PET scans obtained during the study are considered exploratory and will not be used to assess treatment response by RECIST v1.1. However, when possible, CT scans consistent with the standards for a fully contrast-enhanced diagnostic CT scan should be used for CD8 PET scans. The contrast-enhanced CT scan should be evaluated separately from the CD8 PET scan and will count as an efficacy endpoint assessment.

[0369] All measurable and evaluable lesions should be re-evaluated in each subsequent tumor assessment. The same radiographic procedures used to assess the disease site at screening should be applied to subsequent tumor assessments (e.g., CT scan with the same contrast protocol).

[0370] Response will be evaluated by the investigator using RECIST v1.1. If possible, evaluation should be performed by the same assessor to ensure intra-visit consistency. Before dosing in the next cycle, the investigator must check the results.

[0371] The overall response rate (ORR) is defined as the primary efficacy endpoint for each dose expansion cohort. If a CR / PR is observed from the overall objective response assessment, the subject will be considered a responder by the investigator according to RECIST. This endpoint will be analyzed according to the BOP2 method. At the end of the cohort, the ORR will be calculated separately for each expansion cohort using the binomial exact method with 95% confidence intervals, where the denominator will include all efficacy-evaluable subjects in the cohort (subjects who have completed at least three RECIST assessments after baseline or who have been discontinued from the study due to death, AE, lack of efficacy, or progressive disease). As an exploratory endpoint, the overall confirmed response rate (CR / PR confirmed by the next RECIST assessment), the ORR according to iRECIST, and the ORR (ITT method) including all dosed subjects in the denominator will be similarly analyzed for each expansion cohort with 95% confidence intervals after enrollment is complete.

[0372] Progression-free survival (PFS) is defined as an exploratory efficacy endpoint for each histology-specific expansion cohort, which is the duration from Day 1 to the date of first disease progression, as assessed by the investigator according to RECIST v1.1 (or as the primary reason for discontinuation) or death. This time-to-event variable will be censored at the date of the last RECIST assessment or at the date of discontinuation not due to disease progression or death. This endpoint for each expansion cohort including all dosed subjects will be analyzed using the Kaplan-Meier method. PFS according to the iRECIST criteria will be similarly derived and analyzed.

[0373] Duration of response (DOR) is defined as an exploratory for each histology-specific expansion cohort, which is the duration from the first observed response (CR / PR according to RECIST v1.1) to the date of first disease progression after response. This time-to-event variable will be censored at the date of the last RECIST assessment or at the date of discontinuation not due to AE, disease progression, or death after the initial response date. This endpoint for each expansion cohort including all responders in the cohort will be analyzed using the Kaplan-Meier method. DOR according to the iRECIST criteria will be similarly derived and analyzed.

[0374] The disease control rate (DCR) is defined as the percentage of subjects with advanced or metastatic cancer who have achieved a complete response, partial response, and stable disease as determined by RECIST v1.1. This endpoint will be analyzed for each expansion cohort, including all dosed subjects, using the Kaplan-Meier method.

[0375] Overall survival (OS) is defined as an exploratory endpoint for each histology-specific expansion cohort and is the duration from Day 1 to the date of death. The time-to-event variable will be censored at the date of the last known survival. This endpoint will be analyzed for each expansion cohort, including all dosed subjects, using the Kaplan-Meier method.

[0376] D. Safety Assessments

[0377] Safety assessments will consist of monitoring and recording adverse events (including serious adverse events (SAEs) and special interest adverse events (AEs)), performing protocol-specified safety laboratory evaluations, measuring protocol-specified vital signs, and performing other protocol-specified tests considered essential for the safety assessment of the study.

[0378] E. Pharmacokinetics

[0379] Serum PK of 9H-1 will be collected in all parts of the study. The planned PK time points may be updated or discontinued after an initial assessment of the characterized PK profile. PK sampling may be reduced without protocol modification if emerging PK data demonstrate that a lower frequency schedule of events is warranted.

