Genetically engineered streptomyces as well as construction method and application thereof

By replacing the aveA3 fragment of Streptomyces as the milA3 fragment of Streptomyces, the genetically engineered Streptomyces avermitilis HU501-M was solved, and the problems of low yield and high cost of milbemycin D were achieved, achieving efficient production and wide application.

CN120424848AInactive Publication Date: 2025-08-05HUZHOU UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510637184.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-05
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The difficulty in producing milbemycin D efficiently is the result of its limited application in agriculture and veterinary medicines, mainly due to low yield and high manufacturing costs.

Method used

By replacing the aveA3 fragment of Streptomyces avermitilis HU501-M in Streptomyces, genetically engineered Streptomyces avermitilis HU501-M was constructed, and the gene cluster replacement was achieved using the Cas9 knock-in vector to optimize the biosynthesis path of milbemycin D.

Benefits of technology

It has achieved efficient production of milbemycin D, reduced production costs, and improved its application effect in preventing and controlling pine nematodes and American white moths.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424848A_ABST
    Figure CN120424848A_ABST
Patent Text Reader

Abstract

The invention discloses genetically engineered streptomyces as well as a construction method and application thereof. According to the present invention, an aveA3 fragment in a Streptomyces avermitilis gene cluster capable of generating an ivermectin B1b compound is replaced with a milA3 fragment in a Streptomyces hygroscopicus gene cluster so as to obtain the gene engineering Streptomyces, such as Streptomyces avermitilis HU501-M, and the gene engineering Streptomyces HU501-M can be used to produce the ivermectin B1b compound, such that the gene engineering Streptomyces HU501-M can be used to produce the ivermectin B1b compound, and the ivermectin B1b compound can be used to produce the ivermectin B1b compound, and the ivermectin B1b compound can be used to produce the ivermectin B1b compound, and can be used to produce the ivermectin B1b compound. The constructed genetically engineered streptomyces can be used for preparing milbemycin D, and the compound has efficient insecticidal, acaricidal and antiparasitic activity, is high in safety to human beings and animals, and is environment-friendly. The main fermentation product of the genetically engineered streptomyces is milbemycins D, and the genetically engineered streptomyces has a good industrial development prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology and microbial pharmacy, and specifically relates to genetically engineered bacteria and their construction methods and uses. Background Art

[0002] Sixteen-membered macrolide natural products have attracted considerable attention in drug development due to their rich bioactivity and excellent safety profile. Avermectins and milbemycins, among them, have been widely used as agricultural and veterinary pesticides due to their excellent insecticidal activity. The biosynthetic gene clusters for avermectins and milbemycins have been identified and show strong homology among Streptomyces. This provides a foundation for the use of synthetic biology to manipulate gene fragments and engineer the producing bacteria to obtain engineered strains with enhanced traits.

[0003] Milbemycins are a class of 16-membered macrolide compounds discovered from the fermentation broth of Streptomyces hygroscopicus. They exhibit high activity and low toxicity. In 1972, the 16-membered macrolide structure of these compounds was elucidated and named milbemycins. Subsequently, several structurally similar compounds, including milbemycin D, E, F, G, H, J, and K, have been reported. Several milbemycins have been commercialized internationally. Milbemycin D, due to its excellent acaricidal activity and crystallizable properties, has been explored for use in veterinary and pesticide development. However, since it is not the primary fermentation product of the milbemycin-producing bacteria, its commercialization is hampered by low yields and high manufacturing costs. The development of engineered strains that produce milbemycin D as their primary fermentation product through synthetic biology would be of great significance for the industrial development of this product. Summary of the Invention

[0004] The present invention provides a genetically engineered Streptomyces capable of producing milbemycin D, which is obtained by replacing the aveA3 fragment in the gene cluster of Streptomyces avermitilis producing the ivermectin B1b compound with the milA3 fragment in the gene cluster of Streptomyces milbemycinicus.

[0005] The genetically engineered Streptomyces involved in the present invention is named Streptomyces avermitilis HU501-M was deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 2025823 and the deposit date was April 18, 2025.

