Methods of treating cancer using anti-DDR1 antibodies and immune checkpoint inhibitors
Through the combined treatment of antibodies specifically bound to human DDR1 and immune checkpoint inhibitors, the problem of cancer immune rejection is solved, the therapeutic effect on immune cold tumors is enhanced, tumor immune rejection is reduced, and treatment response is improved.
Patent Information
- Application Number
- CN202380090150.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-08-16
- Filing Date
- 2023-11-15
- Publication Date
- 2025-08-01
AI Technical Summary
The prior art is difficult to effectively treat immune rejection in cancer, especially immune cold tumors that are inadequate in the treatment of immune checkpoint inhibitors, resulting in limited treatment options.
Using a combination of antibodies specifically bound to human DDR1 and immune checkpoint inhibitors, the tumor matrix is destroyed and the infiltration and anti-tumor ability of immune cells to the tumor are enhanced by the administration of anti-DDR1 antibodies and PD-1 or PD-L1 antagonists.
It enhances the therapeutic effect on immune cold tumors, reduces tumor immune rejection, reduces tumor burden, improves the response to immune checkpoint inhibitors, and achieves more effective cancer treatment.
Smart Images

Figure CN120418296A_ABST
Abstract
Description
[0001] Cross - Reference to Related Applications
[0002] This application claims priority to U.S. Provisional Application Serial No. 63 / 383,954, filed November 16, 2022, and U.S. Provisional Application Serial No. 63 / 519,935, filed August 16, 2023. The content of each of these related applications is hereby incorporated by reference in its entirety.
[0003] Reference to Sequence Listing
[0004] This application is being filed with a Sequence Listing in electronic format. The Sequence Listing is provided as a file named INCEN011WOseqlist.xml, created on November 15, 2023, and having a size of 16,422 bytes. The information in the electronic format of the Sequence Listing is hereby incorporated by reference in its entirety. Technical Field
[0005] The present disclosure relates to methods of treating disorders associated with discoidin domain receptor tyrosine kinase 1 (DDR1) by administering an anti - DDR1 antibody in combination with an immune checkpoint inhibitor. Background Art
[0006] Cancer immune exclusion is a cancer phenotype characterized by a spatial imbalance where more immune cells are near the tumor, but fewer immune cells physically contact the tumor cells, and it is prevalent in a high proportion of tumors. Transforming immune - excluded tumors into immune - accessible ones is an active area of oncology research.
[0007] Accordingly, there remains an unmet medical need for treatment options for immune - excluded cancers. Summary of the Invention
[0008] Discoidin domain receptor tyrosine kinase 1 (DDR1) is a receptor tyrosine kinase that is widely expressed in normal and transformed epithelial cells and is activated by various types of collagen. DDR1 autophosphorylation is achieved by all collagens (type I to type VI) tested to date. DDR1 is mainly expressed in normal epithelial cells and is aberrantly overexpressed in a variety of human cancers. Its expression is associated with tumor progression, including breast cancer, lung cancer, ovarian cancer, liver cancer, gastric cancer, and glioma. Elevated DDR1 signatures are associated with more immune - cold tumors and reduced responsiveness to immune checkpoint inhibitor therapy in non - small cell lung cancer.
[0009] 9H-1 is a first-in-class humanized monoclonal antibody that targets human DDR1 and is designed to disrupt the tumor stroma and allow the subject's own immune cells to infiltrate the tumor to destroy it. Robust single-agent activity has been observed in multiple preclinical tumor models. Thus, 9H-1 may provide an effective treatment for cancers, particularly cancers with immune exclusion. In addition, the use of 9H-1 in combination with immune checkpoint inhibitors may result in a further improvement in anti-tumor ability relative to either single therapy.
[0010] Embodiments of the present disclosure relate to methods for reducing immune exclusion of a tumor and / or reducing tumor burden in a subject in need thereof, the methods using an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) and an immune checkpoint inhibitor. Embodiments are also provided for a specific dosing regimen for administering an antibody that specifically binds to human DDR1.
[0011] The present disclosure provides the following numbered embodiments: 1. A method for reducing immune exclusion of a tumor in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
[0012] 2. A method for reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
[0013] 3. The method according to embodiment 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg.
[0014] 4. The method according to embodiment 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg.
[0015] 5. The method according to any one of embodiments 1-4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg, or about 1600 mg.
[0016] 6. The method according to any one of embodiments 1-5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg, or 1600 mg.
[0017] 7. The method according to any one of embodiments 1-6, wherein the anti-DDR1 antibody is administered intravenously.
[0018] 8. The method according to any one of embodiments 1-7, wherein the anti-DDR1 antibody is administered by intravenous infusion within 60 minutes.
[0019] 9. The method according to any one of embodiments 1-7, wherein the anti-DDR1 antibody is administered by intravenous infusion within 30 minutes.
[0020] 10. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered once a week.
[0021] 11. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered once every two weeks.
[0022] 12. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered once every three weeks.
[0023] 13. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered once every four weeks.
[0024] 14. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered once every eight weeks.
[0025] 15. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 8 mg once every three weeks.
[0026] 16. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 24 mg once every three weeks.
[0027] 17. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 80 mg once every three weeks.
[0028] 18. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 240 mg once every three weeks.
[0029] 19. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 400 mg once every three weeks.
[0030] 20. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 800 mg once every 3 weeks.
[0031] 21. The method according to any one of embodiments 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 1600 mg once every 3 weeks.
[0032] 22. The method according to any one of embodiments 1-21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist.
[0033] 23. The method according to any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg.
[0034] 24. The method according to any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg or 1680 mg.
[0035] 25. The method according to any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg.
[0036] 26. The method according to any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0037] 27. The method according to any one of embodiments 1-26, wherein the PD-1 or PD-L1 antagonist is intravenously administered.
[0038] 28. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once a week.
[0039] 29. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 2 weeks.
[0040] 30. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 3 weeks.
[0041] 31. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 4 weeks.
[0042] 32. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 6 weeks.
[0043] 33. The method according to any one of embodiments 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 8 weeks.
[0044] 34. The method according to any one of the foregoing embodiments, wherein the subject has cancer.
[0045] 35. The method according to embodiment 34, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to treat cancer in the subject.
[0046] 36. The method according to embodiment 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1.
[0047] 37. The method according to embodiment 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1.
[0048] 38. The method according to embodiment 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostarlimab, cemiplimab, sintilimab, penpulimab, tislelizumab, toripalimab, or retifanlimab.
[0049] 39. The method according to embodiment 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab, or durvalumab.
[0050] 40. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is pembrolizumab.
[0051] 41. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 400 mg once every 6 weeks.
[0052] 42. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 200 mg once every 3 weeks.
[0053] 43. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks.
[0054] 44. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is nivolumab.
[0055] 45. The method according to embodiment 44, wherein nivolumab is administered at a dose of 240 mg once every 2 weeks.
[0056] 46. The method according to embodiment 44, wherein nivolumab is administered at a dose of 360 mg once every 3 weeks.
[0057] 47. The method according to embodiment 44, wherein nivolumab is administered at a dose of 480 mg once every 4 weeks.
[0058] 48. The method according to embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg once every 2 weeks.
[0059] 49. The method according to embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg once every 3 weeks.
[0060] 50. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is cemiplimab.
[0061] 51. The method according to embodiment 50, wherein cemiplimab is administered at a dose of 350 mg once every 3 weeks.
[0062] 52. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is dostarlimab.
[0063] 53. The method according to embodiment 52, wherein dostarlimab is administered at a dose of 500 mg once every 3 weeks.
[0064] 54. The method according to embodiment 52, wherein dostarlimab is administered at a dose of 1000 mg once every 6 weeks.
[0065] 55. The method according to any one of embodiments 1-35 or 37, wherein the PD-L1 antagonist is atezolizumab.
[0066] 56. The method according to embodiment 55, wherein atezolizumab is administered at a dose of 840 mg once every 2 weeks.
[0067] 57. The method according to embodiment 55, wherein atezolizumab is administered at a dose of 1200 mg once every 3 weeks.
[0068] 58. The method according to embodiment 55, wherein atezolizumab is administered at a dose of 1680 mg once every 4 weeks.
[0069] 59. The method according to any one of embodiments 1 - 35 or 37, wherein the PD-L1 antagonist is durvalumab.
[0070] 60. The method according to embodiment 59, wherein durvalumab is administered at a dose of 10 mg / kg once every 2 weeks.
[0071] 61. The method according to embodiment 59, wherein durvalumab is administered at a dose of 20 mg / kg once every 3 weeks.
[0072] 62. The method according to embodiment 59, wherein durvalumab is administered at a dose of 1500 mg once every 3 weeks.
[0073] 63. The method according to any one of the foregoing embodiments, wherein the cancer expresses DDR1.
[0074] 64. The method according to any one of the foregoing embodiments, wherein the cancer is a solid cancer.
[0075] 65. The method according to any one of the foregoing embodiments, wherein the cancer is locally advanced or metastatic solid cancer.
[0076] 66. The method according to any one of the foregoing embodiments, wherein the cancer is unresectable.
[0077] 67. The method according to any one of the foregoing embodiments, wherein the cancer is refractory to immunotherapy.
[0078] 68. The method according to embodiment 67, wherein the immunotherapy is an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-PD-1 / anti-PD-L1 antibody bispecific antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM-3 antibody, an antagonist anti-LAG-3 antibody, an antagonist anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody or an agonist anti-CD28 antibody.
[0079] 69. The method according to embodiment 67, wherein the immunotherapy is an antagonist anti-PD-L1 antibody.
[0080] 70. The method according to any one of the foregoing embodiments, wherein the cancer is not sarcoma, hepatocellular carcinoma or glioma.
[0081] 71. The method according to any one of the foregoing embodiments, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma or bone cancer.
[0082] 72. The method according to any one of the foregoing embodiments, wherein the cancer is colorectal cancer, ovarian cancer or non-small cell lung cancer.
[0083] 73. The method according to any one of the foregoing embodiments, wherein the subject is not a candidate for standard of care treatment.
[0084] 74. The method according to any one of the foregoing embodiments, wherein the cancer is refractory to standard of care treatment.
[0085] 75. The method according to embodiment 74, wherein the standard of care treatment is chemotherapy or radiation.
[0086] 76. The method according to any one of embodiments 1-75, wherein administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces the tumor size in the subject.
[0087] 77. The method according to any one of the foregoing embodiments, wherein prior to administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) Have confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) Have pathologically documented advanced, unresectable or metastatic cancer that is refractory or intolerant to standard therapy known to confer benefit, or for which no standard therapy is available; c) Have an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1; d) Have a life expectancy of ≥ 3 months; e) Have one or more of the following: i) Calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft - Gault formula; ii) Total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) Hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 109 cells / L; or vi) Absolute neutrophil count ≥ 1.5 × 109 cells / L; f) Have a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) Have not received other cancer therapies.
[0088] 78. The method according to any one of the preceding embodiments, wherein prior to administering the anti - DDR1 antibody and the PD - 1 or PD - L1 antagonist, the subject: a) Has not received prior treatment with a systemic agent within 28 days or within five half - lives of the drug, whichever is shorter, wherein the systemic agent includes a radio - immunoconjugate, an antibody - drug conjugate, an immune / cytokine, or a monoclonal antibody; b) Does not have ongoing toxicity from prior treatment; c) Has not undergone major surgery < 3 months prior to administering the anti - DDR1 antibody; d) Has not received radiotherapy < 28 days prior to administering the anti - DDR1 antibody; e) have not undergone an organ transplant, an allogeneic stem cell transplant, or an autologous stem cell transplant; f) have not received a diagnosis of primary or acquired immunodeficiency; g) have not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the anti-DDR1 antibody; h) do not have active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiotherapy; i) do not have an active autoimmune disease or a history of such disease that requires immunosuppressive therapy; j) do not have clinical symptoms of CNS metastases within 28 days prior to administration of the anti-DDR1 antibody; and / or k) do not have leptomeningeal carcinomatosis.
[0089] 79. The method according to any one of the foregoing embodiments, wherein the anti-DDR1 antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant thereof comprising 1-5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant thereof comprising 1-5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.
[0090] 80. The method according to embodiment 79, wherein: (a) the VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1-5 amino acid changes; and / or (b) the VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 5, or a variant thereof having 1-5 amino acid changes, and SEQ ID NO: 6, or a variant thereof having 1-5 amino acid changes.
[0091] 81. The method according to embodiment 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively.
[0092] 82. The method according to any one of embodiments 79-81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises: VH, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or VL, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.
[0093] 83. The method according to embodiment 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 8.
[0094] 84. The method according to embodiment 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 9.
[0095] 85. The method according to any one of embodiments 79-84, wherein the anti-DDR1 antibody comprises a heavy chain and / or a light chain, the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 12.
[0096] 86. The method according to any one of the foregoing embodiments, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0097] 87. The method according to any one of embodiments 1-85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0098] 88. The method according to any one of embodiments 1-85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0099] 89. The method according to any one of embodiments 1-85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0100] 90. The method according to any one of the foregoing embodiments, wherein the anti-DDR1 is administered to the subject before the PD-1 or PD-L1 antagonist.
[0101] 91. The method according to any one of the foregoing embodiments, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist.
[0102] 92. The method according to any one of the foregoing embodiments, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to the subject simultaneously.
[0103] 93. The method according to any one of the foregoing embodiments, wherein administration of the antibody and the immune checkpoint inhibitor prevents further growth of tumor size in the subject.
[0104] 94. The method according to any one of the foregoing embodiments, wherein administration of the antibody and the immune checkpoint inhibitor achieves at least disease stabilization in the subject.
[0105] 95. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the foregoing embodiments.
[0106] 96. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the preparation of a medicament for the treatment of cancer, wherein the treatment is carried out according to the method of any one of the foregoing embodiments.
[0107] 97. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for the treatment of cancer, wherein the treatment is carried out according to the method of any one of the foregoing embodiments.
[0108] 98. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist.
[0109] 99. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the foregoing embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0110] Figure 1 is a bar graph showing embodiments of 9H-1 binding at different concentrations in a flow cytometry assay.
[0111] Figure 2 is a graph showing embodiments of tumor volume in mice treated with 9H-1, 9H-1-LALAPG, or IgG control.
[0112] Figures 3A to 3D is a graph showing in all dose groups ( Figure 3A ), only in the low dose group ( Figure 3B ), in the medium dose group ( Figure 3C ), and only in the high dose group ( Figure 3D ) embodiments of the concentration of 9H-1 in each cynomolgus monkey.
[0113] Figure 4 is a graph showing embodiments of the simulated 9H-1 concentration at a dosing interval of every two weeks.
[0114] Figure 5 is a graph showing embodiments of the simulated 9H-1 concentration at a dosing interval of every three weeks.
[0115] Figure 6 is a graph showing embodiments of the percentage of the number of CD3+ T cells in the total number of cells at the margin and center of solid tumors in a mouse tumor model. Mice were treated with vehicle (control), a rabbit monoclonal antibody version of 9H-1 (αDDR1), pembrolizumab (αPD-1), or a combination of a rabbit monoclonal antibody version of 9H-1 and pembrolizumab (combination).
