Attenuated and broad-spectrum porcine epidemic diarrhea virus recombinant strain independent of pancreatin as well as construction method and application of attenuated and broad-spectrum porcine epidemic diarrhea virus recombinant strain

The S protein of the PEDV variant was replaced by the CRISPR/Cas9 system to construct an attenuated, broad-spectrum porcine epidemic diarrhea virus recombinant strain, which solved the problem of exogenous protease dependence, achieved efficient virus proliferation and broad-spectrum immune protection effects, and supported vaccine development.

CN120424892APending Publication Date: 2025-08-05JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510576769.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Cell culture of existing pig epidemic diarrhea virus mutant strains requires exogenous addition of protease, which increases the cost and difficulty of virus culture. The vaccines prepared by classical strains have poor cross-protection for mutant strains, which limits basic research and vaccine development.

Method used

The amino acids 894-993 of the S protein of the swine epidemic diarrhea virus variant AH2012/12 were replaced by the CRISPR/Cas9 system as the corresponding sequence of the classic strain JS2008, and a recombinant strain that was attenuated, broad-spectrum and non-titrosin-dependent pancreatic enzyme were constructed, and the recombinant virus was rescued in Vero cells using homologous recombination technology.

Benefits of technology

It has achieved the improvement of viral proliferation titer without relying on pancreatic enzymes, significantly attenuated, and can induce high-level neutralizing antibodies against PEDV classical and mutant strains, providing a scientific basis and theoretical basis for vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424892A_ABST
    Figure CN120424892A_ABST
Patent Text Reader

Abstract

The invention discloses an attenuated, broad-spectrum and pancreatin-independent porcine epidemic diarrhea virus recombinant strain as well as a construction method and application thereof, and belongs to the technical field of animal virology and genetic engineering. According to the present invention, the 894-993 site amino acid sequence of the PEDV AH2012 / 12 variant strain S protein is transformed into the 894-993 site amino acid sequence of the JS2008 classical strain S protein through the CRISPR / Cas9 system and the homologous recombination method, and the recombinant virus rAH2012 / 12-894-993aaJS2008 is obtained through the rescue; compared with a parent virus AH2012 / 12, the recombinant virus rAH2012 / 12-894-993aaJS2008 has the advantages that the proliferation titer in cells is obviously improved, the toxicity is highly weakened, a cross-protective neutralizing antibody aiming at the G1 type and the G2 type of the PEDV can be induced, and the virus strain can be used for fundamental research and vaccine research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal virology and genetic engineering, and in particular to an attenuated, broad-spectrum, and pancreatic enzyme-independent porcine epidemic diarrhea virus recombinant strain, and a construction method and application thereof. Background Art

[0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric disease of pigs caused by the porcine epidemic diarrhea virus (PEDV). Clinically characterized by acute diarrhea, vomiting, and dehydration in piglets, PED leads to a high mortality rate. PED was first reported in the United Kingdom in 1971 and subsequently spread to other countries. In 2010, a PED outbreak was primarily caused by a variant strain of PEDV. Significant differences in the replicase and S genes between the classical strain (G1) and the variant strain (G2) have been found. Vaccines prepared with the classical strain offer poor cross-protection against PEDV variants. Therefore, the development of highly effective vaccines against PEDV variants is urgently needed.

[0003] During the cell culture process of PEDV variants, exogenous proteases are required to promote viral proliferation. Porcine pancreatic enzymes are usually added. Studies have also shown that type II serine protease (TTSP) has catalytic activity similar to pancreatic enzymes. Transmembrane serine protease (TMPRSS2) and large mosaic serine protease (MSPL) can also promote the proliferation of PEDV strains in Vero cells. However, the exogenous addition of proteases requires purification of the relevant proteases and exploration of cell tolerance, which increases the cost and difficulty of virus culture and limits basic research and vaccine development of PEDV variants. Reports show that cell culture of PEDV classic strains does not require exogenous addition of pancreatic enzymes. Some scholars have changed the pancreatic enzyme dependence of the variant strain by replacing the S2 subunit and S2' subunit of the classic strain. However, the replacement fragment in the S2 gene region of the developed recombinant strain is longer, and there are neutralizing antigenic epitopes on the S2 gene, which may affect the immunogenicity and pathogenicity of the variant strain.