[0380] The following PK parameters for 9H-1 will be determined using non-compartmental methods: Cmax, time to Cmax (Tmax), last validated plasma concentration (Clast), AUC0-last (AUC504h or AUC336h or AUC672h for the doses on Day 1 of Cycle 1 and Day 3 of Cycle 3), time to last measurable concentration (Tlast), (t1 / 2), and, if possible, Vd and CL. Possible relationships between PK and PD variables, efficacy, and / or selected toxicities will be explored as appropriate.

[0381] PK profiles for the evaluation of the PK characteristics of 9H-1 will be collected from all enrolled subjects. Complete PK profiles will be collected from all enrolled subjects.

[0382] Residual PK, PD, and ADA samples used for PK and ADA analysis may also be used for exploratory PK and / or PD analysis related to 9H-1 treatment and cancer. This may include the use of residual samples for exploratory, alternative PK assay development and analysis.

[0383] 9H-1 levels will be determined using blood samples collected before and after dosing during the EOT visit. These determinations will be used to calculate single-dose and repeat-dose PK profiles for each evaluable subject at each dose level. Non-compartmental analysis will be used to estimate single-dose, monotherapy 9H-1. PK parameters will include, but not be limited to, accumulation ratio, Cmax, Tmax, Clast, Tlast, AUC0-last (AUC504h or AUC336h or AUC672h), Vd, CL, and t½.

[0384] Descriptive statistics will be used to tabulate and summarize 9H-1 concentrations. 9H-1 concentration plots will be drawn by group for time points. Descriptive statistics will be used to tabulate and summarize individual and summary PK parameters.

[0385] F. Immunogenicity

[0386] The relationship between immunogenicity and 9H-1 serum concentration and adverse events will be presented graphically and tabulated to characterize the relationship between changes in ADA at screening and the serum concentration of monotherapy 9H-1.

[0387] In addition, the potential correlation between immunogenicity and other endpoints (primary safety, efficacy, and biomarker parameters) can be evaluated. This will be done in two steps. First, a descriptive analysis will be performed graphically between changes in immunogenicity at screening values and primary safety, efficacy, and biomarker parameters (as categorical or continuous variables). If any potential correlation is identified, further studies will be conducted using mechanism-based modeling approaches as appropriate.

[0388] The concentration / adverse event-immunogenicity relationship will be presented graphically and tabulated to characterize the relationship between the presence of screening immunogenicity and changes in the serum concentration of monotherapy 9H-1.

[0389] In addition, the potential correlation between immunogenicity and other endpoints (primary safety, efficacy, and biomarker parameters) can be evaluated. This will be done in two steps. First, a descriptive analysis will be performed graphically between changes in immunogenicity at screening values and primary safety, efficacy, and biomarker parameters (as categorical or continuous variables). If any potential correlation is identified, further studies will be conducted using mechanism-based modeling approaches as appropriate.

[0390] G. Biomarkers

[0391] The exploratory biomarker objectives of this study are to identify biomarkers associated with immuno-oncology research interventions by assessing tumor tissue and circulating soluble factors, including but not limited to DNA, RNA, enzymes, growth factors, cytokines, antibodies, and immune cells in tissue and blood. Additionally, the microbial profile can be evaluated from fecal samples. Assessments can be made at baseline and / or as a function of changes in the research intervention to determine associations with clinical outcomes (including clinical response and resistance) and research intervention tolerability.

[0392] Collecting samples for biomarker research is part of this study. The following samples for biomarker research are required and will be collected from all participants in this study as specified in the SoA: - Blood, including PBMC - Skin biopsy - Tumor tissue biopsy (prior, archived, or fresh) - Optionally, the following samples for biomarker research, which should be collected from participants in the study if possible, are as follows: Tumor tissue biopsy (six weeks post-treatment), optionally for all subjects. Mandatory for biomarker backfill subjects.