[0116] Figures 7A to 7B depicts the percentage of the number of GZMB+(left) and IFN +(right) cells out of the total number of CD8+ T cells ( Figure 7A ), and the change in tumor volume over time in a murine solid tumor model according to some non-limiting embodiments ( Figure 7B ). Mice were treated with vehicle (control), a rabbit monoclonal antibody version of 9H-1 (αDDR1), a murine anti-PD-1 antibody (αPD-1), or a combination of a rabbit monoclonal antibody version of 9H-1 and an anti-PD-1 antibody (combination).
[0117] Figure 8 depicts a schematic model of the proposed mechanism for enhancing the anti-tumor effect of immune checkpoint inhibitors by anti-DDR1 according to some non-limiting embodiments.
[0118] Figures 9A to 9D shows, over time, the individual tumor volume (mm3) ( Figure 9A and Figure 9B ), the average tumor volume (mm3) ( Figure 9C ), and the survival probability ( Figure 9D ) in B16F10 DDR1- / - tumors in C57BL / 6 mice at 23 days post-inoculation.
[0119] Figures 10A to 10C shows, at 26 days post-inoculation, the individual tumor volume (mm3) ( Figure 10A ); the average tumor volume (mm3) ( Figure 10B ); and the body weight (g) ( Figure 10C ) in LLC1 DDR1- / - tumors in C57BL / 6 mice.
[0120] Figures 11A to 11C shows, at 31 days post-inoculation, the individual tumor volume (mm3) ( Figure 11A ); the average tumor volume (mm3) ( Figure 11B ); and the body weight (g) ( Figure 11C ) in E0771 DDR- / - tumors in C57BL / 6 mice.
[0121] Figures 12A to 12C shows, at 31 days post-inoculation, the individual tumor volume (mm3) ( Figure 12A ); the average tumor volume (mm3) ( Figure 12B ); and the body weight (g) ( Figure 12C ) in Renca DDR1- / - tumors in Balb / c mice.
[0122] Figures 13A to 13D shows the individual tumor volume (mm3) ( Figure 13A );the average tumor volume (mm3) ( Figure 13B );body weight (g) ( Figure 13C );and the average body weight (g) ( Figure 13D ) in 4T1 DDR1- / - tumors in Balb / c mice at 38 days post inoculation.
[0123] Figures 14A to 14C shows the individual tumor volume (mm3) ( Figure 14A );the average tumor volume (mm3) ( Figure 14B );and the average body weight (g) ( Figure 14C ) in EMT6 DDR1- / - tumors in Balb / c mice at 31 days post inoculation.
[0124] Figures 15A to 15D shows the individual tumor volume (mm3) ( Figure 15A );the average tumor volume (mm3) ( Figure 15B );the individual tumor volume (mm3) ( Figure 15C );and the average body weight (g) ( Figure 15D ) in CT26 DDR1- / - tumors in Balb / c mice at 38 days post inoculation.
[0125] Figures 16A to 16D shows the individual tumor volume (mm3) ( Figure 16A );the average tumor volume (mm3) ( Figure 16B );the average body weight (g) ( Figure 16C );and the survival probability ( Figure 16D ) in MBT-2 DDR1- / - tumors in C3H / HeN mice at 11 days post inoculation.
[0126] Figure 17 Shows the study design of an embodiment for tumor kinetics studies in BALB / c mice using CT26 (wild type (WT) and knockout (KO)) cell lines.
[0127] Figures 18A to 18B shows the change in tumor volume (mm3) ( Figure 18A ) and the change in body weight percentage ( Figure 18B ) in CT26 DDR1 WT + CT26 DDR1 KO (n =10) at 42 days post inoculation.
[0128] Figures 19A to 19B shows the individual tumor volume (mm3) changes of the CT26 WT cell line ( Figure 19A ) and the CT26 KO cell line ( Figure 19B ) within 42 days after inoculation.
[0129] Figures 20A to 20C Shows the flow cytometry analysis diagrams of the CT26 parental line using the isotype antibody control ( Figure 20A ) and using the anti-DDR1 antibody ( Figure 20B ); and the flow cytometry analysis of the CT26 DDR1r line using the anti-DDR1 antibody after flow sorting ( Figure 20C ). DETAILED DESCRIPTION
[0130] Embodiments of the present disclosure relate to methods for treating cancer using antibodies that specifically bind to discoidin domain receptor tyrosine kinase 1 (DDR1) (including human DDR1 (i.e., "specifically binds to human DDR1")) and immune checkpoint inhibitors. In some embodiments, the immune checkpoint inhibitor is a PD-1 antagonist or a PD-L1 antagonist. In some embodiments, the immune checkpoint inhibitor includes a PVRIG antagonist. In some embodiments, the PVRIG antagonist is an anti-PVRIG antibody that specifically binds to human PVRIG. Embodiments of specific dosage regimens for administering antibodies that specifically bind to human DDR1 are also provided herein, as well as embodiments of dosage regimens for combination therapies including PD-1 antagonists and PD-L1 antagonists. In some embodiments, the dosage regimens provided in the present disclosure provide serum exposure to the anti-DDR1 antibody in a human subject that is higher than necessary to inhibit DDR1 function, thereby enhancing the therapeutic effect of co-administered immune checkpoint inhibitors.
[0131] TERMS
[0132] Unless otherwise defined, all technical and scientific terms used herein, when considered in light of the present disclosure, have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting of any claimed subject matter.
[0133] As used herein, and unless otherwise specified, the terms "antibody" and "antibodies" have their ordinary and customary meanings as understood in accordance with the specification, and include full-length antibodies, antigen-binding fragments of full-length antibodies, and molecules comprising antibody CDRs, VH regions, and / or VL regions. Examples of antibodies include, but are not limited to, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intrabodies, heteroconjugate antibodies, antibody-drug conjugates, single domain antibodies, monovalent antibodies, single-chain antibodies or single-chain Fv (scFv), camelized antibodies, affibodies, Fab fragments, F(ab’)2 fragments, disulfide-linked Fv (sdFv), anti-idiotypic (anti-Id) antibodies (including, for example, anti-anti-Id antibodies), and antigen-binding fragments of any of the foregoing. In certain embodiments, the antibodies described herein refer to a polyclonal antibody population. Antibodies can be of any type of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, or IgA2), or any subclass (e.g., IgG2a or IgG2b). In certain embodiments, the antibodies described herein are IgG antibodies or a class thereof (e.g., human IgG1 or IgG4) or a subclass thereof. In an embodiment, the antibody is a humanized monoclonal antibody. In an embodiment, the antibody is a human monoclonal antibody.
[0134] As used herein and unless otherwise specified, the term “CDR” or “complementary determining region” has its ordinary and customary meaning as understood according to the specification, and refers to the non - contiguous antigen - binding sites present within the variable regions of heavy - and light - chain polypeptides. These specific regions have been described, for example, by Kabat et al., J. Biol. Chem. 252, 6609 - 6616 (1977) and Kabat et al., “Sequences of Proteins of Immunological Interest.” (1991), Chothia et al., J. Mol. Biol. 196:901 - 917 (1987), and MacCallum et al., J. Mol. Biol. 262:732 - 745 (1996), all of which are incorporated herein by reference in their entirety, where the definitions include overlapping or subsets of amino acid residues when compared to each other (see Table 1 below). In certain embodiments, the term “CDR” is the CDR as defined by MacCallum et al., J. Mol. Biol. 262:732 - 745 (1996) and Martin A. “Protein Sequence and Structure Analysis of Antibody Variable Domains,” in Antibody Engineering, Kontermann and Dübel, eds., Chapter 31, pp. 422 - 439, Springer - Verlag, Berlin (2001). In certain embodiments, the term “CDR” is the CDR as defined by Kabat et al., J. Biol. Chem. 252, 6609 - 6616 (1977) and Kabat et al., “Sequences of Proteins of Immunological Interest.” (1991). In certain embodiments, different conventions are used to define the heavy - chain CDRs and light - chain CDRs of an antibody. In certain embodiments, the heavy - chain CDRs and / or light - chain CDRs are defined by performing a structural analysis of the antibody and identifying the residues in the variable regions that are predicted to contact the epitope region of a target molecule (e.g., human DDR1). CDRH1, CDRH2, and CDRH3 denote the heavy - chain CDRs, and CDRL1, CDRL2, and CDRL3 denote the light - chain CDRs.
[0135] Table 1. CDR Definitions.
[0136]
[0137] As used herein, and unless otherwise specified, the terms "variable region" and "variable domain" have their ordinary and customary meanings as understood according to the specification, and are used interchangeably, and are common in the art. The variable region generally refers to a portion of an antibody, typically a portion of the light or heavy chain, typically about 110 to 120 amino acids at the amino terminus, or 110 to 125 amino acids in the mature heavy chain, and about 90 to 115 amino acids in the mature light chain, which varies greatly in the antibody sequence and is responsible for the binding and specificity of a particular antibody to its particular antigen. The variability of the sequence is concentrated in regions called complementarity determining regions (CDRs), while the more highly conserved regions in the variable region are called framework regions (FRs). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with the antigen. In certain embodiments, the variable region is a human variable region. In certain embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In an embodiment, the variable region is a primate (e.g., non-human primate) variable region. In an embodiment, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs).
[0138] As used herein, and unless otherwise specified, the terms "VH" and "VL" have their ordinary and customary meanings as understood according to the specification, and refer respectively to the variable regions of the antibody heavy and light chains, as described in Kabat et al., (1991) "Sequences of Proteins of Immunological Interest", which is incorporated herein by reference in its entirety.
[0139] As used herein, and unless otherwise specified, the term "constant region" has its ordinary and customary meaning as understood according to the specification, and is common in the art. The constant region is the portion of the antibody, e.g., the carboxyl-terminal portion of the light and / or heavy chain, which does not directly participate in the binding of the antibody to the antigen, but which can exhibit various effector functions, such as interaction with Fc receptors (e.g., Fcγ receptors).
[0140] As used herein and unless otherwise specified, the term "heavy chain" has its ordinary and customary meaning as understood in accordance with the specification, and when used in reference to an antibody, can refer to any of the different types based on the amino acid sequence of the constant region, e.g., alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (μ), which give rise to IgA, IgD, IgE, IgG, and IgM classes of antibodies, including subclasses of IgG, e.g., IgG1, IgG2, IgG3, and IgG4.
[0141] As used herein and unless otherwise specified, the term "light chain" has its ordinary and customary meaning as understood in accordance with the specification, and when used in reference to an antibody, can refer to any of the different types based on the amino acid sequence of the constant region, e.g., kappa (κ) or lambda (λ). Light chain amino acid sequences are well known in the art. In an embodiment, the light chain is a human light chain.
[0142] As used herein and unless otherwise specified, the terms "specifically bind", "specifically recognize", "immunologically specifically bind", and "immunologically specifically recognize" have their ordinary and customary meanings as understood in accordance with the specification, and are similar terms in the context of an antibody, and refer to a molecule that binds to an antigen (e.g., an epitope or immune complex), such binding being as understood by one of ordinary skill in the art. For example, a molecule that specifically binds an antigen may bind other peptides or polypeptides, generally with lower affinity, the affinity being determined by, e.g., immunoassay, BIAcore®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In an embodiment, the KA of a molecule that specifically binds an antigen to the antigen is at least 2 log (e.g., a multiple of 10), 2.5 log, 3 log, 4 log, or more higher than the KA of the molecule when non-specifically binding to another antigen. Unless otherwise expressly stated, an antibody or fragment thereof that is referred to as "specifically binding" an antigen (where the antigen is identified as being from a particular species (e.g., human)) can bind the same antigen from another species with the same or similar affinity. For example, an antibody or fragment thereof that "specifically binds to human DDR1" can bind mouse DDR1 with a similar affinity.
[0143] As used herein and unless otherwise specified, the term "EU numbering system" has its ordinary and customary meaning as understood in accordance with the specification and refers to the EU numbering convention for antibody constant regions as described in Edelman G.M. et al., Proc. Natl. Acad. USA, 63, 78-85 (1969) and Kabat et al., "Sequences of Proteins of Immunological Interest", 1991, each of which is incorporated herein by reference in its entirety.
[0144] As used herein, the term "subject" includes any human or non-human animal. In embodiments, the subject is a human. In some embodiments, "subject" and "patient" may be used interchangeably.
[0145] As used herein and unless otherwise specified, the term "cancer" has its ordinary and customary meaning as understood in accordance with the specification and refers to any disorder characterized by uncontrolled division of abnormal cells in the body. For example, mutations may occur in cells such that they are unable to regulate cell division and result in the formation of one or more tumors. Cancer can be benign, pre-cancerous, or malignant. Cancer occurs in a variety of cells and tissues, including but not limited to, the oral cavity (e.g., mouth, tongue, pharynx, etc.), digestive system (e.g., esophagus, stomach, small intestine, colon, rectum, liver, bile duct, gallbladder, pancreas, etc.), respiratory system (e.g., larynx, lung, bronchus, etc.), bone, joint, skin (e.g., basal cell, squamous cell, meningioma, etc.), breast, reproductive system (e.g., uterus, ovary, prostate, testis, etc.), urinary system (e.g., bladder, kidney, ureter, etc.), eye, nervous system (e.g., brain, etc.), endocrine system (e.g., thyroid, etc.), soft tissue (e.g., muscle, fat, etc.), and hematopoietic system (e.g., lymphoma, myeloma, leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, etc.).
[0146] As used herein and unless otherwise specified, the term "solid cancer" has its ordinary and customary meaning as understood in accordance with the specification and refers to a cancer that results in a malignant solid tumor. Solid tumors include sarcomas and carcinomas. Blood cancers generally do not form solid tumors.
[0147] As used herein and unless otherwise specified, the term "unresectable" has its ordinary and customary meaning as understood in accordance with the specification and refers to a tumor that cannot be treated by surgical removal.
[0148] As used herein and unless otherwise specified, the term "locally advanced" has its ordinary and customary meaning as understood in accordance with the specification and refers to cancer with high vascular involvement and / or that has grown outside the body part or organ where it originated but has not metastasized.
[0149] As used herein and unless otherwise specified, the term "refractory" has its ordinary and customary meaning as understood in accordance with the specification and refers to cancer that does not respond to treatment.
[0150] As used herein and unless otherwise specified, the terms "treat", "treating", and "treatment" have their ordinary and customary meanings as understood in accordance with the specification and refer to the treatment or preventive measures described herein. The method of "treatment" involves administering an antibody to a subject having cancer to prevent, cure, delay, reduce the severity of, or improve one or more symptoms of the cancer or recurrent cancer, or to extend the survival time of the subject beyond what would be expected in the absence of such treatment. In some embodiments, "treatment" includes achieving a complete response, partial response, or disease stabilization. In some embodiments, "treatment" includes at least achieving disease stabilization.
[0151] As used herein and unless otherwise specified, the term "effective amount" has its ordinary and customary meaning as understood in accordance with the specification and, in the context of administering a treatment to a subject, refers to the amount of the treatment that achieves the desired preventive or therapeutic effect.
[0152] As used herein, the term "about", when referring to a measurable value (e.g., a dose), includes a variation of ±5% of the given value or range.
[0153] As used herein with respect to an antibody and unless otherwise specified, the term "isolated" has its ordinary and customary meaning as understood in accordance with the specification and refers to an antibody that is separated from one or more contaminants (e.g., polypeptides, polynucleotides, lipids, host cells, or carbohydrates, etc.) that are present in the natural source of the antibody. All instances of "antibody" described herein are additionally considered to be isolated antibodies, but need not be isolated antibodies.