[0006] The present invention also provides a method for constructing the genetically engineered Streptomyces, comprising: constructing a milA3 Cas9 knock-in vector; and introducing the milA3 Cas9 knock-in vector into Streptomyces avermitilis that produces the ivermectin B1b compound via conjugative transfer using Escherichia coli ET12567 (pUZ8002), such that the aveA3 fragment in the ivermectin B1b-producing Streptomyces avermitilis gene cluster is replaced with the milA3 fragment in the Streptomyces hygroscopicus gene cluster. The milA3 Cas9 knock-in vector comprises the sgRNA sequences shown in SEQ ID NOs: 1 to 18.

[0007] The present invention also relates to the use of the genetically engineered Streptomyces, which can be used to prepare a milbemycin D compound, comprising the steps of performing aerobic liquid submerged fermentation of the genetically engineered Streptomyces in a culture medium containing assimilable carbon and nitrogen sources.

[0008] Preferably, the assimilable carbon source in the above-mentioned culture medium is selected from one of starch, soluble starch, maltodextrin, sucrose, glucose, sorbitol, mannitol, maltose, lactose, galactose, fructose, or a combination of the above-mentioned substances; preferably, the assimilable nitrogen source in the above-mentioned culture medium is selected from one of soybean cake powder, soybean flour, peanut cake powder, malt extract, peptone, yeast powder, yeast extract, beef extract, yeast extract, corn steep liquor powder, gluten powder, or a combination of the above-mentioned substances; the temperature of the aerobic liquid submerged fermentation is 20-35°C, preferably 28-30°C; the pH is 5.0-8.0, preferably 7.0; and the fermentation time is 120-240 hours.

[0009] The present invention also provides the use of milbemycin D in preventing and controlling pine wood nematodes and gypsy moths.

[0010] The main fermentation product of the genetically engineered Streptomyces of the present invention is milbemycin D, which shows good prospects for industrial development. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 HPLC chromatogram of fermentation products of strain Streptomyces avermitilis HU501

[0012] Figure 2 High-resolution mass spectrometry of the main product peak of the fermentation of strain Streptomyces avermitilis HU501;

[0013] Figure 3 The structure of the Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3;

[0014] Figure 4Flowchart for the construction of the Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3;

[0015] Figure 5 Enzyme digestion verification diagram of Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3;

[0016] Figure 6 PCR verification of the conjugant strain with the milA3 fragment knocked in;

[0017] Figure 7 The gene segment replacement process of the zygote strain;

[0018] Figure 8 HPLC profile of the fermentation product of the conjugant strain with the milA3 fragment knocked in;

[0019] Figure 9 High-resolution mass spectrum of the main fermentation product peak of the knock-in milA3 fragment conjugant strain;

[0020] Figure 10 The pure product of Milbemycin D prepared in Example 6 of the present invention 1 H-NMR spectrum;

[0021] Figure 11 The pure product of Milbemycin D prepared in Example 6 of the present invention 13 C-NMR spectrum;

[0022] Figure 12 DEPT135 spectrum of pure milbemycin D prepared in Example 6 of the present invention DETAILED DESCRIPTION

[0023] Example 1

[0024] Obtaining the starting strain Streptomyces avermitilis HU501 (CCTCC NO: M 2025824)

[0025] The Streptomyces avermitilis HU501 of the present invention is obtained by multi-round mutagenesis breeding based on the avermectin-producing bacterium Streptomyces avermitilis (ATCC No. 31267) through single or combined mutagenesis using ultraviolet (UV), atmospheric pressure room temperature plasma (ARTP), and ethyl methanesulfonate (EMS).

[0026] After culturing the avermectin-producing strain in ISP2 or ISP3 slant medium at 28°C for 8 to 10 days, the spores were scraped off under sterile conditions and a spore suspension was prepared. The concentration was adjusted to 10 7 The cells were mutagenized using ultraviolet light, atmospheric pressure room temperature plasma, and ethyl methanesulfonate.

[0027] UV mutagenesis: 1 mL of spore suspension was applied to a sterile 9 cm culture dish and irradiated with a 30 W UV lamp at a wavelength of 254 nm at a distance of 20 cm from the liquid surface for 40, 60, and 80 seconds, then irradiated with red light and diluted with physiological saline to 10 -4 , 10 -5 , 10 -6 , respectively, spread ISP2 plates, put them into stainless steel barrels for dark culture, and culture at 28℃ for 8 days, and then select mutant colonies.