[0393] Samples can be tested for genetic analysis of tumor and blood samples, including but not limited to circulating cell-free DNA, DNA testing from tumor and / or immune cells, and potentially T cell receptor sequencing. The study can evaluate whether genetic variations correlate with treatment outcomes. If genetic variations are found to have predictive power or adverse events, the data may inform the optimal use of treatment in cancer subjects. Circulating soluble analytes can be evaluated, including but not limited to immunocytokines, growth factors, antibodies, and / or markers associated with immune signatures and activation or cancer. Additionally, tumor and blood samples will be collected before and at the time of the research intervention for immunocyte profiling, which can include immunocyte phenotyping, enumeration, and / or activation status. Genome-wide and targeted messenger RNA (mRNA) expression profiling and sequencing can be performed in tumor and / or blood to determine gene signatures associated with treatment outcomes. Epigenetic analysis can also be performed as these epigenetic are important biomarkers for some cancers.

[0394] Blood, skin, tissue, and tumor biopsies will be collected from subjects throughout the trial for biomarker analysis.

[0395] H. Genetics

[0396] Instructions for sample collection, storage, and transportation for samples used in planned genetic analysis will be provided in the laboratory manual. Samples should be collected for the planned analysis of the association between genetic variants in germline / tumor DNA and clinical outcomes. As described in the activity schedule, blood is collected for planned genetic analysis for DNA. If documented laws or regulations prohibit (or local IRB / IEC does not approve) sample collection for these purposes, such samples should not be collected at the corresponding study sites. Additional DNA extracted from samples used in planned genetic analysis will only be stored for future biomedical research if the participant has signed the Future Biomedical Research consent.

[0397] In the case of DNA extraction failure, alternative genetic blood samples may be requested from the participant. Obtaining an alternative sample will require a signed informed consent, unless it is included in the original consent.

[0398] I. Objectives and Endpoints

[0399] Table 11: Objectives and Endpoints.

[0400]

[0401] For the purposes of analysis, the following groups are defined: Table 12: Groups for Analysis.

[0402]

[0403] J. Statistical Analysis

[0404] This study will use an adaptive approach, using treatment period data to guide trial adaptation and the success or failure of each combination in each study sub-group.

[0405] The statistical analysis plan will be developed and finalized before database lock, and will describe the study populations to be included in the analysis, as well as the process for accounting for missing, unused, and spurious data. This section is a summary of the planned statistical analysis of the primary and secondary endpoints.

[0406] Example 4 - In Vivo Syngeneic Mouse Tumor Model Selection: Identification of an Immune-Repulsive DDR1-Dependent Mouse Model

[0407] The goals of these studies were to identify DDR1-dependent syngeneic mouse models for evaluating immune rejection of novel DDR1-targeted therapies. Selection criteria for identifying immune rejection mouse tumor models included: (i) expression of DDR1; (ii) presence of a functional immune system; (iii) immunohistochemical (IHC) signs of immune cells present in the periphery of the tumor (i.e., excluded); and (iv) resistance to checkpoint inhibition therapy or other therapies to enable study of combination strategies (e.g., checkpoint inhibitors (CPI); chemotherapy, radiotherapy (RT), etc.).

[0408] Eight different syngeneic mouse tumor models that express variable levels of DDR1, have variable levels of resistance to anti-PD1, and are known to be immune models were selected for screening of DDR1-dependent mouse models of immune rejection. (Table 13). The studies described herein used clean cell lines (i.e., free of mycoplasma and murine-pathogen contamination). Transient expression of the CRISPR / Cas9 system (i.e., unstable Cas9 expression) was used to generate the knockout cell lines used to ensure that non-mouse proteins were not expressed in any of the cell lines. Additionally, rather than isolating single cell clones, a pool of DDR1-negative (DDR1KO) cells was sorted using flow cytometry to dilute any potential off-target effects. The sorted cells were expanded and implanted into wild-type immunocompetent mice of the same syngeneic strain.

[0409] The observed tumor growth data confirmed the anti-tumor effects of DDR1 KO in multiple models. (For example, Figures 9A to 13D ). For humane reasons, mice with tumors reaching a volume of > 2,000 mm3 were euthanized. This decreased the average tumor volume at later time points. Interestingly, anti-tumor effects were observed primarily in mouse models of the BALB / c strain ( Figures 9A to 12D ) and the C3H / HeN strain ( Figures 13A to 13D ), and to a lesser extent in the C57BL / 6 mouse tumor model ( Figures 6A to 8C ). The Renca (renal carcinoma) and MBT-2 mouse models were observed to show strong anti-tumor effects. ( Figures 9A to 9C ; Figures 13A to 13D ). The observed anti-tumor effects are summarized in Table 13.