[0154] The determination of the "percent identity" between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be accomplished using a mathematical algorithm. Non-limiting examples of mathematical algorithms for comparing two sequences are the algorithms of Karlin S & Altschul SF (1990) PNAS 87: 2264-2268 as modified in Karlin S & Altschul SF (1993) PNAS 90: 5873-5877, each of which is incorporated herein by reference in its entirety. This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul SF et al., (1990) J Mol Biol 215: 403, which are incorporated herein by reference in their entirety. The NBLAST nucleotide program parameters can be used, e.g., score = 100, wordlength = 12, for BLAST nucleotide searches to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. The XBLAST program parameters can be used, e.g., score 50, wordlength = 3, for BLAST protein searches to obtain amino acid sequences homologous to the protein molecules described herein. To obtain a gapped alignment for comparison purposes, gapped BLAST can be used as described in Altschul SF et al., (1997) Nuc Acids Res 25: 3389-3402, which is incorporated herein by reference in its entirety. Optionally, an iterative search can be performed with PSI-BLAST, which detects distant relationships between molecules (ibid.). When using the BLAST, gapped BLAST, and PSI-BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see, e.g., the National Center for Biotechnology Information (NCBI) on the World Wide Web, ncbi.nlm.nih.gov). Another non-limiting example of a mathematical algorithm for sequence comparison is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17, which is incorporated herein by reference in its entirety. This algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
[0155] The percent identity between two sequences can be determined using techniques similar to those described above, whether or not gaps are allowed. When calculating the percent identity, generally only exact matches are counted. In some embodiments, the percent identity is calculated using only exact matches without introducing gaps.
[0156] As used herein and unless otherwise specified, the term "amino acid change" has its ordinary and customary meaning as understood in accordance with the specification, and refers to a substitution or insertion of an amino acid at a position in an amino acid sequence.
[0157] Anti-DDR1 antibody
[0158] In one aspect, any antibody that specifically binds to DDR1 (i.e., an anti-DDR1 antibody) is useful in the methods and uses provided herein.
[0159] In embodiments, the amino acid sequences of the CDRs, VH / VL, and the heavy and light chain sequences of exemplary antibodies that specifically bind to DDR1 are shown in Tables 2, 3, and 4, respectively.
[0160]
[0161] In embodiments, the antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant thereof comprising 1-5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant thereof comprising 1-5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.
[0162] In embodiments, (a) VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are the following sequences, respectively: SEQ ID NO: 1, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1-3 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1-5 amino acid changes; and / or (b) VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are the following sequences, respectively: SEQ ID NO: 4, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 5, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 6, or a variant thereof comprising 1-5 amino acid changes.
[0163] In an embodiment, (a) the VH comprises CDRH1, CDRH2, and CDRH3 amino acid sequences that are, respectively, the following sequences: SEQ ID NO: 1, or a variant thereof that contains 1 or 2 amino acid changes, SEQ ID NO: 2, or a variant thereof that contains 1 or 2 amino acid changes, and SEQ ID NO: 3, or a variant thereof that contains 1 or 2 amino acid changes; and / or (b) the VL comprises CDRL1, CDRL2, and CDRL3 amino acid sequences that are, respectively, the following sequences: SEQ ID NO: 4, or a variant thereof that contains 1 or 2 amino acid changes, SEQ ID NO: 5, or a variant thereof that contains 1 or 2 amino acid changes, and SEQ ID NO: 6, or a variant thereof that contains 1 or 2 amino acid changes.
[0164] In an embodiment, (a) the VH comprises CDRH1, CDRH2, and CDRH3 amino acid sequences that are, respectively, the following sequences: SEQ ID NO: 1, or a variant thereof that contains 1 amino acid change, SEQ ID NO: 2, or a variant thereof that contains 1 amino acid change, and SEQ ID NO: 3, or a variant thereof that contains 1 amino acid change; and / or (b) the VL comprises CDRL1, CDRL2, and CDRL3 amino acid sequences that are, respectively, the following sequences: SEQ ID NO: 4, or a variant thereof that contains 1 amino acid change, SEQ ID NO: 5, or a variant thereof that contains 1 amino acid change, and SEQ ID NO: 6, or a variant thereof that contains 1 amino acid change.
[0165] In an embodiment, the antibody comprises CDRH1, CDRH2, CDRH_{3}, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively.
[0166] In an embodiment, the antibody comprises: a VH that comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or a VL that comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.
[0167] In an embodiment, the antibody comprises a VH and a VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 8. In an embodiment, the amino acid sequence of the VH consists of the amino acid sequence shown in SEQ ID NO: 7, and the amino acid sequence of the VL consists of the amino acid sequence shown in SEQ ID NO: 8.
[0168] In an embodiment, the antibody comprises a VH and a VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 9. In an embodiment, the amino acid sequence of the VH consists of the amino acid sequence shown in SEQ ID NO: 7, and the amino acid sequence of the VL consists of the amino acid sequence shown in SEQ ID NO: 9.
[0169] In an embodiment, the antibody comprises a heavy chain and / or a light chain, wherein the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 12.
[0170] In an embodiment, the antibody comprises a heavy chain and a light chain, wherein the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the antibody comprises a heavy chain and a light chain, wherein the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12. In an embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 10, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 10 without a terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12.
[0171] In an embodiment, the antibody comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprising the amino acid sequence shown in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without the terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12. In an embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence shown in SEQ ID NO: 11, and the amino acid sequence of the light chain consists of the amino acid sequence shown in SEQ ID NO: 12, which is referred to herein as the antibody "9H-1". In some embodiments, the heavy chain of 9H-1 does not contain the terminal lysine of SEQ ID NO: 11.
[0172] In some embodiments, the antibody is 9H-1 (PRTH-101) provided by Incendia Therapeutics, Inc. (Boston, MA).
[0173] Also provided herein are compositions (e.g., pharmaceutical compositions) comprising at least one anti-DDR1 antibody of the present disclosure. The composition may comprise an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1); and a pharmaceutically acceptable carrier. Any suitable pharmaceutically acceptable carrier can be used. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for drug delivery of the antibodies disclosed herein. Generally, the nature of the carrier will depend on the particular mode of administration employed. For example, parenteral formulations may contain injectable fluids, which include pharmaceutically and physiologically acceptable fluids such as water, saline, balanced salt solutions, dextrose aqueous solutions, glycerol, etc. as vehicles. In addition to the biocompatible carrier, the pharmaceutical composition to be administered may contain small amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, etc., for example, sodium acetate or sorbitan monolaurate.
[0174] The compositions of the present disclosure can take the form of solutions, suspensions, emulsions, etc. Examples of suitable medicaments are described in "Remington's Pharmaceutical Sciences". Such compositions can contain a prophylactically or therapeutically effective amount of an antibody or a fragment thereof (preferably in purified form), as well as a suitable amount of a carrier to provide a form suitable for administration to a patient. The formulation can be suitable for the mode of administration, which can be oral, intravenous, intra-arterial, intra-oral, intranasal, nebulized, bronchial inhalation or delivery via mechanical ventilation.
[0175] The antibodies of the present disclosure as described herein can be formulated for parenteral administration, e.g., formulated for injection via intradermal, intravenous, intramuscular, subcutaneous, intratumoral or even intraperitoneal routes. The antibody can alternatively be administered directly to the mucosa by a topical route, e.g., by nasal drops, inhalation or by nebulizer.
[0176] Generally, the components of the compositions of the present disclosure can be provided separately or mixed together in unit dosage forms, e.g., provided as a dry lyophilized powder or an anhydrous concentrate in a sealed container such as an ampoule or sachet that labels the amount of the active agent. When the composition is to be administered by infusion, it can be dispensed in an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the components can be mixed before administration.
[0177] Methods and dosage regimens
[0178] The present disclosure relates to methods for reducing the immune rejection of tumors and methods for reducing tumor burden in a subject in need thereof with an antibody that specifically binds to human DDR1 (i.e., an anti-DDR1 antibody). Specific dosage regimens for administering the anti-DDR1 antibody are also provided herein, which result in tumor size reduction and increased response to immunotherapy in subjects with solid cancers (e.g., colorectal cancer, ovarian cancer or non-small cell lung cancer).
[0179] In one aspect, provided herein is a method for reducing the immune rejection of tumors in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.
[0180] In one aspect, provided herein is a method for reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) in an amount of 5 mg to 2000 mg.
[0181] In an embodiment, the subject has cancer. In an embodiment, the antibody treats cancer in the subject.
[0182] In an embodiment, the antibody is administered at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0183] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.
[0184] In an embodiment, the antibody is administered intravenously or subcutaneously.
[0185] In an embodiment, the antibody is administered once a week. In some embodiments, the frequency of administering the antibody does not exceed once a week. In an embodiment, the antibody is administered once every 2 weeks. In some embodiments, the frequency of administering the antibody is not more than once every 2 weeks. In an embodiment, the antibody is administered once every 3 weeks. In some embodiments, the frequency of administering the antibody is not more than once every 3 weeks. In an embodiment, the antibody is administered once every 4 weeks. In some embodiments, the frequency of administering the antibody is not more than once every 4 weeks. In an embodiment, the antibody is administered once every 5 weeks. In some embodiments, the frequency of administering the antibody does not exceed once every 5 weeks. In an embodiment, the antibody is administered once every 6 weeks. In some embodiments, the frequency of administering the antibody is not more than once every 6 weeks. In an embodiment, the antibody is administered once every 7 weeks. In an embodiment, the antibody is administered once every 8 weeks. In some embodiments, the frequency of administering the antibody is not more than once every 8 weeks.
[0186] In an embodiment, the antibody is administered once a week at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In an embodiment, the antibody is administered once a week at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0187] In an embodiment, the antibody is administered once a week at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered once a week at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.
[0188] In an embodiment, the antibody is administered once every two weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every two weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every two weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every two weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg, once every two weeks. In an embodiment, the antibody is administered once every two weeks at a dose of 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0189] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every two weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every two weeks.
[0190] In an embodiment, the antibody is administered once every three weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every three weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every three weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every three weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every three weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0191] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every three weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every three weeks.
[0192] In an embodiment, the antibody is administered once every 4 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0193] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 4 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 4 weeks.
[0194] In an embodiment, the antibody is administered once every 5 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0195] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 5 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 5 weeks.
[0196] In an embodiment, the antibody is administered once every 6 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 6 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0197] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 6 weeks.
[0198] In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0199] In an embodiment, the antibody is administered once every 7 weeks at a dose of 5 mg to 2000 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg to 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg to 800 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg.
[0200] In an embodiment, the antibody is administered once every 8 weeks at a dose of about 5 mg to about 2000 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg to about 1600 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg to about 800 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg or about 1600 mg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg or about 1600 mg.
[0201] In an embodiment, the antibody is administered at a dose of 5 mg to 2000 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 1600 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg to 800 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg or 1600 mg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg or 1600 mg once every 8 weeks.
[0202] In an embodiment, the antibody is administered intravenously at a dose of 8 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 24 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 25 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 75 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 80 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 240 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 250 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 400 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 800 mg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 1600 mg once every 3 weeks.
[0203] In embodiments, the antibody is administered intravenously. In embodiments, the antibody is administered via intravenous infusion within 60 minutes. In embodiments, the antibody is administered via intravenous infusion within 30 minutes. In some embodiments, the antibody is administered intratumorally.
[0204] In embodiments, the dose is a therapeutically effective amount.
[0205] In some embodiments, the antibody is administered using a flat dose (e.g., the amount of antibody administered is not based on the weight of the subject).
[0206] In one aspect, provided herein is a method of reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at 0.1 mg / kg to 100 mg / kg.
[0207] In one aspect, provided herein is a method of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) at 0.1 mg / kg to 100 mg / kg.
[0208] In embodiments, the subject has cancer. In embodiments, the antibody treats the cancer in the subject.
[0209] In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0210] In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered at a dose of from 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0211] In an embodiment, the antibody is administered intravenously or subcutaneously. In some embodiments, the antibody is administered intratumorally.
[0212] In an embodiment, the antibody is administered once a week. In some embodiments, the frequency of administration of the antibody does not exceed once a week. In an embodiment, the antibody is administered once every 2 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 2 weeks. In an embodiment, the antibody is administered once every 3 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 3 weeks. In an embodiment, the antibody is administered once every 4 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 4 weeks. In an embodiment, the antibody is administered once every 5 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 5 weeks. In an embodiment, the antibody is administered once every 6 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 6 weeks. In an embodiment, the antibody is administered once every 7 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 7 weeks. In an embodiment, the antibody is administered once every 8 weeks. In some embodiments, the frequency of administration of the antibody does not exceed once every 8 weeks.
[0213] In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0214] In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once a week at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0215] In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0216] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every two weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every two weeks.
[0217] In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0218] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every three weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every three weeks.
[0219] In an embodiment, the antibody is administered once every 4 weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0220] In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once every 4 weeks at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0221] In an embodiment, the antibody is administered once every 5 weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0222] In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once every 5 weeks at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0223] In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg once every 6 weeks.
[0224] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 6 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 6 weeks.
[0225] In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0226] In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 50 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 25 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg to 20 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg. In an embodiment, the antibody is administered once every 7 weeks at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0227] In an embodiment, the antibody is administered once every 8 weeks at a dose of from about 0.1 mg / kg to about 100 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of from about 0.1 mg / kg to about 50 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of from about 0.1 mg / kg to about 25 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of from about 0.1 mg / kg to about 20 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg or about 100 mg / kg. In an embodiment, the antibody is administered once every 8 weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg or about 20 mg / kg.
[0228] In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg or 100 mg / kg once every 8 weeks. In an embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg once every 8 weeks.
[0229] In an embodiment, the antibody is administered intravenously at a dose of 0.1 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 0.3 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 1 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 3 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 10 mg / kg once every 3 weeks. In an embodiment, the antibody is administered intravenously at a dose of 20 mg / kg once every 3 weeks.
[0230] In an embodiment, prior to administration of the antibody, the subject: a) has measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1, with confirmed metastatic or advanced, unresectable cancer; b) has pathologically documented advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard therapies known to confer benefit, or for which no standard therapy is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) calculated creatinine clearance (CrCL) ≥ 50 mL / min, calculated by the Cockcroft - Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) platelets ≥ 100 × 109 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 109 cells / L; f) has a corrected QT interval (QTc) ≤ 470 ms (calculated by the Fridericia correction formula); and / or g) has not received other cancer therapies.
[0231] In an embodiment, prior to administration of the antibody, the subject: a) has not received prior treatment with systemic agents within 28 days or within five half - lives of the drug, whichever is shorter, where the systemic agents include radio - immunoconjugates, antibody - drug conjugates, immunocytokines, or monoclonal antibodies; b) does not have ongoing toxicity from prior treatment; c) has not undergone major surgery within < 3 months prior to administration of the antibody; d) has not received radiotherapy within < 28 days prior to administration of the antibody; e) has not undergone organ transplantation, allogeneic stem cell transplantation, or autologous stem cell transplantation; f) has not received a diagnosis of primary or acquired immunodeficiency; g) has not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the antibody; h) does not have active central nervous system (CNS) tumor involvement that is not definitively treatable by surgery or radiotherapy; i) does not have an active autoimmune disease or a history of such disease that requires immunosuppressive therapy; j) does not have clinical symptoms of CNS metastases within 28 days prior to administration of the antibody; and / or k) does not have leptomeningeal carcinomatosis.