[0028] ARTP mutagenesis: 25 μL of spore suspension was taken and applied to a slide. The air flow rate was set to 10 SLM, the incident power was 100 W, and the outlet spacing was 2 mm. After treatment for 30, 40, 50, and 60 s, the spore suspension was diluted to 10 with sterile water. -4 , 10 -5 , 10 -6 , respectively, and ISP2 plates were plated. After culturing at 28°C for 8 days, mutant colonies were selected.

[0029] EMS mutagenesis: Dissolve 1 mL of ethyl methanesulfonate in 2 mL of anhydrous ethanol, then add 22 mL of phosphate buffer (pH 7.2). Place 2 mL of the spore suspension in a sterile test tube and add 4.0% ethyl methanesulfonate solution to achieve final concentrations of 2.0%, 3.0%, and 4.0%. Shake at 150 rpm for 30 minutes, then add 10 mL of 5% sodium thiosulfate to terminate the reaction. Dilute the mixture sequentially with physiological saline and sterile water to 10% -4 , 10 -5 , 10 -6 , respectively, spread on ISP2 plates, culture at 28°C for 8 days, and then select mutant colonies.

[0030] Combined mutagenesis: Select two or more of the above mutagenesis methods and continuously treat the spore suspension for mutagenesis.

[0031] For each batch, no less than 100 strains of the above-mentioned single or combined mutagenized single colonies were selected, and after expansion, spores were scraped and fermented in shake flasks. Fermentation medium: corn starch 100g / L, amylase 0.2g / L, glucose 10g / L, yeast powder 10g / L, soybean powder 20g / L, distilled water 1L, CaCO3 3g / L, pH 7.0. 30mL was filled in a 250 shake flask, and the fermentation culture was terminated after 10 days at 28°C and 250rpm. 1mL of fermentation liquid was taken, 3mL of methanol was added, and ultrasonication was performed for 30min, then filtered with filter paper, and the filtrate was analyzed by HPLC to select strains that can produce high-yield Ivermectin B1b (molecular formula: C 47 H 72 O 14 ) strains. HPLC analysis conditions were as follows: column Agilent ZORBAXX DB-C18 (4.6×250 mm id, 5 μm); mobile phase: methanol:acetonitrile:water = 81:7:12; flow rate 1 mL / min; absorption wavelength 240 nm; injection volume 10 μL.

[0032] After multiple rounds of mutagenesis, mutant strains were obtained Streptomyces avermitilis HU501, the yield of Ivermectin with B1b exceeds 900 μg / mL, the HPLC spectrum is shown in Figure 1 The high-resolution LC / MS spectrum of the main product peak is shown in Figure 2 . strain Streptomyces avermitilis HU501 was deposited in the China Center for Type Culture Collection (Address: Wuhan University Collection Center, Wuhan University, Wuhan, China), with the deposit number being CCTCC NO: M 2025824 and the deposit date being April 18, 2025.

[0033] Example 2

[0034] Construction of Cas9 knock-in vector plasmid for Streptomyces hygroscopicus milA3 fragment

[0035] In this embodiment, the Cas9 knock-in vector plasmid of the milA3 fragment of Streptomyces hygroscopicus is named pKC1139-Cas9-spacer-AA3UD-MA3. The vector contains the upstream and downstream fragments of the aveA3 fragment of Streptomyces avermitilis, namely aveA3-UP and aveA3-DOWN, as well as the milA3 fragment of Streptomyces hygroscopicus. The aveA3-UP sequence is shown in SEQ ID NO.19, the milA3 sequence is shown in SEQ ID NO.20, and the aveA3-DOWN sequence is shown in SEQ ID NO.21. Plasmid pKC1139-Cas9-spacer-AA3UD-MA3, plasmid structure is shown in Figure 3This plasmid consists of 35,842 bases, with sgRNA sequences at positions 297-316, Cas9 protein sequences at positions 477-4580, EcoRI restriction sites at positions 6504-6510, aveA3 upstream homology arms at positions 6511-9197, milA3 sequences at positions 9198-26678, aveA3 downstream homology arms at positions 26679-29654, and apramycin resistance gene fragment at positions 30857-31657. The spacer in this invention refers to the sgRNA.