[0410] Table 13. Summary of anti-tumor effects observed in mouse tumor models.

[0411]

[0412] Example 5 - Tumor kinetics study using murine colorectal carcinoma tumor model CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines in Balb / c mice

[0413] The CRISPR-Cas9 system was used to disrupt DDR1 expression in CT26 murine colorectal cells as described in Example 4. Subsequently, isolated CT26 cells with reduced surface DDR1 levels (DDR1r / DDR1 KO) compared to WT controls were sorted using flow cytometry ( Figures 17A - 17C ). DDR1r / DDR1 KO and control cells (DDR1 WT) were injected into both flanks of BALB / c mice (n = 10 per condition) to form tumors. At the DDR1r / DDR1 KO condition, the tumor volume at 31 days (where all mice were still under study) showed a significant decrease in tumor size. These results indicate that DDR1 plays a functional role in suppressing tumor growth and progression.

[0414] Methods and Results

[0415] DDR1 CRISPR knockout: DDR1 was knocked out in the murine colon cancer cell line CT26 (ATCC, CRL-2638) by using two DDR1 sgRNAs and Cas9-RFP (IDT, Cat#10008163). Both DDR1 sgRNAs targeted the DDR1 extracellular domain coding sequence.

[0416] The sgRNA sequences were as follows: sgRNA1: TCCATCTCCACGTAGCCCGTGGG (IDT, Design ID: Mm.Cas9.DDR1.1.AC); [SEQ ID NO:13]; sgRNA2: ACTTACGATG-GATATACTGCTGG (Design ID: Mm.Cas9.DDR1.1.AD). [SEQ ID NO:14]. The RNP complex with Cas9-RFP and sgRNA was generated in vitro according to the manufacturer's instructions. The RNP complex was electroporated into CT26 cells using the Lonza NucleofectorTM system.

[0417] FACS sorting: CT26 DDR1 knockout cell pool was isolated by cell sorting (Sony SH800S). Briefly, CT26 cells were collected 72 hours after electroporation and cell surface DDR1 expression was detected by anti-mouse DDR1 antibody (Sun et al. Nature, 2021 Nov; 599 (7886): 673–678; antibody #33). DDR1-negative population was sorted for continuous culture for one week. Sorted and amplified cells were collected for a second round of sorting to generate > 99% DDR1-negative population. This CT26 cell pool was tested negative for mycoplasma and murine pathogens (Mouse Essential CLEAR panel, Charles River Research Animal Diagnostic Services).

[0418] Tumor mouse model: Female BALB / c mice (strain BALB / cAnNCr1) (n = 20; age = 6 - 8 weeks) obtained from Charles River Laboratories were used in this study. The body weight of the mice at the time of inoculation was approximately 17 - 25 g.

[0419] CT26 tumor cell line was used in the study and is described in Tables 14 and 15 below.

[0420] Table 14. CT26 (WT) [WT: wild-type DDR1]

[0421] Table 15. CT26 (KO) [KO: DDR1 knockout]

[0422] Figure 14 The design of the tumor kinetics study using CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines in Balb / c mice is shown. During the entire study, tumor volume (TV) (mm3) and body weight (BW) were monitored 2 - 3 times per week and the changes were plotted as Figure 15A and Figure 15B shown. If the tumor volume of the mice reached > 2,000 mm3 tumor volume or when the animal died (whichever occurred earlier), the mice were removed from the mean. This resulted in a decrease in the mean tumor volume at subsequent time points. Individual tumor volumes are shown in Figure 16A and Figure 16B .

[0423] On day 31 of the study, all mice survived, and the TV (mean ± SEM) of animals in CT26 WT (Group 1 (G1)) was 2156.77 ± 71.8 mm3, and that in CT26 KO (Group 2 (G2)) was 1126.50 ± 290.45 mm3.