[0232] In an embodiment of the methods described herein, the cancer is associated with elevated DDR1 phosphorylation. Exemplary cancer tissues that may be associated with elevated DDR1 phosphorylation include, but are not limited to, cancers or cancer cells of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, intestine, gingiva, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, pancreas, testis, tongue, cervix, or uterus.
[0233] Exemplary histological types of cancer that may be associated with elevated DDR1 phosphorylation include, but are not limited to, malignant neoplasms; carcinoma; undifferentiated carcinoma; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; epitheliolymphoid carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; familial polyposis adenocarcinoma; solid carcinoma; malignant carcinoid tumor; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe cell carcinoma; oxyphilic cell carcinoma; eosinophilic adenocarcinoma; basophilic cell carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulated sclerosing carcinoma; adrenocortical carcinoma; endometrial carcinoma; skin appendage carcinoma; sweat gland adenocarcinoma; sebaceous gland carcinoma; ceruminous gland adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma (bookmark ring cell carcinoma); invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget’s disease of the breast; acinar cell carcinoma; adenosquamous cell carcinoma; adenocarcinoma with squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; malignant testicular tumor; Sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipoma; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; fibrous histiocytoma; mixed tumor; Mullerian mixed tumor; Wilms tumor; hepatoblastoma; malignant mesenchymoma; malignant Brenner tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; struma ovarii carcinoma; choriocarcinoma; malignant mesonephroma; hemangioendothelioma, hemangiopericytoma; chondroblastoma; giant cell tumor of bone; malignant odontogenic tumor; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal tumor; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant granular cell tumor; malignant lymphoma; Hodgkin disease; paragranuloma; small lymphocyte lymphoma; diffuse large cell malignant lymphoma;Follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocytic leukemia; and hairy cell leukemia.;
[0234] In embodiments, the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma or bone cancer. In embodiments, the cancer is colorectal cancer, ovarian cancer or non-small cell lung cancer. In embodiments, the colorectal cancer is microsatellite stable (MSS). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer does not include breast cancer.
[0235] In embodiments, the cancer is not sarcoma, hepatocellular carcinoma or glioma.
[0236] In embodiments, the cancer expresses DDR1. In embodiments, the cancer is a solid cancer. In embodiments, the cancer is locally advanced or metastatic solid cancer. In embodiments, the cancer is unresectable.
[0237] In embodiments, the cancer is refractory to immunotherapy. In embodiments, the cancer is refractory to antagonist anti-PD-1 antibody, antagonist anti-PD-L1 antibody, antagonist anti-PD-L2 antibody, antagonist anti-CTLA-4 antibody, antagonist anti-BTLA antibody, antagonist anti-TREMR antibody, antagonist anti-TIGIT antibody, antagonist anti-VISTA antibody, antagonist anti-TIM-3 antibody, antagonist anti-LAG-3 antibody, antagonist anti-CEACAM1 antibody, agonist anti-GITR antibody, agonist anti-OX40 antibody and agonist anti-CD137 antibody, agonist anti-DR3 antibody, agonist anti-TNFSF14 antibody, agonist anti-CD27 antibody, agonist anti-ICOS antibody or agonist anti-CD28 antibody.
[0238] In embodiments, the subject is not a candidate for standard of care treatment. In embodiments, the subject is intolerant to standard of care treatment.
[0239] In an embodiment, the cancer is refractory to standard of care treatment. In an embodiment, the standard of care treatment is chemotherapy and / or radiation. In an embodiment, the standard of care treatment is a chemotherapeutic agent selected from the following: abiraterone acetate, afatinib, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminoglutethimide, anagrelide, anastrozole, arsenic trioxide, asparaginase, azacitidine, azathioprine, bendamustine, bevacizumab, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carmustine, cetuximab, chlorambucil, cisplatin, cladribine, crizotinib, cyclophosphamide, cytarabine, dacarbazine, actinomycin D, dasatinib, daunorubicin, denileukindiftitox, decitabine, docetaxel, dexamethasone, doxifluridine, doxorubicin, epirubicin, epoetin alpha, epothilone, erlotinib, estramustine, entinostat, etoposide, everolimus, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil, fluoxymesterone, flutamide, folate-linked alkaloid, gefitinib, gemcitabine, gemtuzumab ozogamicinozogamicin, GM-CT-01, goserelin, hexamethylmelamine, hydroxyureas, ibritumomab, idarubicin, ifosfamide, imatinib, interferon α, interferon β, irinotecan, ixabepilone, lapatinib, leucovorin, leuprolide, lenalidomide, letrozole, lomustine, mechlorethamine, medroxyprogesterone acetate, melphalan, mercaptopurine, methotrexate, mitomycin, mitoxantrone, nelarabine, nilotinib, nilutamide, octreotide, ofatumumab, oprelvekin, oxaliplatin, paclitaxel, panitumumab, pemetrexed, pentostatin, polysaccharide galactose lectin inhibitor, procarbazine, raloxifene, retinoic acid, rituximab, romiplostim, sargramostim, sorafenib, streptozocin, sunitinib, tamoxifen, temsirolimus, temozolomide, teniposide, thalidomide, thioguanine, thiotepa, tioguanine, topotecan, toremifene, tositumomab, trametinib, trastuzumab, tretinoin, valrubicin, VEGF inhibitor and trap, vinblastine, vincristine, vindesine, vinorelbine, vintafolide(EC145) and vorinostat.
[0240] In one aspect, the present disclosure provides an antibody that specifically binds to human DDR1 for treating cancer, wherein the treatment is carried out according to the methods disclosed herein.
[0241] In one aspect, the present disclosure provides an antibody that specifically binds to human DDR1 for preparing a medicament for treating cancer, wherein the treatment is carried out according to the methods disclosed herein.
[0242] Combined therapy
[0243] In one aspect, the present disclosure provides a method for reducing the immune rejection of a tumor in a subject in need thereof, the method comprising administering an immune checkpoint inhibitor and an antibody that specifically binds to human DDR1 to the subject.
[0244] In one aspect, the present disclosure provides a method for reducing the tumor burden in a subject in need thereof, the method comprising administering an immune checkpoint inhibitor and an antibody that specifically binds to human DDR1 to the subject.
[0245] In some embodiments, the immune checkpoint inhibitor comprises a PD-1 antagonist. In some embodiments, the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1. In some embodiments, the anti-PD-1 antibody comprises pembrolizumab, nivolumab, cemiplimab, sintilimab, penpulimab, tislelizumab, toripalimab or rivulizumab. In some embodiments, the immune checkpoint inhibitor comprises a PD-L1 antagonist. In some embodiments, the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1. In some embodiments, the immune checkpoint inhibitor comprises a PVRIG antagonist. In some embodiments, the PVRIG antagonist is an anti-PVRIG antibody that specifically binds to human PVRIG.
[0246] In some embodiments, the methods provided herein include administering a PD-1 or PD-L1 antagonist to a subject at a dose of about 100 mg, about 200 mg, about 240 mg, about 350 mg, about 360 mg, about 400 mg, about 480 mg, about 500 mg, about 840 mg, about 1000 mg, about 1200 mg, about 1500 mg, about 1680 mg, about 1700 mg, about 1800 mg, about 1900 mg, or about 2000 mg. In some embodiments, the methods provided herein include administering a PD-1 or PD-L1 antagonist to a subject at a dose of about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, or about 30 mg / kg.
[0247] In some embodiments, the immune checkpoint inhibitor is administered intravenously. In some embodiments, a PD-1 or PD-L1 antagonist is administered intravenously. In some embodiments, the immune checkpoint inhibitor is administered intratumorally. In some embodiments, a PD-1 or PD-L1 antagonist is administered intratumorally. In some embodiments, a PD-1 or PD-L1 antagonist is administered once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 6 weeks, or once every 8 weeks. In some embodiments, the frequency of administering a PD-1 or PD-L1 antagonist does not exceed once a week, does not exceed once every 2 weeks, does not exceed once every 3 weeks, does not exceed once every 4 weeks, does not exceed once every 6 weeks, or does not exceed once every 8 weeks. In some embodiments, the frequency of administering an immune checkpoint inhibitor does not exceed once a week, does not exceed once every 2 weeks, does not exceed once every 3 weeks, does not exceed once every 4 weeks, does not exceed once every 6 weeks, or does not exceed once every 8 weeks.
[0248] In some embodiments, the PD-1 antagonist is pembrolizumab. In some embodiments, pembrolizumab is administered at a dose of 400 mg once every 6 weeks, or at a dose of 200 mg once every 3 weeks. In some embodiments, pembrolizumab is administered at a dose of 400 mg once every 3 weeks. In some embodiments, pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks.
[0249] In some embodiments, the PD-1 antagonist is nivolumab. In some embodiments, nivolumab is administered at a dose of 240 mg once every 2 weeks, at a dose of 360 mg once every 3 weeks, or at a dose of 480 mg once every 4 weeks. In some embodiments, nivolumab is administered at a dose of 3 mg / kg once every 2 weeks, or at a dose of 3 mg / kg once every 3 weeks.
[0250] In some embodiments, the PD-1 antagonist is cemiplimab. In some embodiments, cemiplimab is administered at a dose of 350 mg once every three weeks.
[0251] In some embodiments, the PD-1 antagonist is dostarlimab. In some embodiments, dostarlimab is administered at a dose of 500 mg once every three weeks, or at a dose of 1000 mg once every six weeks.
[0252] In some embodiments, the PD-L1 antagonist is atezolizumab. In some embodiments, atezolizumab is administered at a dose of 840 mg once every two weeks, 1200 mg once every three weeks, or 1680 mg once every four weeks.
[0253] In some embodiments, the PD-L1 antagonist is durvalumab. In some embodiments, durvalumab is administered at a dose of 1500 mg once every three weeks. In some embodiments, durvalumab is administered at a dose of 10 mg / kg once every two weeks, or at a dose of 20 mg / kg once every three weeks.
[0254] An antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor can be administered in any suitable manner. In some embodiments, the antibody and the immune checkpoint inhibitor are administered to the subject contemporaneously or simultaneously or within the same period of time (e.g., during the same visit to a clinical site). In some embodiments, the antibody and the immune checkpoint inhibitor are administered to the subject at different time periods. The antibody that specifically binds to human DDR1 and the immune checkpoint inhibitor can be administered in any suitable order. In some embodiments, the antibody is administered first, followed by the immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is administered first, followed by the antibody that specifically binds to human DDR1. In some embodiments, the antibody and the immune checkpoint inhibitor are administered at the same dosing frequency. In some embodiments, the antibody and the immune checkpoint inhibitor are administered at different dosing frequencies. In some embodiments, the antibody is administered more frequently (e.g., with an increased frequency, an increased frequency of about, or an increased frequency of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or an increased frequency of a percentage within the range defined by any two of the foregoing values (e.g., 10 - 200%, 20 - 150%, 30 - 100%, 50 - 100%, etc.)) than the immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is administered more frequently (e.g., with an increased frequency, an increased frequency of about, or an increased frequency of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or an increased frequency of a percentage within the range defined by any two of the foregoing values (e.g., 10 - 200%, 20 - 150%, 30 - 100%, 50 - 100%, etc.)) than the antibody.
[0255] In some embodiments, administering to a subject an antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor results in at least disease stabilization (e.g., disease stabilization of cancer). In some embodiments, administering to a subject an antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor prevents further development of cancer in the subject. In some embodiments, administering to a subject an antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor prevents further growth of tumor size in the subject. In some embodiments, after administering the antibody, the tumor size does not increase by more than or is not greater than about 30%, 25%, 20%, 15%, 10%, 5%, 3%, 1% or is not greater than a percentage within the range defined by any two of the foregoing values (e.g., 1-30%, 3-25%, 5-20%, 1-20%, 1-10%, 1-5%, etc.), or when the size does not increase, further growth of the tumor size is prevented. In some embodiments, administering to a subject an antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor results in a complete response (e.g., elimination of the tumor). In some embodiments, administering to a subject an antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor results in at least a partial response (e.g., tumor shrinkage by about 50% or more).
[0256] Kit
[0257] The present disclosure also provides a kit for treating cancer in a subject, wherein the kit comprises at least one anti-DDR1 antibody of the present disclosure. In some embodiments, the kit further comprises an immune checkpoint inhibitor (e.g., a PD-1 or PD-L1 antagonist). In some embodiments, the kit comprises one or more containers for containing the anti-DDR1 antibody and / or the immune checkpoint inhibitor. Any suitable container can be used. Suitable containers include, but are not limited to, vials, test tubes, flasks, bottles, syringes or other container tools in which the antibody can be placed or, preferably, appropriately aliquoted. In some embodiments, the kit comprises a pre-filled syringe containing the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured to deliver a unit dose (e.g., a therapeutically effective amount) of the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured for single-use delivery of a unit dose of the anti-DDR1 antibody. In some embodiments, the kit comprises instructions for use.
[0258] Additional embodiments
[0259] Additional non-limiting embodiments of the present disclosure are provided according to the numbered schemes below.
[0260] 1. A method for reducing the immune rejection of tumors in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
[0261] 2. A method for reducing the tumor burden in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
[0262] 3. The method according to item 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg.
[0263] 4. The method according to item 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg.
[0264] 5. The method according to any one of items 1-4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg or about 1600 mg.
[0265] 6. The method according to any one of items 1-5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg or 1600 mg.
[0266] 7. The method according to any one of items 1-6, wherein the anti-DDR1 antibody is administered intravenously.
[0267] 8. The method according to any one of items 1-7, wherein the anti-DDR1 antibody is administered by intravenous infusion within 60 minutes.
[0268] 9. The method according to any one of items 1-7, wherein the anti-DDR1 antibody is administered by intravenous infusion within 30 minutes.
[0269] 10. The method according to any one of items 1-9, wherein the anti-DDR1 antibody is administered once a week.
[0270] 11. The method according to any one of items 1-9, wherein the anti-DDR1 antibody is administered once every 2 weeks.
[0271] 12. The method according to any one of items 1-9, wherein the anti-DDR1 antibody is administered once every 3 weeks.
[0272] 13. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is administered once every 4 weeks.
[0273] 14. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is administered once every 8 weeks.
[0274] 15. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 8 mg once every 3 weeks.
[0275] 16. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 24 mg once every 3 weeks.
[0276] 17. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 80 mg once every 3 weeks.
[0277] 18. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 240 mg once every 3 weeks.
[0278] 19. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 400 mg once every 3 weeks.
[0279] 20. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 800 mg once every 3 weeks.
[0280] 21. The method according to any one of aspects 1-9, wherein the anti-DDR1 antibody is intravenously administered at a dose of 1600 mg once every 3 weeks.
[0281] 22. The method according to any one of aspects 1-21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist.
[0282] 23. The method according to any one of aspects 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg.
[0283] 24. The method according to any one of aspects 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg or 1680 mg.
[0284] 25. The method according to any one of aspects 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg.
[0285] 26. The method according to any one of aspects 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
[0286] 27. The method according to any one of aspects 1-26, wherein the PD-1 or PD-L1 antagonist is administered intravenously.
[0287] 28. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once a week.
[0288] 29. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every two weeks.
[0289] 30. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every three weeks.
[0290] 31. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every four weeks.
[0291] 32. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every six weeks.