[0036] The construction process of pKC1139-Cas9-spacer-AA3UD-MA3 is shown in Figure 4 , the specific steps are as follows:

[0037] (1) The original vector plasmid is named pKC1139-Cas9. The aveA3 fragment sequence of Streptomyces avermitilis was used as the target. The available sgRNA sequences were designed as shown in SEQ ID NO: 1 to SEQ ID NO: 18. The pKC1139-Cas9 plasmid was constructed using the selected sequence: SEQ ID NO: 1 as an example.

[0038] (2) Design primer sequences (Forward: SEQ ID NO: 22, Reverse: SEQ ID NO: 23), and then amplify the fragment containing the sgRNA sequence using pKC1139-Cas9 as a template through primers;

[0039] (2) The pKC1139-Cas9 plasmid was digested with XbaI and NheI restriction endonucleases to recover the large fragment, and the recovered large fragment was connected with the fragment of the sgRNA sequence contained in step (1) by seamless cloning to obtain the plasmid pKC1139-Cas9-spacer;

[0040] (3) Design primers for amplifying the upstream and downstream homology arms of Streptomyces avermitilis aveA3, and amplify the Streptomyces avermitilis HU501 as a template. The upstream homology arm amplification primers are: Forward see SEQ ID NO: 24, Reverse see SEQ ID NO: 25; the downstream homology arm amplification primers are Forward: SEQ ID NO: 26, Reverse see SEQ ID NO: 27; the plasmid pKC1139-Cas9-spacer is digested with EcoRI restriction enzyme, and the upstream and downstream homology arms of aveA3 are inserted into the plasmid pKC1139-Cas9-spacer by seamless cloning to obtain the plasmid pKC1139-Cas9-spacer-AA3UD, which is then verified by enzyme digestion and the correct plasmid is extracted;

[0041] (4) The milA3 gene sequence of Streptomyces hygroscopicus was searched in the NCBI database and divided into four segments of similar size (4635 bp + 3611 bp + 4123 bp + 5112 bp). The relevant fragments were obtained by large-fragment gene synthesis, and NdeI restriction enzyme sites were added to the homology arms of the first and fourth fragments. The plasmid pKC1139-Cas9-spacer-AA3UD was digested with restriction endonuclease NdeI, and the first and fourth fragments of milA3 were ligated with the restriction endonuclease by seamless cloning. The plasmid was then connected to obtain the plasmid pKC1139-Cas9-spacer-AA3UD-MA3part, and enzyme digestion was performed to verify the correct plasmid. The plasmid pKC1139-Cas9-spacer-AA3UD-MA3part was digested with the restriction endonuclease NdeI, and the second and third fragments of milA3 were seamlessly cloned and connected with the digested plasmid to obtain the plasmid pKC1139-Cas9-spacer-AA3UD-MA3. EcoRV and XbaI were used to verify the enzyme digestion of the plasmid pKC1139-Cas9-spacer-AA3UD-MA3. The results are shown in Figure 5 The enzyme digestion yielded four expected fragments of 5799 bp, 6599 bp, 11216 bp, and 12092 bp in size. Lane 1 was consistent with expectations. The plasmid in lane 1 was further sequenced, and the results showed that it was consistent with the target sequence, indicating that the plasmid pKC1139-Cas9-spacer-AA3UD-MA3 was successfully constructed.

[0042] Example 3

[0043] The Cas9 knock-in vector plasmid of the milA3 fragment of Streptomyces hygroscopicus was introduced into Streptomyces avermitilis HU501 to obtain the conjugative strain

[0044] Plasmid pKC1139-Cas9-spacer-AA3UD-MA3 was introduced into the starting bacterium Streptomyces avermitilis HU501 by conjugation transfer of Escherichia coli ET12567 (pUZ8002), as follows.

[0045] (1) The pKC1139-Cas9-spacer-AA3UD-MA3 expression vector was transformed into the demethylated starting Escherichia coli E. coli ET12567 (pUZ8002) by heat shock method to obtain the recombinant bacteria E. coli ET12567 / pUZ8002 / pKC1139-Cas9-spacer-AA3UD-MA3.