[0424] During the entire study period, there were no differences in body weight (BW) changes between the groups. There were no unexpected deaths or clinical observations during the study, except for mouse #3532 in G1, which was euthanized due to morbidity.

[0425] Surviving and terminal blood (serum) were collected two days before the start of the study (day 2) and at the study endpoint (day 28), respectively. In addition, at the study endpoint (day 28), half (½) of the tumors were placed in 10% formalin and the other half (½) of the tumors were snap-frozen in liquid nitrogen. ( Figure 14 )

[0426] Example 6 - DDR1 expression is associated with poor prognosis in intrahepatic cholangiocarcinoma (iCCA).

[0427] DDR1 is a tyrosine kinase expressed on cancer cells, which binds to collagen, is associated with T cell exclusion, is associated with poor outcomes in several cancer types, and is the target of the investigational drug therapy 9H-1. DDR1 mRNA is known to be highly expressed in intrahepatic cholangiocarcinoma (iCCA). The correlation between DDR1 protein expression and histological and clinicopathological factors and prognosis in iCCA was evaluated.

[0428] Methods: Surgical specimens from 80 patients with iCCA who underwent resection at a single institution from 2004 to 2016 were evaluated by multiplex immunofluorescence (mIF) and DDR1 immunohistochemistry (IHC) in tissue microarrays. IHC and MIF values from 74 patients were averaged using multiple samples from the same tumor. For H score > 150, DDR1 was classified as high. The correlations between DDR1 H score and clinicopathological features and outcomes were compared using Spearman correlation (continuous variables), Wilcoxon rank sum (binary features), or Kruskal-Wallis test (categorical features).

[0429] Results: DDR1 was highly expressed in 87.5% (70 / 80) of iCCA samples. IHC 3+ expression was present on 100% of cells in 25% (20 / 80) of iCCA samples. The DDR1 H score was positively correlated with the percentage of the tumor bed containing stroma (R = 0.27, p = 0.014). Patients with high DDR1 were more likely to have perineural invasion (21%) compared to patients with low DDR1 (0%).

[0430] High DDR1 expression trended with disease-free survival (p = 0.059) and overall survival (0.048) regardless of stage. The DDR1 H score was not associated with CD3+ or CD8+ density in the tumor stroma or parenchyma. The DDR1 H score was not associated with the tumor mutation status including FGFR and IDH1.

[0431] Conclusions: DDR1 was highly expressed in the majority of iCCAs. DDR1 expression was associated with a higher level of stroma containing collagen which is a ligand for DDR1. The prevalence of high DDR1 expression and the associated poor survival outcomes make iCCA a relevant tumor type for evaluating novel DDR1-targeted therapies.

[0432] Example 7 - Phase 1a Study of the Safety, Pharmacokinetics, Pharmacodynamics, and Activity of 9H-1 (PRTH-101) in Adult Subjects with Locally Advanced or Metastatic Solid Tumors

[0433] This example describes some results from an open-label, phase 1 dose-escalation and expansion trial to evaluate the safety and tolerability, efficacy, pharmacokinetics (PK), pharmacodynamics (PD), and activity of the dosing regimen of 9H-1 (an anti-DDR1 humanized monoclonal antibody) in adults with advanced solid cancer as described in Example 3.

[0434] A total of 9 patients in 5 cohorts were administered 9H-1 every three weeks at the Figure 18A dose indicated for each patient. Patients A and F were diagnosed with colorectal cancer (CRC), patients B and I were diagnosed with non-small cell lung cancer (NSCLC), and patients C, D, E, G, and H were diagnosed with papillary thyroid cancer, endometrial cancer, renal cell carcinoma (RCC), thymic carcinoma, and rectal cancer, respectively. Patients A, D, and E discontinued within 2 months of the start of infusion due to progressive disease. Patient C had stable disease but discontinued after an infusion reaction. Patients C, F, G, and H had stable disease for at least about 2 months after the start of infusion and continued treatment.