[0292] 33. The method according to any one of aspects 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every eight weeks.
[0293] 34. The method according to any one of the foregoing aspects, wherein the subject has cancer.
[0294] 35. The method according to aspect 34, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to treat cancer in the subject.
[0295] 36. The method according to aspect 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1.
[0296] 37. The method according to aspect 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1.
[0297] 38. The method according to embodiment 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostarlimab, cemiplimab, sintilimab, pamiparib, tislelizumab, toripalimab or rivulizumab.
[0298] 39. The method according to embodiment 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab or durvalumab.
[0299] 40. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is pembrolizumab.
[0300] 41. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 400 mg every 6 weeks.
[0301] 42. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 200 mg every 3 weeks.
[0302] 43. The method according to embodiment 40, wherein pembrolizumab is administered at a dose of 2 mg / kg every 3 weeks.
[0303] 44. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is nivolumab.
[0304] 45. The method according to embodiment 44, wherein nivolumab is administered at a dose of 240 mg every 2 weeks.
[0305] 46. The method according to embodiment 44, wherein nivolumab is administered at a dose of 360 mg every 3 weeks.
[0306] 47. The method according to embodiment 44, wherein nivolumab is administered at a dose of 480 mg every 4 weeks.
[0333] 9>48. The method according to embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg every 2 weeks.
[0308] 49. The method according to embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg every 3 weeks.
[0309] 50. The method according to any one of embodiments 1-36, wherein the PD-1 antagonist is cemiplimab.
[0310] 51. The method according to embodiment 50, wherein cemiplimab is administered at a dose of 350 mg every 3 weeks.
[0311] 52. The method according to any one of aspects 1-36, wherein the PD-1 antagonist is dostarlimab.
[0312] 53. The method according to aspect 52, wherein dostarlimab is administered at a dose of 500 mg once every 3 weeks.
[0313] 54. The method according to aspect 52, wherein dostarlimab is administered at a dose of 1000 mg once every 6 weeks.
[0314] 55. The method according to any one of aspects 1-35 or 37, wherein the PD-L1 antagonist is atezolizumab.
[0315] 56. The method according to aspect 55, wherein atezolizumab is administered at a dose of 840 mg once every 2 weeks.
[0316] 57. The method according to aspect 55, wherein atezolizumab is administered at a dose of 1200 mg once every 3 weeks.
[0317] 58. The method according to aspect 55, wherein atezolizumab is administered at a dose of 1680 mg once every 4 weeks.
[0318] 59. The method according to any one of aspects 1-35 or 37, wherein the PD-L1 antagonist is durvalumab.
[0319] 60. The method according to aspect 59, wherein durvalumab is administered at a dose of 10 mg / kg once every 2 weeks.
[0320] 61. The method according to aspect 59, wherein durvalumab is administered at a dose of 20 mg / kg once every 3 weeks.
[0321] 62. The method according to aspect 59, wherein durvalumab is administered at a dose of 1500 mg once every 3 weeks.
[0322] 63. The method according to any one of the foregoing aspects, wherein the cancer expresses DDR1.
[0323] 64. The method according to any one of the foregoing aspects, wherein the cancer is a solid cancer.
[0324] 65. The method according to any one of the foregoing aspects, wherein the cancer is locally advanced or metastatic solid cancer.
[0325] 66. The method according to any one of the foregoing aspects, wherein the cancer is unresectable.
[0326] 67. The method according to any one of the foregoing aspects, wherein the cancer is refractory to immunotherapy.
[0327] 68. The method according to aspect 67, wherein the immunotherapy is an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-PD-1 / anti-PD-L1 antibody bispecific antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM-3 antibody, an antagonist anti-LAG-3 antibody, an antagonist anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, and an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody.
[0328] 69. The method according to aspect 67, wherein the immunotherapy is an antagonist anti-PD-L1 antibody.
[0329] 70. The method according to any one of the foregoing aspects, wherein the cancer is not sarcoma, hepatocellular carcinoma, or glioma.
[0330] 71. The method according to any one of the foregoing aspects, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, or bone cancer.
[0331] 72. The method according to any one of the foregoing aspects, wherein the cancer is colorectal cancer, ovarian cancer, or non-small cell lung cancer.
[0332] 73. The method according to any one of the foregoing aspects, wherein the subject is not a candidate for standard of care treatment.
[0333] 74. The method according to any one of the foregoing aspects, wherein the cancer is refractory to standard of care treatment.
[0334] 75. The method according to aspect 74, wherein the standard of care treatment is chemotherapy or radiation.
[0335] 76. The method according to any one of aspects 1-75, wherein administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces the tumor size in the subject.
[0336] 77. The method according to any one of the foregoing regimens, wherein prior to administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) has confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically documented advanced, unresectable or metastatic cancer that is refractory or intolerant to standard therapies known to confer benefit, or for which no standard therapy is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) a calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) platelets ≥ 100 × 109 cells / L; or vi) an absolute neutrophil count ≥ 1.5 × 109 cells / L; f) has a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) has not received other cancer therapies.
[0337] 78. The method according to any one of the foregoing regimens, wherein prior to administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) has not received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, the systemic agent including a radio-immunoconjugate, an antibody-drug conjugate, an immune / cytokine, or a monoclonal antibody; b) does not have ongoing toxicity from prior treatment; c) Have not undergone major surgery within < 3 months prior to administration of the anti-DDR1 antibody; d) Have not received radiotherapy within < 28 days prior to administration of the anti-DDR1 antibody; e) Have not undergone organ transplantation, allogeneic stem cell transplantation or autologous stem cell transplantation; f) Have not received a diagnosis of primary or acquired immunodeficiency; g) Have not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the anti-DDR1 antibody; h) Do not have active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiotherapy; i) Do not have an active autoimmune disease or a history of such disease that requires immunosuppressive therapy; j) Do not have clinical symptoms of CNS metastasis within 28 days prior to administration of the anti-DDR1 antibody; and / or k) Do not have leptomeningeal carcinomatosis.
[0338] 79. The method according to any one of the foregoing regimens, wherein the anti-DDR1 antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2 and CDRH3 amino acid sequences of the VH amino acid sequence shown in SEQ ID NO: 7, the variant thereof comprising 1-5 amino acid changes in any one of the CDRH1, CDRH2 or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2 and CDRL3 amino acid sequences of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant thereof comprising 1-5 amino acid changes in any one of the CDRL1, CDRL2 or CDRL3 amino acid sequences.
[0339] 80. The method according to regimen 79, wherein: (a) The VH comprises the CDRH1, CDRH2 and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1-5 amino acid changes; and / or (b) The VL comprises the CDRL1, CDRL2 and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof having 1-5 amino acid changes, SEQ ID NO: 5, or a variant thereof having 1-5 amino acid changes, and SEQ ID NO: 6, or a variant thereof having 1-5 amino acid changes.
[0340] 81. The method according to embodiment 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO: 1, 2, 3, 4, 5, and 6, respectively.
[0341] 82. The method according to any one of embodiments 79-81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises: VH, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or VL, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.
[0342] 83. The method according to embodiment 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 8.
[0343] 84. The method according to embodiment 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO: 9.
[0344] 85. The method according to any one of embodiments 79-84, wherein the anti-DDR1 antibody comprises a heavy chain and / or a light chain, the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 12.
[0345] 86. The method according to embodiment 85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0346] 87. The method according to embodiment 85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO: 12.
[0347] 88. The method according to any one of the preceding embodiments, wherein the anti-DDR1 is administered to the subject before the PD-1 or PD-L1 antagonist.
[0348] 89. The method according to any one of the preceding embodiments, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist.
[0349] 90. The method according to any one of the preceding embodiments, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to the subject simultaneously.
[0350] 91. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments.
[0351] 92. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for preparing a medicament for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments.
[0352] 93. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments.
[0353] 94. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist.
[0354] 95. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments.
[0355] Examples
[0356] Example 1 - Binding Characteristics and Antitumor Activity of Anti-DDR1 Antibody 9H-1
[0357] Test the binding characteristics of anti-DDR1 antibody 9H-1 in various species and its ability to inhibit tumor growth in vivo in a mouse cancer model.
[0358] A. Binding characteristics
[0359] First, test the affinity of 9H-1 for DDR1 proteins from human, mouse, rat, and cynomolgus monkey. Use Biacore assays to determine the affinity of 9H-1 for the extracellular domain of DDR1 from human, mouse, rat, and cynomolgus monkey. Table 5 below shows that 9H-1 binds to DDR1 from various species with high affinity.
[0360] Table 5. Affinity of 9H-1 for DDR1 from different species
[0361] Next, test the ability of 9H-1 to bind to human cells expressing DDR1. Flow cytometry analysis shows that 9H-1 binds significantly more T47D cells (DDR1 high / DDR2 low) compared to BT549 cells (DDR1 low / DDR2 high) (see Figure 1 ).
[0362] B. Antitumor activity
[0363] Briefly, mice were inoculated with E0771 mouse Ddr1- / - cells (engineered triple-negative breast cancer cell line) expressing human DDR1. Every other day, the mice were treated with 10 mg / kg 9H-1, 9H-1-LALAPG (which contains the heavy chain of SEQ ID NO: 11 with the following mutations: L238A, L239A, P333G, numbered according to SEQ ID NO: 11), or IgG control. Tumors were measured every two weeks.
[0364] Figure 2 The results shown indicate that 9H-1 significantly inhibits tumor growth in mice compared to mice treated with IgG control.
[0365] Example 2 - In Vivo Pharmacokinetics of Anti-DDR1 Antibody 9H-1 to Model the FIH Dose
[0366] To determine the first-in-human (FIH) dose of anti-DDR1 antibody 9H-1, a single dose of the antibody was administered to cynomolgus monkeys for pharmacokinetic modeling.
[0367] According to Table 6 below, cynomolgus monkeys were administered 9H-1 antibody at low, medium, and high doses via an intravenous infusion pump. Serum samples were collected before dosing and at 0.25 hours, 8 hours, 24 hours, 72 hours, 120 hours, 168 hours, 240 hours, 288 hours, 336 hours, 504 hours, 576 hours, 672 hours, 840 hours, and 1008 hours. Analysis was performed by antigen capture ELISA, and the individual concentrations of 9H-1 in each animal are shown in Figure 3A -D.
[0368] Table 6. Dose levels of 9H-1 in cynomolgus monkeys
[0369] A two-compartment model with first-order elimination was selected to fit the PK data from the cynomolgus monkey study. During model building, a three-compartment structure resulted in a slightly lower AIC; however, the two-compartment model was selected to reduce the risk of overparameterization.
[0370] The goodness-of-fit of the three-compartment model was included for comparison. The parameters were scaled using the following equations: Vh = tvV (BWh / BWm)^1 V2h = tvV2 (BWh / BWm)^1 Clh = tvCl (BWh / BWm)^0.8 Cl2h = tvCl2 (BWh / BWm)^0.8 The average body weight of cynomolgus monkeys is 2.15 kg, while 80 kg was used as an estimate of human body weight. Due to the significantly irregular PK profiles indicating antidrug antibodies, some animals and time points were excluded from the modeling database. The following animals and time points were included in the modeling: P0101: 0.25 - 240 hours P0102: 0.25 - 240 hours P0103: 0.25 - 240 hours P0201: 0.25 - 504 hours P0202: 0.25 - 504 hours P0203: 0.25 - 1008 hours Table 7 shows the scaled human model parameters: Table 7. Scaled human model parameters
[0371] Based on the model of cynomolgus monkey data and scaled human parameters, Figure 4 andFigure 5 showed the simulated concentrations of 9H-1 administered at a fixed dose of 8 - 1600 mg every 2 weeks (Q2W, Figure 4 ) or every 3 weeks (Q3W, Figure 5 ). These data indicate that when the antibody is administered at any fixed dose Q2W or Q3W, the concentration of 9H-1 remains above the concentration sufficient to bind to human DDR1 and inhibit DDR1 function. Table 8 shows the steady-state parameters of the simulated human 9H-1 exposure.
[0372] Table 8. Simulated human 9H-1 pharmacokinetics
[0373] Example 3 - Study of the safety, pharmacokinetics, pharmacodynamics, and activity of combination therapy of 9H-1 and anti-PD-1 antibody in adult subjects with locally advanced or metastatic solid tumors
[0374] This example describes an open-label, Phase 1 dose-escalation and expansion trial to evaluate the safety and tolerability, efficacy, pharmacokinetics (PK), pharmacodynamics (PD), and activity of the dosing regimen of 9H-1 (a humanized monoclonal antibody against DDR1) in combination with pembrolizumab in adults with advanced solid cancer. 9H-1 is a first-in-class humanized monoclonal antibody targeting DDR1, which is designed to disrupt the collagen arrangement in the tumor stroma and allow the subject's own immune cells to infiltrate the tumor.
[0375] DDR1-targeted therapy has the potential to benefit a wide number of cancer subjects. Analysis of tumor biopsies from various cancer types has confirmed some measurable levels of DDR1 expression in a range of malignancies, with some notable exceptions. Low DDR1 expression was noted in hepatocellular carcinoma and sarcomas, which is why they were excluded from enrollment in the trial. To understand the DDR1 expression levels associated with benefit and to better understand the cancer types that may potentially benefit, enrollment in the trial included all solid tumors, except hepatocellular carcinoma and sarcomas as described above and gliomas due to the uncertainty of blood-brain barrier penetration.
[0376] A. Study design
[0377] Overall design
[0378] The purpose of the dose-escalation plan was to determine the safety, tolerability, optimal dose, and optimal dosing schedule of 9H-1 in combination with anti-PD-1 antibody therapy. Additional expansion trials will be conducted in cohorts of subjects with specific histologies, treatment histories, and / or baseline characteristics to evaluate the signal of anti-tumor activity.
[0379] For each combination cohort, 3 subjects will be initially enrolled. The first combination cohort will start at dose level 3 and no earlier than after the next higher dose single-agent cohort in the Phase 1 study described in Example 3 has been approved for escalation by the BOIN method and the SRC. Pembrolizumab will be administered at 400 mg / dosing event. This study will include five cohorts of subjects, and 9H-1 will be administered intravenously (IV) to the subjects at a dose of 8 mg (cohort 1), 24 mg (cohort 2), 80 mg (cohort 3), 240 mg (cohort 4), 800 mg (cohort 5), or 1600 mg (cohort 6) every three weeks. If subjects enrolled in cohorts 1 and 2 do not have a related adverse event of grade ≥ 2 after 90 days of treatment and the dose level 3 is not dropped according to the following dose escalation design, the subjects enrolled in cohorts 1 and 2 may have their doses escalated to the dose level of cohort 3.
[0380] A venous injection line containing a sterile, non-pyrogenic, low protein-binding 0.2 micron to 5 micron in-line or add-on filter will be used to administer 9H-1 as a diluted solution intravenously (IV) over 1 hour. After the first two doses have been given to each subject without any signs of infusion reaction, with the permission of the study site PI, the infusion time may be reduced to 30 minutes. If an infusion reaction is observed, the SRC may adjust the premedication and infusion duration. Pembrolizumab in a diluted solution will be administered intravenously over 30 minutes through a venous injection line containing a sterile, non-pyrogenic, low protein-binding 0.2 micron to 5 micron in-line or add-on filter. Other drugs will not be administered through the same infusion line.