[0046] (2) E. coli ET12567 / pUZ8002 / pKC1139-Cas9-spacer-AA3UD-MA3 was inoculated into 50 mL LB liquid medium (containing chloramphenicol, kanamycin, and apramycin), cultured at 37°C until OD600 reached 0.6, centrifuged at 4000 rpm for 10 min to collect the cells, washed twice with 30 mL LB liquid medium, and resuspended with 2 mL LB liquid medium; Streptomyces avermitilis HU501 was streaked on YMS solid medium (0.4% yeast extract, 0.4% soluble starch, 1% malt extract, 0.0005% CoCl·6H2O, 1.5% agar, pH 7.2), cultured at 30°C for 5-7 days, and the surface spores were scraped off with a steel stick into sterile water to prepare a spore suspension. 2×YT liquid medium (1.6% tryptone, 1.0% yeast extract, NaCl The cells were washed twice with 0.5% (0.5%), heat-shocked in a 50°C water bath for 10 min, cooled, mixed with the above-mentioned E. coli, and evenly spread on MS solid medium (2% mannitol, 2% soybean meal, 2% agar, and the remainder water; percentages are by weight, 10 mM MgCl2, pH natural), incubated at 30°C for 20 h, and then added with 25 μg / mL nalidixic acid and 50 μg / mL apramycin. The cells were further incubated at 30°C for 5-7 days. The transformants obtained above were cultured on YMS solid medium containing apramycin for 5-7 days, then cultured on antibiotic-free YMS solid medium at 37°C for 2 days, and then transferred to 30°C for 3-5 days. A small amount of cells were then scraped with a toothpick into a PCR tube, 50 μl of sterile water was added, and the cells were heated at 95°C for 10 min in a PCR instrument. The cells were then transferred to a -80°C ultra-low temperature freezer for 5 min and thawed naturally to obtain a crude total DNA extract. Using primers Forward (SEQ ID NO: 28) and Reverse (SEQ ID NO: 29), a 3074 bp fragment of milA3 was amplified by PCR to confirm that the target DNA sequence had been incorporated into Streptomyces avermitilis HU501. Figure 6 , where lanes 1 and 2 have target size bands, indicating that the milA3 fragment has been integrated, and the strain is the target conjugant strain. The gene fragment replacement process of the conjugant strain is as follows Figure 7 As shown, the aveA3 fragment in its gene cluster was replaced by the milA3 fragment of Streptomyces hygroscopicus.

[0047] Example 4

[0048] Fermentation and detection of zygote strains

[0049] The spores of the zygote strain obtained in Example 3 were inoculated on YMS solid culture medium and cultured at 28° C. for 6-10 days. Shake flask fermentation was carried out according to the following steps, and the fermentation products were detected.

[0050] (1) Preparation of seed solution

[0051] Seed culture medium recipe: 250g / L corn starch, 10g / L glucose, 12g / L yeast extract powder, 20g / L soybean meal, 1L distilled water, 3g / L CaCO₃, pH 7.0, 1000mL purified water, pH 6.8-7.0 before sterilization. Fill 250mL / 1000mL in a shake flask and sterilize at 121°C for 20 minutes. Spores from a 10-day-old plate were scraped and inoculated into the seed culture medium. Four flasks were incubated at 28°C, 200 rpm, and incubated for 40-48 hours to obtain the seed solution.

[0052] (2) Fermentation culture

[0053] Fermentation medium recipe: 60g corn soluble starch, 20g glucose, 20g fried soybean meal, 20g cottonseed meal, 2g light calcium carbonate, 2g sodium chloride, 2g magnesium sulfate heptahydrate, 1000mL tap water, pH 7.0 before sterilization. Fill 250mL / 1000mL in a shake flask and sterilize at 121°C for 20 minutes. Inoculate the seed solution at a volume ratio of 2-10% (volume ratio). Prepare a total of 20L of fermentation broth, shake culture at 28°C, 200rpm for 180-240 hours, and then complete the fermentation.