[0435] Patient B was diagnosed with adenocarcinoma of the right upper lobe, T3N0 (stage IIB). Patient B had the right upper lobe (RUL) resected and received multiple treatment regimens over approximately 3 years, including 3 regimens targeting the PD-1 / PD-L1 pathway. Disease progression occurred approximately 3 - 5 months prior to the start of the infusion of 9H-1. The patient's tumor was noted to have > 50% PD-L1 expression by prior molecular testing.

[0436] In Patient B, tumor size remained stable after treatment with PRTH-101 for approximately 18 weeks compared to baseline ( Figure 18B ; baseline tumor size = 23.81 mm, 18-week tumor size = 23.59 mm). Patient B had disease stability for at least approximately 5 months after the start of the infusion and continued treatment ( Figure 18B ). The dose for Patient B in cycle 9 was escalated from an initial 24 mg to 80 mg.

[0437] PK profiles were obtained for patients in cycle 1 ( Figure 13C ). Generally, the observed concentrations were proportional to the dose. Rapid elimination of the antibody and non-linear PK were observed. This may be due to target-mediated drug disposition (TMDD) at lower doses. Elimination was too early to be associated with anti-drug antibody (ADA) effects. The half-life appeared to be longer at 240 mg. These results are consistent with preclinical observations of concentration-dependent elimination in the range of 10 - 30 μg / mL. One 80 mg and three 240 mg subjects had measurable serum concentrations at the 21-day trough. No accumulation was observed between C1D1 (cycle 1, day 1) and C3D1 (cycle 3, day 1), and the PK profiles between C1D1 and C3D1 (24 mg, 80 mg, and 240 mg doses) were consistent.

[0438] No drug-related adverse events (AEs) were observed.

[0439] Incorporation by reference

[0440] The entire contents of all patents and non-patent literature cited above are incorporated herein by reference.

Claims

1. A method for reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.

2. A method for reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.

3. The method according to claim 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 1600 mg.

4. The method according to claim 1 or 2, wherein the antibody is administered at a dose of about 8 mg to about 800 mg.

5. The method according to any one of claims 1-4, wherein the antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg or about 1600 mg.

6. The method according to any one of claims 1-5, wherein the antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg or 1600 mg.

7. The method according to any one of claims 1-6, wherein the antibody is administered intravenously.

8. The method according to any one of claims 1-7, wherein the antibody is administered via intravenous infusion within 60 minutes.

9. The method according to any one of claims 1-7, wherein the antibody is administered via intravenous infusion within 30 minutes.

10. The method according to any one of claims 1-9, wherein the antibody is administered once a week.

11. The method according to any one of claims 1-9, wherein the antibody is administered once every 2 weeks.

12. The method according to any one of claims 1-9, wherein the antibody is administered once every 3 weeks.

13. The method according to any one of claims 1-9, wherein the antibody is administered once every 4 weeks.

14. The method according to any one of claims 1-9, wherein the antibody is administered once every 8 weeks.

15. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 8 mg once every 3 weeks.

16. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 24 mg once every 3 weeks.

17. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 80 mg once every 3 weeks.

18. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 240 mg once every 3 weeks.

19. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 400 mg once every 3 weeks.

20. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 800 mg once every 3 weeks.

21. The method according to any one of claims 1-9, wherein the antibody is administered intravenously at a dose of 1600 mg once every 3 weeks.

22. The method according to any one of claims 1-21, wherein the dose is a therapeutically effective amount.

23. The method according to any one of the preceding claims, wherein the subject has cancer.

24. The method according to claim 23, wherein the antibody is administered to treat the cancer in the subject.

25. The method according to claim 23 or 24, wherein the cancer expresses DDR1.

26. The method according to any one of claims 23-25, wherein the cancer is a solid cancer.

27. The method according to any one of claims 23-26, wherein the cancer is a locally advanced or metastatic solid cancer.

28. The method according to any one of claims 23-27, wherein the cancer is inoperable.

29. The method according to any one of claims 23-28, wherein the cancer is refractory to immunotherapy.

30. The method according to claim 29, wherein the immunotherapy is an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM-3 antibody, an antagonist anti-LAG-3 antibody, an antagonist anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody or an agonist anti-CD28 antibody.