[0381] Starting from dose cohort 4, up to 10 biomarker backfill slots will be available for subjects who wish to enroll in the trial. The backfill points will be available after the dose cohort has been fully enrolled and is considered safe to continue escalation or has been determined to be the recommended Phase 2 dose (RP2D). Pre-treatment archived tissue or fresh pre-treatment biopsies and post-treatment biopsies 6 weeks after the start of treatment will be mandatory. If the function of the enrolled study site is available, pre-treatment and post-treatment CD8 PET scans will be mandatory. The specific number of slots available for biomarker backfill and the specific histological types to be included or excluded will be determined based on the available data.
[0382] Concomitant Medications
[0383] Any medications or vaccines (including over-the-counter (OTC) or prescription drugs, vitamins, and / or herbal supplements) that participants receive at the time of enrollment or during the study must be recorded along with the reason for use, the administration dates (including start and end dates), and the dose information (including dose and frequency).
[0384] If there are any issues related to concomitant or prior treatments, the medical monitor should be contacted. During the ongoing trial, medications or immunizations specifically prohibited in the exclusion criteria are not allowed. If there are clinical indications for any medications or immunizations specifically prohibited during the trial, it may be necessary to interrupt the study treatment or immunization. The investigator will discuss the prohibited medications and immunizations with the sponsor's clinical director. The final decision regarding any supportive treatment or immunization is made by the investigator and / or the subject's attending physician. However, the decision to continue the subject's study treatment requires the mutual agreement of the investigator, the sponsor, and the subject.
[0385] The following medications and immunizations are prohibited during the study: - Antineoplastic systemic chemotherapy or biotherapy - Immunotherapy not specified in this protocol - Chemotherapy not specified in this protocol - Investigational agents other than 9H-1 - Radiation therapy (radiation therapy for symptomatic solitary lesions or to the brain may be permitted at the discretion of the investigator) - Live vaccines or live attenuated vaccines within 30 days prior to the first dose of study treatment and while participating in the study (inactivated vaccines are permitted). Note: Any licensed COVID-19 vaccines (including those for emergency use) in a specific country are permitted in the study, provided they are mRNA vaccines, adenovirus vaccines, or inactivated vaccines. These vaccines will be treated only as any other concomitant treatment. Investigational vaccines (i.e., those not licensed or approved for emergency use) are not permitted.
[0386] - Systemic corticosteroids, unless used for the following purposes: To modulate symptoms of AEs suspected to have an immunological etiology To prevent vomiting As premedication for IV contrast allergy To treat COPD exacerbations (only short-term orally or IV at > 10 mg / day of prednisone equivalent) For chronic systemic replacement not exceeding 10 mg / day of prednisone equivalent Other corticosteroid uses, unless used for the following purposes: For topical or ophthalmic use Intra-articular joint use For inhalation in the treatment of asthma or chronic obstructive pulmonary disease Note: Inhaled corticosteroids for the treatment of asthma are permitted. If the investigator determines that the subject requires any of the above treatments for any reason, 9H-1 must be interrupted.
[0387] The investigator believes that all treatments necessary for the welfare of the subject can be administered at the investigator's discretion in accordance with the community standards of medical care.
[0388] All concomitant medications will be recorded on the eCRF, including all prescription, over-the-counter products, herbal supplements, as well as IV medications and fluids. If there are changes during the study, the recording of drug dose, frequency, route, and date should also be included on the eCRF.
[0389] All concomitant medications received within 28 days prior to the first dose of study treatment and up to 30 days after the last dose of study treatment should be recorded. All concomitant medications administered during an SAE or ECIS should be recorded.
[0390] BOIN design for dose escalation
[0391] The Bayesian optimal interval (BOIN) design will be used to explore the maximum tolerated dose (MTD). The BOIN design is implemented in a simple way similar to the traditional 3 + 3 design, but is more flexible and has stronger operating characteristics compared to more complex model-based designs (such as the continual reassessment method (CRM)). Dose-limiting toxicity (DLT) occurring in the first cycle will be used for dose exploration.
[0392] The steps to implement the BOIN design are described as follows: 1. Accelerated titration is carried out as follows until dose level 3 (1 mg / kg): Treat the first subject at dose level 1. If no DLT is observed, increase the dose to the next higher level. Continue this dose escalation process with one subject per dose until either of the following events is observed: (i) the first instance of DLT, or (ii) the second instance of moderate (grade 2) toxicity. Then treat two additional subjects at the current dose level. After that, treat subjects in groups of three, as described in steps 2 and 3. In the case where titration reaches dose level 3 without observing (i) or (ii), treat subjects in groups of three starting from dose level 4.
[0393] 2. To assign doses to the next group of subjects, dose escalation / de-escalation is carried out according to the rules shown in Table 9 below. When using Table 9, please note the following: 3. "Elimination" means eliminating the current and higher doses from the trial to prevent treating any future subjects at these doses because they are overly toxic.
[0394] 4. When we eliminate a dose, the dose is automatically de-escalated to the next lower level. When the lowest dose is eliminated, the trial is stopped due to safety. In this case, no dose should be selected as the MTD.
[0395] 5. If no action is triggered (i.e., escalation, de-escalation, or dropout), treat the new subject at the current dose.
[0396] 6. If the current dose is the lowest dose and the rule indicates dose de-escalation, treat the new subject at the lowest dose unless the number of DLTs reaches the dropout boundary (at which point the trial is terminated for safety).
[0397] 7. If the current dose is the highest dose and the rule indicates dose escalation, treat the new subject at the highest dose.
[0398] 8. Repeat step 2 until the maximum sample size of 30 is reached, or stop the trial if the number of evaluable subjects treated at the current dose reaches 9 and the decision according to Table 9 would be to remain at the current dose.
[0399] Table 9. Dose escalation / de-escalation rules for the BOIN design.
[0400]
[0401] The "# of DLTs" is the number of subjects with at least 1 DLT. When no action is triggered (i.e., escalation, de-escalation, or dropout), maintain the current dose for treating the next group of subjects.
[0402] "NA" means that a dose cannot be dropped out until 3 DLT-evaluable subjects have been treated.
[0403] All adverse events (AEs) specified in Table 10 should be counted as DLTs, except those clearly due to disease progression or external causes.
[0404] Table 10. Adverse events.
[0405]
[0406] Long-term extension phase
[0407] Subjects will receive treatment with 9H-1 and pembrolizumab until they meet the criteria for study discontinuation. When the RP2D is determined, subjects in the dose escalation part of the trial will be able to transition from their assigned dose cohort to receive the RP2D.
[0408] Study termination
[0409] The end of the study is defined as the primary completion date, which is defined as the date on which the last subject completes the last visit (a phone call is also considered a visit), or when the sponsor decides to terminate the study, whichever occurs first.
[0410] Recruitment will stop when one of the following occurs: - Before the expected number of subjects is recruited, the study treatment is considered too toxic to continue. This assessment will be conducted by the CTSC.
[0411] - The stated number of subjects to be recruited is reached. This number may be increased to include substitute subjects for those whose DLTs are not evaluable and subjects added to the intermediate dose or expansion cohorts.
[0412] - The stated objectives of the study are achieved.
[0413] - The sponsor decides.
[0414] At the termination of the study, the sponsor and the investigator must ensure that adequate consideration is given to the protection of the subjects' interests.
[0415] If a subject has completed all phases of the study, including a follow-up of 30 days (± 7 days) after the last dose of their study treatment, he or she is considered to have completed the study, unless they are experiencing ongoing study treatment-related AEs or SAEs. For subjects with ongoing SAEs or study treatment-related AEs, follow-up is continued at least every 4 weeks until resolution or return to baseline, stabilization of the event, subject loss to follow-up or withdrawal of consent, or as deemed necessary by medical monitoring, whichever occurs first. If a subject starts another anti-cancer treatment, safety follow-up will stop.
[0416] The total duration of the study from the screening of the first participant to the end of the study is expected to be approximately 40 months.
[0417] B. Study Population
[0418] Inclusion Criteria
[0419] Participants are eligible for the study if the following criteria apply: 1. Willing to read, understand, and sign the informed consent form.
[0420] 2. Age ≥ 18 years.
[0421] 3. Measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1, histologically confirmed metastatic or advanced, unresectable malignant tumor, excluding sarcoma and glioma.
[0422] 4. Have a pathological record of advanced / unresectable or metastatic cancer that is refractory or intolerant to standard treatment known to confer benefit, or for which no standard treatment is available for the cancer.
[0423] 5. The subject must have an Eastern Cooperative Oncology Group performance status (PS) of 0 - 1.
[0424] 6. The subject must have an expected lifespan of ≥ 3 months.
[0425] 7. The subject must have the following laboratory values (obtained ≤ 28 days prior to enrollment):
[0426] a. Calculated creatinine clearance (CrCL) must be ≥ 50 mL / min as calculated by the Cockcroft-Gault formula.
[0427] b. Total bilirubin ≤ 1.5 × ULN, unless there is a known history of Gilbert syndrome (in which case, total bilirubin must ≤ 3 × ULN).
[0428] c. AST and ALT ≤ 2.5 × ULN.
[0429] d. Hemoglobin ≥ 9.0 g / dL.
[0430] e. Platelets ≥ 100 × 109 cells / L
[0431] f. Absolute neutrophil count ≥ 1.5 × 109 cells / L (without the use of hematopoietic growth factors).
[0432] 8. Corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula).
[0433] 9. Women of childbearing potential (WOCBP) must have a negative urine pregnancy test within 72 hours prior to the first administration of 9H-1 and a negative urine pregnancy test on the first day of dosing.
[0434] 10. WOCBP and men with female partners of childbearing potential must agree to use appropriate birth control for the entire duration of their participation and for 90 days after the last dose of 9H-1.
[0435] 11. The subject must be willing to comply with the study visit schedule and the prohibitions and restrictions specified in this protocol.
[0436] 12. The subject must have a disease site that is acceptable for biopsy and is a candidate for tumor biopsy according to the guidelines of the treating institution, or have archived tissue available at the time of enrollment.
[0437] a. After discussion with the sponsor, subjects without an acceptable disease site for biopsy may be considered.
[0438] 13. The subject is not enrolled in any other clinical trial and has not received other treatment for their malignancy.
[0439] 14. The subject may have received prior PD-1 / PD-L1 therapy, but has no prior history of immune-related adverse events ≥ grade 3 to immune checkpoint inhibitors. For patients with grade 2 immune-related adverse events to prior immune checkpoint inhibitors, these must have resolved to grade 1 at the time of enrollment, except for the following: a. Alopecia and vitiligo; b. Stable grade 2 neuropathy, c. Well-controlled hypothyroidism / hyperthyroidism or other endocrine diseases well-controlled by hormone replacement.
[0440] This exception must be evaluated by the investigator (and approved by the sponsor) so as not to place the subject at an undue safety risk while participating in this study.
[0441] Additional inclusion criteria for biomarker backfill subjects: 1. The subject must have a disease site amenable to an acceptable biopsy and be a candidate for tumor biopsy according to the guidelines of the treating institution. The subject must be willing to undergo a new tumor biopsy or have archived tissue available at the time of enrollment and be willing to undergo at least one biopsy during the study.
[0442] a. After discussion with the sponsor, subjects without a disease site amenable to an acceptable biopsy may be considered.
[0443] Additional inclusion criteria for the expansion trial: 1. Subjects with the following indications may be included in the expansion trial: a. Cohort B: Colorectal cancer, MSS, BRAFV600E mutation not previously treated with 5-fluorouracil, oxaliplatin, irinotecan, and appropriate biotherapies or intolerant to the above therapies.
[0444] b. Cohort C: Platinum-resistant ovarian cancer, with one or more prior lines of treatment, where platinum resistance is defined as recurrence or progression within 6 months of completion of the first platinum treatment or subsequent courses of platinum treatment, low TMB
[0445] c. Cohort D: NSCLC with primary resistance to PD-1 / PD-L1 therapy, which is defined as progression within 6 months of initiation of treatment with PD-1 or PD-L1, one or more prior treatments, and no history of targetable driver mutations.
[0446] Exclusion criteria
[0447] If any of the following criteria apply, participants are excluded from the trial: 1. The subject has received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, where the systemic agent includes, but is not limited to, radio-immunoconjugates, antibody-drug conjugates, immunocytokines, and monoclonal antibodies (e.g., anti-CTLA4, anti-PD-1, and anti-PD-L1). 2. According to CTCAE, the subject has persistent toxicity > grade 1 from prior treatment and has the following a. Alopecia and vitiligo b. Neuropathy of grade ≤ 2 c. Well-controlled hypothyroidism / hyperthyroidism or other endocrine diseases well-controlled by hormone replacement 3. The subject has undergone major surgery (excluding minor surgeries, e.g., placement of vascular access) < 3 months prior to administration of 9H-1.
[0448] 4. The subject has received radiotherapy < 28 days prior to administration of 9H-1.
[0449] a. Exception: Limited (e.g., for pain relief) radiotherapy is permitted before and during study treatment, provided there is no acute toxicity and the subject has measurable disease outside the radiotherapy field.
[0450] 5. The subject has undergone or is expected to undergo an organ transplant at any time, including allogeneic or autologous stem cell transplantation.
[0451] 6. The subject has a diagnosis of primary or acquired immunodeficiency.
[0452] 7. The subject has received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of 9H-1. Exception: Inhaled or topical (including mouthwash) steroids and adrenal replacement dosing are permitted in the absence of active autoimmune disease.
[0453] 8. The subject has an active autoimmune disease requiring immunosuppressive therapy or a prior history of autoimmune disease. Exceptions may apply.
[0454] 9. The subject has a known severe intolerance or hypersensitivity to monoclonal antibodies, Fc-bearing proteins (e.g., soluble receptors or other Fc fusion proteins), or IV immunoglobulin preparations; a prior history of a human anti-human antibody response; a known allergy to any of the study drug, its analogs, or excipients in any of the various formulations of any agent.
[0455] 10. The subject has an active central nervous system (CNS) tumor involving (including signs of brain edema by magnetic resonance imaging (MRI), or progression from previous imaging studies) without definitive use of surgery or radiotherapy, or has had any requirement for steroids or has had clinical symptoms of CNS metastases / clinical symptoms from CNS metastases within 28 days before the study treatment.
[0456] 11. The subject has leptomeningeal carcinomatosis, regardless of treatment history.
[0457] 12. The subject currently has a second malignancy at other sites (Exception: non - melanoma skin cancer, appropriately treated carcinoma in situ (e.g., cervix), or asymptomatic prostate cancer under observation). A history of other malignancies is permitted, provided that the subject has had no recurrence for ≥ 2 years, or if the subject has been treated with curative intent within the past 2 years and in the opinion of the investigator, recurrence is unlikely.
[0458] 13. The subject has an active and clinically significant bacterial, fungal, or viral infection, including known hepatitis A, B, or C or HIV (testing not required).
[0459] 14. The subject has received a live vaccine within the past 30 days (inactivated vaccines are permitted; seasonal vaccines > 30 days before the administration of 9H - 1 should be up - to - date).
[0460] 15. Pregnant or breastfeeding women.
[0461] 16. History of any of the following within ≤ 6 months before the first dose: a. New York Heart Association class III or IV congestive heart failure, b. Unstable angina, c. Myocardial infarction, d. Unstable symptomatic ischemic heart disease, e. Hypertension that is uncontrolled despite appropriate medical treatment, f. Persistent symptomatic arrhythmia of grade ≥ 2, g. Pulmonary embolism or symptomatic cerebrovascular event, or any other severe heart condition (e.g., pericardial effusion or restrictive cardiomyopathy). Chronic atrial fibrillation with stable anticoagulation treatment is permitted.