[0054] (3) Detection of fermentation products

[0055] Take 2 mL of fermentation broth and add 6 mL of ethanol. After thorough shaking, sonicate for 30 minutes. Filter with filter paper and transfer 1 mL of the filtrate to a sample bottle for HPLC analysis. HPLC conditions: Column: C8 column (ODS2, 5 μm, 200 × 4.6 mm id); Detection wavelength: 240 nm; Flow rate: 1.00 mL / min; Injection volume: 10 μl; Mobile phase: acetonitrile:methanol:water = 65:23:12. A typical HPLC spectrum is shown in the figure. Figure 8The high-resolution LC / MS spectrum of the main C product peak is shown in Figure 9 The molecular weight of the product was 556 (m / z 579.3304 [M+Na] + ), the chemical formula is calculated as C 33 H 48 O7, consistent with milbemycin D.

[0056] The strain was named Streptomyces avermitilis HU501-M, which was deposited in the China Center for Type Culture Collection (Address: Wuhan University Collection Center, Wuhan University, Wuhan, China), with the deposit number CCTCC NO: M2025823 and the deposit date of April 18, 2025.

[0057] Example 5

[0058] Preparation of fermentation broth containing milbemycin D compound using genetically engineered Streptomyces avermitilis HU501-M (CCTCC NO: M2025823)

[0059] (1) Preparation of plate colonies and seed solution is shown in Example 4.

[0060] (2) Preparation of seed solution in seed tank

[0061] 8 L of seed culture medium (same as in Example 4) was placed in a 15 L seed tank and sterilized by steam at 121°C for 30 min. After cooling to 30°C, 500 mL of seed solution from a primary shake flask was added. The mixture was stirred at 200 rpm, aerated at 0.5 vvm, and incubated at 28°C for 48 hours to obtain the seed solution.

[0062] (3) Preparation of fermentation broth in fermenter

[0063] The formula of the fermentation medium is the same as that of Example 4, with the addition of 1% defoamer. The fermentor tank volume is 50 L, the feeding volume is 30 L, and the mixture is steam sterilized at 121°C for 30 min. After cooling to 30°C, 2 L of seed solution is added to the seed tank. The initial stirring speed is 150 rpm, which is adjusted according to the dissolved oxygen (controlling the dissolved oxygen to be not less than 5%), and the maximum speed is no more than 400 rpm. The ventilation rate is 0.5.0-3.0 vvm (adjusting the speed according to the dissolved oxygen to control the dissolved oxygen to be not less than 30%). The mixture is fermented in a submerged state at 28°C for 240 hours, and then the fermentation is terminated and the fermentation is released. The milbemycin D in the fermentation broth is detected by the HPLC method described in Example 4.

[0064] Example 6

[0065] Extraction of Milbemycin D Compound from Fermentation Broth

[0066] The fermentation broth obtained in Example 5 was centrifuged at 4500 rpm for 15 minutes to obtain mycelia, which was then soaked in 5 L of ethanol and sonicated for 30 minutes. The ethanol extract was filtered to obtain an ethanol extract. The ethanol extract was vacuum concentrated at 50°C to approximately 1 L, and then extracted three times with an equal volume of ethyl acetate to obtain an ethyl acetate extract. The combined extracts were concentrated to dryness under reduced pressure at 50°C to obtain 25 g of an oily substance. The resulting oily substance was dissolved in 100 mL of a 1:1 solution of dichloromethane and methanol, shaken on silica gel, and chromatographed on a silica gel column using a gradient elution of petroleum ether:ethyl acetate (95:5-60:40). Thin layer chromatography was used for detection, and the development conditions were petroleum ether:ethyl acetate (2:1). Three fractions (Fr. 1-3) were combined based on UV absorption. Component Fr.2 was further purified by HPLC (chromatographic column: Zorbax XDB-C18, 5 μm, 250×9.4 mm id) with mobile phase MeOH:H2O=95:5; detection wavelength 240 nm; flow rate 1.5 mL / min) to obtain compound milbemycin D (18 mg, t R The obtained pure milbemycin D was detected by high resolution mass spectrometry (HRESIMS) and nuclear magnetic resonance spectroscopy (NMR). 1 HNMR, 13 C NMR and DEPT135 spectra (400 MHz, CDCl3) Figures 10 to 12 The NMR data are shown in Table 1. The structure of milbemycin D was determined as shown in Formula (I) based on the literature (Hi'ro'shi Mishima, Junya Ide, Shigeki Muramatsu. et al. Milbemycins, a new family of macrolide antibiotics. Structure determination of milbemycins D, E, F, G, H, J and K. JAntibiot, 1983, 36(8): 980-90.).