31. The method according to any one of claims 23-30, wherein the cancer is not a sarcoma, hepatocellular carcinoma or glioma.

32. The method according to any one of claims 23-31, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, intrahepatic cholangiocarcinoma (iCCA) or bone cancer.

33. The method according to any one of claims 23-32, wherein the cancer is colorectal cancer, intrahepatic cholangiocarcinoma (iCCA), ovarian cancer or non-small cell lung cancer.

34. The method according to claim 33, wherein the colorectal cancer is microsatellite stable (MSS).

35. The method according to any one of claims 23-34, wherein the subject is not a candidate for standard of care treatment.

36. The method according to any one of claims 23-35, wherein the cancer is refractory to standard of care treatment.

37. The method according to any one of claims 23 - 36, wherein the subject is intolerant to the standard of care treatment.

38. The method according to claim 36 or 37, wherein the standard of care treatment is chemotherapy or radiation.

39. The method according to any one of claims 1 - 38, wherein administering the antibody reduces the tumor size in the subject.

40. The method according to any one of the preceding claims, wherein prior to administering the antibody, the subject: a) has confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically documented advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which no standard treatment is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) a calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft - Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 10 9 cells / L; or vi) Absolute neutrophil count ≥ 1.5 × 10 9 cells / L; f) has a Corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) has not received other cancer treatments.

41. The method according to any one of the preceding claims, wherein prior to administering the antibody, the subject: a) has not received prior treatment with a systemic agent within 28 days or within five half - lives of the drug, whichever is shorter, where the systemic agent includes radio - immunoconjugate, antibody - drug conjugate, immune / cytokine, or monoclonal antibody; b) does not have ongoing toxicity from prior treatment; c) has not undergone major surgery within < 3 months prior to administering the antibody; d) has not received radiation therapy within < 28 days prior to administering the antibody; e) has not undergone organ transplantation, allogeneic stem cell transplantation, or autologous stem cell transplantation; f) has not received a diagnosis of primary or acquired immunodeficiency; g) has not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administering the antibody; h) No active central nervous system (CNS) tumor involvement without explicitly using surgery or radiotherapy; i) No active autoimmune disease requiring immunosuppressive therapy or a history of such disease; j) No clinical symptoms of CNS metastasis within 28 days before administration of the antibody; and / or k) Not suffering from leptomeningeal carcinomatosis.

42. The method according to any one of claims 1-41, wherein the antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences in the VH amino acid sequence shown in SEQ ID NO: 7, the variant comprising one or two amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences in the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant comprising one or two amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.

43. The method according to claim 42, wherein: (a) The VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising one or two amino acid changes, SEQ ID NO: 2, or a variant thereof comprising one or two amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising one or two amino acid changes; and / or (b) The VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof comprising one or two amino acid changes, SEQ ID NO: 5, or a variant thereof comprising one or two amino acid changes, and SEQ ID NO: 6, or a variant thereof comprising one or two amino acid changes.

44. The method according to claim 42 or 43, wherein the antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown in SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively.

45. The method according to any one of claims 1-44, wherein the antibody comprises: VH, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 7; and / or VL, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 8 or 9.

46. The method according to claim 45, wherein the antibody comprises VH and VL, the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO:

8.

47. The method according to claim 45, wherein the antibody comprises VH and VL, the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO:

9.

48. The method according to any one of claims 1-47, wherein the antibody comprises a heavy chain and / or a light chain, the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO:

12.

49. The method according to any one of the preceding claims, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO:

12.

50. The method according to any one of claims 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO:

12.

51. The method according to any one of claims 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO:

12.

52. The method according to any one of claims 1-48, wherein the antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO:

12.

53. The method according to any one of the preceding claims, wherein administration of the antibody prevents further growth of tumor size in the subject.

54. The method according to any one of the preceding claims, wherein administration of the antibody achieves at least disease stabilization in the subject.

55. An antibody that specifically binds to human DDR1, which is used for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.

56. An antibody that specifically binds to human DDR1, which is used for preparing a medicament for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.

57. Use of an antibody that specifically binds to human DDR1 for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.

Images