[0462] 17. The subject has any contraindications to the imaging evaluations or other study procedures to which the subject will be subjected.
[0463] 18. The subject has any medical or social condition that, in the opinion of the investigator, may place the subject at increased risk, affect compliance, or confound safety or other clinical study data interpretation.
[0464] C. Efficacy Assessment
[0465] Participants will undergo tumor assessments until loss of clinical benefit as determined by the investigator (unless the participant withdraws consent or the sponsor terminates the study). All participants who discontinue the study intervention for reasons other than disease progression (e.g., adverse event) will continue tumor assessments until death, disease progression, initiation of another systemic anti-cancer therapy, loss to follow-up, withdrawal of consent, or study termination, whichever occurs first. Tumor assessments may be repeated at any time at the discretion of the investigator if progressive disease is suspected.
[0466] Measurable and evaluable lesions should be assessed and recorded at screening. Tumor assessments performed as standard of care before obtaining informed consent and within 30 days before enrollment do not have to be repeated at screening.
[0467] Screening assessments must include CT scans of the chest / abdomen and pelvis (using IV contrast unless contraindicated and oral contrast according to appropriate institutional standards). If a contrast-enhanced CT scan is contraindicated (i.e., in participants with contrast allergy or impaired renal clearance), a non-contrast CT scan of the chest may be performed, and an MRI scan of the abdomen and pelvis should be performed. All subjects with neurological symptoms will require an MRI of the brain.
[0468] If a CT scan for tumor assessment is performed in a positron emission tomography (PET) / CT scanner, the CT acquisition must be consistent with the standards for a fully contrast-enhanced diagnostic CT scan.
[0469] If clinically indicated, a bone scan (technetium-99m [Tc-99m]) or sodium fluoride (NaF) PET should be performed at screening. If bone metastases are present at screening and not visible on CT or MRI scans, or if clinically indicated, repeat Tc-99m and NaF-PET bone scans should be performed at the time of complete response in the target disease or when progression in bone is suspected.
[0470] If clinically indicated, CT scans of the neck or extremities should also be performed, and if there are signs of disease at screening, CT scans should be repeated throughout the study.
[0471] CD8 PET scans obtained during the study period are considered exploratory and will not be used to assess treatment response by RECIST v1.1. However, when possible, CT scans consistent with the criteria of a full-contrast diagnostic CT scan are applied for CD8 PET scans. The contrast-enhanced CT scans should be evaluated separately from the CD8 PET scans and will count as efficacy endpoint evaluations.
[0472] All measurable and evaluable lesions should be re-evaluated in each subsequent tumor assessment. The same radiographic procedures used to evaluate disease sites at screening should be applied to subsequent tumor assessments (e.g., CT scans with the same contrast protocol).
[0473] Response will be evaluated by the investigator using RECIST v1.1. If possible, it should be evaluated by the same assessor to ensure intra-visit consistency. Before dosing in the next cycle, the investigator must check the results.
[0474] The overall response rate (ORR) is defined as the primary efficacy endpoint for each dose expansion cohort. If a CR / PR is observed from the overall objective response assessment, the subject will be considered a responder by the investigator according to RECIST. This endpoint will be analyzed according to the BOP2 method. At the end of the cohort, the ORR will be calculated separately for each expansion cohort using the binomial exact method with a 95% confidence interval, where the denominator will include all efficacy-evaluable subjects in the cohort (subjects who have completed at least three RECIST assessments after baseline or who have been discontinued from the study due to death, AE, lack of efficacy, or progressive disease). As an exploratory endpoint, the overall confirmed response rate (CR / PR confirmed by the next RECIST assessment), the ORR according to iRECIST, and the ORR including all dosed subjects in the denominator (ITT method) will be similarly analyzed for each expansion cohort with a 95% confidence interval after enrollment is complete.
[0475] Progression-free survival (PFS) is defined as an exploratory efficacy endpoint for each histology-specific expansion cohort, which is the duration from Day 1 to the date of first disease progression, as evaluated by the investigator according to RECIST v1.1 (or as the primary reason for discontinuation) or death. This time-to-event variable will be censored at the date of the last RECIST assessment or the date of discontinuation not due to disease progression or death. This endpoint for each expansion cohort including all dosed subjects will be analyzed using the Kaplan-Meier method. PFS according to the iRECIST criteria will be similarly derived and analyzed.
[0476] The duration of response (DOR) is defined as exploratory for each histology-specific expansion cohort and is the duration from the first observed response (CR / PR per RECIST v1.1) to the date of first disease progression after response. This time-to-event variable will be censored at the date of the last RECIST assessment or at the date of discontinuation for reasons other than AE, disease progression, or death after the initial response date. This endpoint for each expansion cohort, including all responders in the cohort, will be analyzed using the Kaplan-Meier method. DOR according to the iRECIST criteria will be similarly derived and analyzed.
[0477] The disease control rate (DCR) is defined as the percentage of subjects with advanced or metastatic cancer who have achieved a complete response, partial response, and stable disease by RECIST v1.1. This endpoint for each expansion cohort, including all dosed subjects, will be analyzed using the Kaplan-Meier method.
[0478] Overall survival (OS) is defined as an exploratory endpoint for each histology-specific expansion cohort and is the duration from Day 1 to the date of death. This time-to-event variable will be censored at the date of the last known survival. This endpoint for each expansion cohort, including all dosed subjects, will be analyzed using the Kaplan-Meier method.
[0479] D. Safety Assessment
[0480] Safety assessment will consist of monitoring and recording adverse events (including serious adverse events (SAEs) and special-purpose adverse events (AEs)), performing protocol-specified safety laboratory evaluations, measuring protocol-specified vital signs, and performing other protocol-specified tests considered essential for the safety assessment of the study.
[0481] E. Pharmacokinetics
[0482] Serum PK of 9H-1 and pembrolizumab will be collected in all parts of the study. The planned PK time points may be updated or discontinued after the initial assessment of the characterized PK profile. PK sampling may be reduced without protocol modification if emerging PK data show that a lower frequency schedule of events is warranted.
[0483] The following PK parameters of 9H-1 will be determined using non-compartmental methods: Cmax, time to Cmax (Tmax), last verified plasma concentration (Clast), AUC0-last (AUC504h or AUC336h or AUC672h for the doses on Day 1 of Cycle 1 and Day 3 of Cycle 3), time to the last measurable concentration (Tlast), (t1 / 2), cumulative ratios of 9H-1 and pembrolizumab, and, if possible, Vd and CL. Possible relationships between PK and PD variables, potency, and / or selected toxicities will be explored as appropriate.
[0484] PK profile curves for the evaluation of the PK characteristics of 9H-1 and pembrolizumab will be collected from all enrolled subjects. Complete PK profile curves will be collected for all subjects enrolled in the combined dose escalation study. Subjects enrolled in the expansion study will have a simplified PK sampling schedule.
[0485] Remaining PK, PD, and ADA samples for PK and ADA analysis may also be used for exploratory PK and / or PD analysis related to 9H-1 treatment and cancer. This may include using the remaining samples for exploratory, alternative PK assay development and analysis.
[0486] 9H-1 levels will be determined using blood samples collected before and after dosing during the EOT visit. These determinations will be used to calculate single-dose and repeated-dose PK profile curves for each evaluable subject at each dose level. Non-compartmental analysis will be used to estimate PK parameters of 9H-1 in combination with pembrolizumab and pembrolizumab alone. PK parameters will include, but not be limited to, cumulative ratios, Cmax, Tmax, Clast, Tlast, AUC0-last (AUC504h or AUC336h or AUC672h), Vd, CL, and t½.
[0487] Descriptive statistics will be used to list and summarize 9H-1 and pembrolizumab concentrations in tabular form. 9H-1 and pembrolizumab concentration plots will be drawn by cohort for time points. Descriptive statistics will be used to list and summarize individual and summary PK parameters in tabular form.
[0488] F. Immunogenicity
[0489] The relationship between immunogenicity and the 9H-1 serum concentration and adverse events will be presented graphically and tabulated to characterize the change in ADA at screening and the relationship with the serum concentration of 9H-1 in combination with pembrolizumab.
[0490] In addition, the potential correlation between immunogenicity and other endpoints (primary safety, efficacy, and biomarker parameters) can be evaluated. This will be done in two steps. First, a descriptive analysis will be performed in the form of a graph between the immunogenicity changes at screening values and the primary safety, efficacy, and biomarker parameters (as categorical or continuous variables). If any potential correlation is identified, further studies will be conducted using mechanism-based modeling methods as appropriate.
[0491] The concentration / adverse event-immunogenicity relationship will be presented in the form of a graph and tabulated to characterize the relationship between the presence of screening immunogenicity and changes in the serum concentration of single agent 9H-1.
[0492] In addition, the potential correlation between immunogenicity and other endpoints (primary safety, efficacy, and biomarker parameters) can be evaluated. This will be done in two steps. First, a descriptive analysis will be performed in the form of a graph between the immunogenicity changes at screening values and the primary safety, efficacy, and biomarker parameters (as categorical or continuous variables). If any potential correlation is identified, further studies will be conducted using mechanism-based modeling methods as appropriate.
[0493] G. Biomarkers
[0494] The exploratory biomarker objectives of this study are to identify biomarkers associated with immuno-oncology study interventions by evaluating tumor tissue and circulating soluble factors, including but not limited to DNA, RNA, enzymes, growth factors, cytokines, antibodies, and immune cells in tissue and blood. In addition, the microbial profile can be evaluated from fecal samples. Assessments at baseline and / or over the course of the study intervention can be made to determine associations with clinical outcomes (including clinical response and resistance) and study intervention tolerability.
[0495] Collecting samples for biomarker research is part of this study. The following samples are required for biomarker research and will be collected from all participants in this study as specified in the SoA: - Blood, including PBMC - Skin biopsy - Tumor tissue biopsy (prior, archived, or fresh) - Optionally, the following samples for biomarker research that should be collected from participants in the study, if possible: Tumor tissue biopsy (six weeks after treatment), optionally for all subjects. Mandatory for biomarker backfill subjects.
[0496] Test samples can be used for genetic analysis of tumor and blood samples, including but not limited to circulating free DNA, DNA testing from tumors and / or immune cells, and possible T cell receptor sequencing. The study can evaluate whether genetic variations correspond to treatment outcomes. If genetic variations predictive of efficacy or adverse events are found, the data may inform the optimal use of treatment in cancer subjects. Circulating soluble analytes can be evaluated, including but not limited to immunocytokines, growth factors, antibodies, and / or markers associated with immune signatures and activation or cancer. In addition, tumor and blood samples will be collected before and at the time of study intervention for immune cell profiling, which can include immunocyte phenotyping, enumeration, and / or activation status. Whole genome and targeted messenger RNA (mRNA) expression profiling and sequencing can be performed in tumors and / or blood to identify gene signatures associated with treatment outcomes. Epigenetic analysis can also be performed as these epigenetic are important biomarkers in some cancers.
[0497] Blood, skin, tissue, and tumor biopsies will be collected from subjects throughout the trial for biomarker analysis.
[0498] H. Genetics
[0499] Instructions for sample collection, storage, and transportation for planned genetic analysis samples will be provided in the laboratory manual. Samples should be collected for planned analysis of the association between germline / tumor DNA genetic variants and clinical outcomes. As described in the activity schedule, blood will be collected for planned genetic analysis for DNA. If documented laws or regulations prohibit (or local IRB / IEC does not approve) sample collection for these purposes, such samples should not be collected at the corresponding study sites. Additional DNA extracted from planned genetic analysis samples will only be stored for future biomedical research if the participant has signed a Future Biomedical Research consent.
[0500] In the event of DNA extraction failure, alternative genetic blood samples may be requested from the participant. Obtaining an alternative sample will require a signed informed consent, unless it is included in the original consent.
[0501] I. Objectives and Endpoints
[0502] Table 11: Objectives and Endpoints.
[0503]
[0504] Table 12: Objectives and Endpoints of the Extension Study.
[0505]
[0506] For the purposes of analysis, the following groups were defined: Table 13: Groups for analysis.
[0507]
[0508] J. Statistical Analysis
[0509] This study will use an adaptive approach, using data from the treatment period to guide trial adaptation and the success or failure of each combination in each study sub-group.
[0510] The statistical analysis plan will be developed and finalized prior to database lock and will describe the study populations to be included in the analysis, as well as the process for accounting for missing, unused, and spurious data. This section is a summary of the planned statistical analysis of the primary and secondary endpoints.
[0511] Example 4 - Anti-DDR1 Antibody Treatment Enhances T Cell Infiltration Induced by Anti-PD-1 Antibody
[0512] This example demonstrates that when administered in combination with an anti-PD-1 antibody, the rabbit monoclonal antibody form of 9H-1 (a humanized anti-DDR1 monoclonal antibody), wherein the rabbit monoclonal antibody comprises heavy and light chains shown in Table 17 below, enhances the infiltration of T cells into solid tumors in mice.
[0513] Table 17
[0514] As Figure 6 shown, when the 9H-1 rabbit monoclonal antibody (αDDR1) is administered in combination with the mouse anti-PD-1 antibody (αPD-1), the percentage of CD3+ cells in the center of the mouse solid tumor is significantly higher compared to the administration of the 9H-1 rabbit monoclonal antibody or the mouse anti-PD-1 antibody alone. In addition, Figure 7A and Figure 7B show respectively that compared to single treatment or control treatment, combination treatment significantly increases T cell activation and significantly reduces tumor volume. Although not bound by theory, it is believed that anti-DDR1 treatment disrupts the collagen barrier around solid tumors, allowing increased T cell infiltration, and the addition of an anti-PD-1 therapeutic agent increases T cell activation and infiltration to further enhance the anti-tumor effect ( Figure 8 ).
[0515] Example 5 - In Vivo Syngeneic Mouse Tumor Model Selection: Identification of an Immune-Rejected DDR1-Dependent Mouse Model
[0516] The goal of these studies was to identify DDR1-dependent syngeneic mouse models for evaluating immune rejection of novel DDR1-targeted therapies. Selection criteria for identifying immune rejection mouse tumor models included: (i) expression of DDR1; (ii) presence of a functional immune system; (iii) immunohistochemical (IHC) evidence of immune cells present in the periphery of the tumor (i.e., excluded); and (iv) resistance to checkpoint inhibition therapy or other therapies to enable investigation of combination strategies (e.g., checkpoint inhibitors (CPI); chemotherapy, radiotherapy (RT), etc.).
[0517] Eight different syngeneic mouse tumor models that express variable levels of DDR1, have variable levels of resistance to anti-PD1, and are known to be immune models were selected for screening of DDR-1-dependent mouse models of immune rejection. (Table 14). The studies described herein used clean cell lines (i.e., free of mycoplasma and murine-pathogen contamination). The knockout cell lines used were generated using transient expression of the CRISPR / Cas9 system (i.e., unstable Cas9 expression) to ensure that no non-mouse proteins were expressed in any of the cell lines. In addition, rather than isolating single cell clones, a pool of DDR1-negative (DDR1KO) cells was sorted using flow cytometry to dilute any potential off-target effects. The sorted cells were expanded and implanted into wild-type immunocompetent mice of the same syngeneic strain.