[0067] Table 1 NMR data of milbemycin D obtained in Example 6

[0068]

[0069]

[0070] Example 7

[0071] Insecticidal activity test of milbemycin D compounds

[0072] (1) Nematicidal activity test

[0073] Weigh 100 mg of milbemycin D and dissolve it in 5 mL of DMSO to prepare a stock solution. Dilute it to 20, 50, 100, 250, and 500 mg / L of the drug solution for later use. Set the same concentration of the control agents milbemycin A3 and A4, and set a blank control treatment at the same time. Using the immersion method, prepare a suspension of about 2500 heads / mL (water) of 3-year-old pine wood nematodes / pseudopine wood nematodes for later use. Mix 900 μL of the pine wood nematode suspension with 100 μL of the drug solution for immersion. Repeat 3 times for each concentration and culture in a constant temperature box at 25 ° C. After 24 hours, count the number of survivors and deaths of pine wood nematodes, and calculate the corrected mortality rate and lethal median concentration LC. 50 The results showed that the lethal concentration of milbemycin D to pine wood nematode / Pinus xylophilus was 50 The concentrations of milbemycin A3 and A4 were 10.5 mg / L and 14.7 mg / L respectively, which were lower than the lethal concentrations of milbemycin A3 and A4 to pine wood nematodes and pseudopine wood nematodes. 50 The values are 15.5mg / L, 17.7mg / L and 14.3mg / L, 16.5mg / L respectively.

[0074] (2) Test on the activity of killing American white moth

[0075] Using fourth-instar larvae as test insects, solutions of milbemycin A3, A4, and D were prepared at 1, 2, 5, 10, and 20 mg / L, respectively. Mulberry leaves were cut into 7 cm x 7 cm squares and immersed in the various concentrations of the solutions for 15 seconds. The leaves were then removed and air-dried. The squares were then placed in Petri dishes lined with moistened filter paper. Fifteen fourth-instar larvae, starved for 12 hours, were placed in each dish. After 24 hours, fresh mulberry leaves were replaced with fresh mulberry leaves. The experiment was repeated three times, with a blank control. Larvae were incubated at 25°C, and feeding was observed and recorded. Mortalities were counted after 48 hours. Results showed that 20 mg / L milbemycin D had a mortality rate of 86.7% for fourth-instar larvae, while both milbemycins A3 and A4 had a mortality rate of 80%.

[0076] Sequence Listing

[0077] SEQ ID NO: 1

[0078] GGATTGTTGCGTGTGATGTG

[0079] SEQ ID NO:2

[0080] CCTTGCTGACGAGTTGTGTG

[0081] SEQ ID NO:3

[0082] GCCACATCGACAGATCATCG

[0083] SEQ ID NO:4<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0084] <h2 style=";text-align:left;direction:ltr"> TCGACAGATCATCGTGGCTA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0085] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:5<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0086] <h2 style=";text-align:left;direction:ltr"> TTTGATCGTAAGCCGTGTTC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0087] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:6<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0088] <h2 style=";text-align:left;direction:ltr"> CAGGAATGACCAACGGTGTG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0089] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:7<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0090] <h2 style=";text-align:left;direction:ltr"> GTGTGCTTTCGAGCCAGTAG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0091] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:8<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0092] <h2 style=";text-align:left;direction:ltr"> GTAGAGGAAACTCCCACAGC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0093] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:9<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0094] <h2 style=";text-align:left;direction:ltr"> CACAGTGAGTTGCTCGATTC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0095] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:10<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0096] <h2 style=";text-align:left;direction:ltr"> CCACATTGGAACTGGCCGAA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0097] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:11<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0098] <h2 style=";text-align:left;direction:ltr"> CACACCGTTGGTCATTCCTG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0099] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:12<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0100] <h2 style=";text-align:left;direction:ltr"> GCTTATGGCCTGGCATTCCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0101] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:13<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0102] <h2 style=";text-align:left;direction:ltr"> CTTATGGCCTGGCATTCCAA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0103] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0104] <h2 style=";text-align:left;direction:ltr"> TCGCTGTGCTGATGAGGAAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0105] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:15<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0106] <h2 style=";text-align:left;direction:ltr"> TATGGCGACTACGAGGCAAA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0107] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:16