[0518] The observed tumor growth data confirmed the anti-tumor effect of DDR1 KO. (For example, Figures 12A to 16D ). Interestingly, the anti-tumor effect was observed primarily in mouse models of the BALB / c strain( Figures 12A to 15D ) and the C3H / HeN strain( Figures 16A to 16D ), and to a lesser extent in the C57BL / 6 mouse tumor model( Figures 9A to 11C ). The Renca (renal carcinoma) and MBT-2 mouse models were observed to show a strong anti-tumor effect.( Figures 12A to 12C ; Figures 16A to 16D ). The observed anti-tumor effects are summarized in Table 14.
[0519] Table 14. Summary of anti-tumor effects observed in mouse tumor models.
[0520]
[0521] Example 6 - Tumor kinetics study using murine colorectal carcinoma tumor model CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines in Balb / c mice
[0522] The CRISPR-Cas9 system was used to disrupt DDR1 expression in CT26 murine colorectal cells as described in Example 5. Subsequently, isolated CT26 cells with reduced surface DDR1 levels (DDR1r / DDR1 KO) compared to WT controls were sorted using flow cytometry ( Figures 20A - 20C ). DDR1r / DDR1 KO and control cells (DDR1 WT) were injected into the flanks of BALB / c mice (n = 10 per condition) to form tumors. At the DDR1r / DDR1 KO condition, the tumor volume at 31 days (where all mice were still under study) showed a significant decrease in tumor size. These results indicate that DDR1 plays a functional role in suppressing tumor growth and progression.
[0523] Methods and Results: DDR1 CRISPR Knockout: DDR1 was knocked out in the murine colon cancer cell line CT26 (ATCC, CRL-2638) by using two DDR1 sgRNAs and Cas9-RFP (IDT, Cat#10008163). Both DDR1 sgRNAs targeted the DDR1 extracellular domain coding sequence.
[0524] The sgRNA sequences were as follows: sgRNA1: TCCATCTCCACGTAGCCCGTGGG (IDT, Design ID: Mm.Cas9.DDR1.1.AC); [SEQ ID NO:13]; sgRNA2: ACTTACGATG-GATATACTGCTGG (Design ID: Mm.Cas9.DDR1.1.AD). [SEQ ID NO:14]. The RNP complex with Cas9-RFP and sgRNA was generated in vitro according to the manufacturer's instructions. The RNP complex was electroporated into CT26 cells using the Lonza NucleofectorTM system.
[0525] FACS sorting: The CT26 DDR1 knockout cell pool was isolated by cell sorting (Sony SH800S). Briefly, CT26 cells were collected 72 hours after electroporation and cell surface DDR1 expression was detected by anti-mouse DDR1 antibody (Sun et al. Nature, 2021 Nov; 599 (7886): 673–678; antibody #33). The DDR1-negative population was sorted and used for continuous culture for one week. The sorted and amplified cells were collected for a second round of sorting to generate a >99% DDR1-negative population. This CT26 cell pool tested negative for mycoplasma and murine pathogens (Mouse Essential CLEAR panel, Charles River Research Animal Diagnostic Services).
[0526] Tumor mouse model: Female BALB / c mice (strain BALB / cAnNCr1) (n = 20; age = 6 - 8 weeks) obtained from Charles River Laboratories were used in this study. The body weight of the mice at the time of inoculation was approximately 17 - 25 g.
[0527] The CT26 tumor cell line was used in the study and is described in Tables 15 and 16 below.
[0528] Table 15. CT26 (WT) [WT: wild-type DDR1]
[0529] Table 16. CT26 (KO) [KO: DDR1 knockout]
[0530] Figure 17 The design of the tumor kinetics study using the CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines in Balb / c mice is shown. During the entire study, tumor volume (TV) (mm3) and body weight (BW) were monitored 2 - 3 times per week, and the changes were plotted as Figure 18A and Figure 18B shown. If the tumor volume of the mice reached >2,000 mm3 tumor volume or when the animal died (whichever occurred earlier), the mice were removed from the mean. This resulted in a decrease in the mean tumor volume at subsequent time points. Individual tumor volumes are shown in Figure 19A and Figure 19B .
[0531] On day 31 of the study, all mice survived, and the TV (mean ± SEM) of the animals in CT26 WT (Group 1 (G1)) was 2156.77 ± 71.8 mm3, and that in CT26 KO (Group 2 (G2)) was 1126.50 ± 290.45 mm3.
[0532] During the entire study period, there were no differences in body weight (BW) changes between the groups. There were no unexpected deaths or clinical observations during the study, except for mouse #3532 in G1, which was euthanized due to morbidity.
[0533] Surviving and terminal blood (serum) were collected two days before the start of the study (day 2) and at the end of the study (day 28), respectively. In addition, at the end of the study (day 28), half (½) of the tumors were placed in 10% formalin, and the other half (½) of the tumors were snap-frozen in liquid nitrogen. ( Figure 17 )
[0534] Incorporation by reference
[0535] The entire contents of all patents and non-patent literature cited above are hereby incorporated by reference into this text.
Claims
1. A method for reducing immune rejection of a tumor in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
2. A method for reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
3. The method according to claim 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg.
4. The method according to claim 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg.
5. The method according to any one of claims 1-4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg or about 1600 mg.
6. The method according to any one of claims 1-5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg or 1600 mg.
7. The method according to any one of claims 1-6, wherein the anti-DDR1 antibody is administered intravenously.
8. The method according to any one of claims 1-7, wherein the anti-DDR1 antibody is administered via intravenous infusion within 60 minutes.
9. The method according to any one of claims 1-7, wherein the anti-DDR1 antibody is administered via intravenous infusion within 30 minutes.
10. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered once a week.
11. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered once every 2 weeks.
12. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered once every 3 weeks.
13. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered once every 4 weeks.
14. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered once every 8 weeks.
15. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 8 mg once every 3 weeks.
16. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 24 mg once every 3 weeks.
17. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 80 mg once every 3 weeks.
18. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously once every 3 weeks at a dose of 240 mg.
19. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously once every 3 weeks at a dose of 400 mg.
20. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously once every 3 weeks at a dose of 800 mg.
21. The method according to any one of claims 1-9, wherein the anti-DDR1 antibody is administered intravenously once every 3 weeks at a dose of 1600 mg.
22. The method according to any one of claims 1-21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist.
23. The method according to any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg.
24. The method according to any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg or 1680 mg.
25. The method according to any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg.
26. The method according to any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg or 20 mg / kg.
27. The method according to any one of claims 1-26, wherein the PD-1 or PD-L1 antagonist is administered intravenously.
28. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once a week.
29. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 2 weeks.
30. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 3 weeks.
31. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 4 weeks.
32. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 6 weeks.
33. The method according to any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 8 weeks.
34. The method according to any one of the preceding claims, wherein the subject has cancer.
35. The method according to claim 34, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to treat cancer in the subject.
36. The method according to claim 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1.
37. The method according to claim 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1.
38. The method according to claim 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostarlimab, cemiplimab, sintilimab, penpulimab, tislelizumab, toripalimab, or retifanlimab.
39. The method according to claim 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab, or durvalumab.
40. The method according to any one of claims 1-36, wherein the PD-1 antagonist is pembrolizumab.
41. The method according to claim 40, wherein pembrolizumab is administered at a dose of 400 mg once every 6 weeks.
42. The method according to claim 40, wherein pembrolizumab is administered at a dose of 200 mg once every 3 weeks.
43. The method according to claim 40, wherein pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks.
44. The method according to any one of claims 1-36, wherein the PD-1 antagonist is nivolumab.
45. The method according to claim 44, wherein nivolumab is administered at a dose of 240 mg once every 2 weeks.
46. The method according to claim 44, wherein nivolumab is administered at a dose of 360 mg once every 3 weeks.
47. The method according to claim 44, wherein nivolumab is administered at a dose of 480 mg once every 4 weeks.
48. The method according to claim 44, wherein nivolumab is administered at a dose of 3 mg / kg once every 2 weeks.
49. The method according to claim 44, wherein nivolumab is administered at a dose of 3 mg / kg once every 3 weeks.
50. The method according to any one of claims 1-36, wherein the PD-1 antagonist is cemiplimab.
51. The method according to claim 50, wherein cemiplimab is administered at a dose of 350 mg once every 3 weeks.
52. The method according to any one of claims 1-36, wherein the PD-1 antagonist is dostarlimab.
53. The method according to claim 52, wherein dostarlimab is administered at a dose of 500 mg once every 3 weeks.
54. The method according to claim 52, wherein dostarlimab is administered at a dose of 1000 mg once every 6 weeks.
55. The method according to any one of claims 1-35 or 37, wherein the PD-L1 antagonist is atezolizumab.
56. The method according to claim 55, wherein atezolizumab is administered at a dose of 840 mg once every 2 weeks.
57. The method according to claim 55, wherein atezolizumab is administered at a dose of 1200 mg once every 3 weeks.
58. The method according to claim 55, wherein atezolizumab is administered at a dose of 1680 mg once every 4 weeks.
59. The method according to any one of claims 1-35 or 37, wherein the PD-L1 antagonist is durvalumab.
60. The method according to claim 59, wherein durvalumab is administered at a dose of 10 mg / kg once every 2 weeks.
61. The method according to claim 59, wherein durvalumab is administered at a dose of 20 mg / kg once every 3 weeks.
62. The method according to claim 59, wherein durvalumab is administered at a dose of 1500 mg once every 3 weeks.
63. The method according to any one of the preceding claims, wherein the cancer expresses DDR1.
64. The method according to any one of the preceding claims, wherein the cancer is a solid cancer.
65. The method according to any one of the preceding claims, wherein the cancer is locally advanced or metastatic solid cancer.
66. The method according to any one of the preceding claims, wherein the cancer is inoperable.
67. The method according to any one of the preceding claims, wherein the cancer is refractory to immunotherapy.
68. The method according to claim 67, wherein the immunotherapy is an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-PD-1 / anti-PD-L1 antibody bispecific antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM-3 antibody, an antagonist anti-LAG-3 antibody, an antagonist anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, and an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody.
69. The method according to claim 67, wherein the immunotherapy is an antagonist anti-PD-L1 antibody.
70. The method according to any one of the preceding claims, wherein the cancer is not sarcoma, hepatocellular carcinoma or glioma.
71. The method according to any one of the preceding claims, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma or bone cancer.
72. The method according to any one of the preceding claims, wherein the cancer is colorectal cancer, ovarian cancer or non-small cell lung cancer.
73. The method according to any one of the preceding claims, wherein the subject is not a candidate for standard of care treatment.
74. The method according to any one of the preceding claims, wherein the cancer is refractory to standard of care treatment.
75. The method according to claim 74, wherein the standard of care treatment is chemotherapy or radiation.
76. The method according to any one of claims 1-75, wherein administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces the tumor size in the subject.
77. The method according to any one of the preceding claims, wherein prior to administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) has confirmed metastatic or advanced, unresectable cancer with measurable disease according to Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically documented advanced, unresectable or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which no standard treatment is available for the cancer; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) has a life expectancy of ≥ 3 months; e) has one or more of the following: i) a calculated creatinine clearance (CrCL) ≥ 50 mL / min as calculated by the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 10 9 cells / L; or vi) Absolute neutrophil count ≥ 1.5 × 10 9 cells / L; f) has a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia correction formula); and / or g) has not received other cancer treatments.
78. The method according to any one of the preceding claims, wherein prior to administering the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) Have not received prior treatment with a systemic agent within 28 days or within five half-lives of the drug, whichever is shorter, where the systemic agent includes a radio-immunoconjugate, an antibody-drug conjugate, an immune / cytokine, or a monoclonal antibody; b) Do not have persistent toxicity from prior treatment; c) Have not undergone major surgery within < 3 months prior to administration of the anti-DDR1 antibody; d) Have not received radiotherapy within < 28 days prior to administration of the anti-DDR1 antibody; e) Have not undergone an organ transplant, an allogeneic stem cell transplant, or an autologous stem cell transplant; f) Have not received a diagnosis of primary or acquired immunodeficiency; g) Have not received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the anti-DDR1 antibody; h) Do not have active central nervous system (CNS) tumor involvement that is not definitively treated with surgery or radiotherapy; i) Do not have an active autoimmune disease or a history of such a disease that requires immunosuppressive therapy; j) Do not have clinical symptoms of CNS metastasis within 28 days prior to administration of the anti-DDR1 antibody; and / or k) Do not have leptomeningeal carcinomatosis.
79. The method according to any one of the preceding claims, wherein the anti-DDRl antibody comprises: a heavy chain variable region (VH) or a variant thereof, the heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences in the VH amino acid sequence shown in SEQ ID NO: 7, the variant comprising 1-5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) or a variant thereof, the light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences in the VL amino acid sequence shown in SEQ ID NO: 8 or 9, the variant comprising 1-5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.
80. The method according to claim 79, wherein: (a) The VH comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 1, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 2, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 3, or a variant thereof comprising 1-5 amino acid changes; and / or (b) The VL comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences that are respectively the following sequences: SEQ ID NO: 4, or a variant thereof comprising 1-5 amino acid changes, SEQ ID NO: 5, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 6, or a variant thereof comprising 1-5 amino acid changes.
81. The method according to claim 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences shown by SEQ ID NO:1, 2, 3, 4, 5, and 6, respectively.
82. The method according to any one of claims 79-81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises: VH, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 7; and / or VL, which comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 8 or 9.
83. The method according to claim 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO:
8.
84. The method according to claim 82, wherein the anti-DDR1 antibody comprises VH and VL, the VH comprises the amino acid sequence shown by SEQ ID NO: 7, and the VL comprises the amino acid sequence shown by SEQ ID NO:
9.
85. The method according to any one of claims 79-84, wherein the anti-DDR1 antibody comprises a heavy chain and / or a light chain, the heavy chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO: 10 or 11, and the light chain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown by SEQ ID NO:
12.
86. The method according to any one of the preceding claims, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown by SEQ ID NO: 10, and the light chain comprises the amino acid sequence shown by SEQ ID NO:
12.
87. The method according to any one of claims 1-85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown by SEQ ID NO: 10 without a terminal lysine, and the light chain comprises the amino acid sequence shown by SEQ ID NO:
12.
88. The method according to any one of claims 1 - 85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, and the light chain comprises the amino acid sequence shown in SEQ ID NO:
12.
89. The method according to any one of claims 1 - 85, wherein the anti-DDR1 antibody comprises a heavy chain and a light chain, the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11 without a terminal lysine, and the light chain comprises the amino acid sequence shown in SEQ ID NO:
12.
90. The method according to any one of the preceding claims, wherein the anti-DDR1 is administered to the subject before the PD-1 or PD-L1 antagonist.
91. The method according to any one of the preceding claims, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist.
92. The method according to any one of the preceding claims, wherein the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist are administered to the subject simultaneously.
93. The method according to any one of the preceding claims, wherein administration of the antibody and the immune checkpoint inhibitor prevents further growth of tumor size in the subject.
94. The method according to any one of the preceding claims, wherein administration of the antibody and the immune checkpoint inhibitor achieves at least disease stabilization in the subject.
95. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.
96. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in preparing a medicament for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.
97. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.
98. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist.
99. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in treating cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.