[0108] GAGGCAAATGGCTTTGTCTA

[0109] SEQ ID NO:18

[0110] CACACACAACTCGTCAGCAA

[0111] SEQ ID NO.19

[0112]

[0113] SEQ ID NO.20

[0114]

[0115] SEQ ID NO.21

[0116]

[0117] SEQ ID NO:22

[0118] GCTATTTCTAGCTCTAAAACGGATTGTTGCGTGTGATGTGGCTGGATCCTAC

[0119] CAACCG

[0120] SEQ ID NO:23

[0121] GCGGCGACCACCACCACCAC

[0122] SEQ ID NO:24

[0123] CTCTTGATCCCCATCGAATTCCGAAACCGGACACACCACA

[0124] SEQ ID NO:25

[0125] TTGAATTTGGGAGACAGTGCATATGAGCCCAGAAACCACTCCGA

[0126] SEQ ID NO:26

[0127] CACTGTCTCCCAAATTCAAGAAGTC

[0128] SEQ ID NO:27

[0129] ACAGCTATGACATGATTACTACCACGACCACCTCTTCCG

[0130] SEQ ID NO:28

[0131] CCCTCGGTCTGCTCCCAAACTCCCCAG

[0132] SEQ ID NO:29

[0133] CTGGACCCACACCTCGACCATCCCCTG。

Claims

1. A genetically engineered Streptomyces, characterized in that: The genetically engineered Streptomyces is an engineered bacterium obtained by replacing the aveA3 fragment in the gene cluster of Streptomyces avermitilis that can produce the ivermectin B1b compound with the milA3 fragment in the gene cluster of Streptomyces milbemycinicus.

2. The genetically engineered Streptomyces according to claim 1, wherein The genetically engineered Streptomyces was named Streptomyces avermitilis HU501-M, deposited in China Center for Type Culture Collection, with the deposit number CCTCCNO: M 2025823 and the deposit date of April 18, 2025.

3. A method for constructing a genetically engineered Streptomyces according to any one of claims 1 to 2, characterized in that: include: Construction of milA3 Cas9 knock-in vector; The milA3 Cas9 knock-in vector was introduced into the ivermectin B1b-producing Streptomyces avermitilis by conjugative transfer via Escherichia coli ET12567 (pUZ8002), so that the aveA3 fragment in the ivermectin B1b-producing Streptomyces avermitilis was replaced by the milA3 fragment in the Streptomyces hygroscopicus gene cluster.

4. A method for constructing a genetically engineered Streptomyces according to claim 3, characterized in that: The Cas9 knock-in vector of milA3 contains sgRNA sequences shown as SEQ ID NO: 1 to SEQ ID NO:

18.

5. A use of the genetically engineered Streptomyces as claimed in claims 1 to 2, characterized in that: The genetically engineered Streptomyces according to claims 1 to 2 can be used to prepare milbemycin D, the structure of which is shown in the following formula (I).

6. A use of the genetically engineered Streptomyces according to claim 5, characterized in that: The method comprises the steps of performing aerobic liquid submerged fermentation of the genetically engineered Streptomyces as claimed in claims 1 to 2 in a culture medium containing assimilable carbon and nitrogen sources.

7. A use of the genetically engineered Streptomyces according to claim 6, characterized in that: The assimilable carbon source in the culture medium is selected from starch, soluble starch, maltodextrin, sucrose, glucose, sorbitol, mannitol, maltose, lactose, galactose, fructose or a combination thereof.

8. The use of the genetically engineered Streptomyces according to claim 6, characterized in that: The assimilable nitrogen source in the culture medium is selected from soybean cake powder, soybean flour, peanut cake powder, malt extract, peptone, yeast powder, yeast extract, beef extract, yeast extract, corn steep liquor powder, gluten powder, or a combination of the above substances.

9. The use of the genetically engineered Streptomyces according to claim 6, characterized in that: The temperature of the aerobic liquid submerged fermentation is 20-35° C., preferably 28-30° C.; the pH is 5.0-8.0, preferably 7.0; and the fermentation time is 120-240 hours.