[0004] The CRISPR / Cas9 system can efficiently edit biological genomes or plasmids. In recent years, it has been widely used to construct viral-infectious cloned plasmids. Specific guide RNA (sgRNA) prepared in vitro directs the Cas9 protein to cleave the target gene, then repairs the DNA through homologous recombination, achieving site-directed mutagenesis of the viral-infectious cloned plasmid. The resulting recombinant viral plasmid can be transfected into virus-sensitive cell lines to rescue the recombinant virus. This system allows for precise editing of viral strains and is characterized by ease of operation and high efficiency. Summary of the Invention

[0005] The purpose of the present invention is to provide a recombinant strain of porcine epidemic diarrhea virus that is attenuated, broad-spectrum and independent of pancreatic enzymes, and a construction method and application thereof, in order to solve the problems existing in the above-mentioned prior art. By replacing the 894-993 amino acids of the S protein of the porcine epidemic diarrhea variant strain AH2012 / 12, a recombinant strain of porcine epidemic diarrhea virus is constructed. The recombinant strain is significantly attenuated and can provide immune protection to pigs, providing a basis for the research and development of porcine epidemic diarrhea virus vaccines.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an attenuated, broad-spectrum, and pancreatic enzyme-independent recombinant strain of porcine epidemic diarrhea virus. The attenuated, broad-spectrum, and pancreatic enzyme-independent recombinant strain of porcine epidemic diarrhea virus is obtained by replacing the 894-993 amino acids of the S protein of the PEDV AH2012 / 12 strain with the 894-993 amino acids of the S protein of the PEDV JS2008 strain, and rescuing the virus.

[0008] Preferably, the genome accession number of the PEDV AH2012 / 12 strain on NCBI is KU646831.1, and the genome accession number of the PEDV JS2008 strain on NCBI is KC109141.1.

[0009] The present invention also provides a method for constructing the attenuated, broad-spectrum, and pancreatic enzyme-independent recombinant strain of porcine epidemic diarrhea virus, comprising the following steps:

[0010] (1) Designed and synthesized specific upstream and downstream sgRNA primers targeting amino acids 894-993 of the S protein of the PEDVAH2012 / 12 strain, and amplified the sgRNA tracrRNA sequence by extension PCR using scaffold oligo to obtain in vitro transcription templates of sgRNA-894-993aa F and sgRNA-894-993aa R, which were then transcribed in vitro to obtain sgRNA-894-993aaF and sgRNA-894-993aaR;

[0011] (2) The plasmid pBAC-AH2012 / 12 containing the full-length cDNA sequence of the PEDV AH2012 / 12 strain was cut using the CRISPR / Cas9 system to obtain the linearized pBAC-AH2012 / 12 plasmid;

[0012] (3) Clone the gene sequence encoding amino acids 894-993 of the S protein of the PEDV JS2008 strain (the gene sequence fragment has 20 bp homology arms upstream and downstream of the linearized plasmid in step (2)), and perform homologous recombination with the linearized pBAC-AH2012 / 12 plasmid. Then, the homologous recombination product is transformed into competent cells, and the plasmid is extracted from the positive clones with correct sequencing by PCR screening and sequencing to obtain pBAC-AH2012 / 12-894-993aa. JS2008 Recombinant plasmid;

[0013] (4) The pBAC-AH2012 / 12-894-993aa JS2008 The recombinant plasmid was transfected into Vero cells, and the attenuated, broad-spectrum and trypsin-independent porcine epidemic diarrhea virus recombinant strain was obtained through virus rescue.

[0014] Optionally, the nucleotide sequences of the upstream and downstream sgRNA primers are shown in SEQ ID NO: 1-2, and the sequence of the scaffold oligo is shown in SEQ ID NO: 3.

[0015] Optionally, the gene sequence encoding amino acids 894-993 of the S protein of the PEDV JS2008 strain is shown in SEQ ID NO: 6.

[0016] The present invention also provides the use of the attenuated, broad-spectrum and pancreatic enzyme-independent porcine epidemic diarrhea virus recombinant strain in the preparation of an attenuated porcine epidemic diarrhea vaccine.

[0017] Optionally, the porcine epidemic diarrhea attenuated vaccine is an inactivated vaccine.

[0018] The present invention also provides an attenuated porcine epidemic diarrhea vaccine, which contains the porcine epidemic diarrhea virus recombinant strain.

[0019] Optionally, the attenuated porcine epidemic diarrhea vaccine further comprises an adjuvant.

[0020] The present invention discloses the following technical effects:

[0021] (1) The present invention obtains the pancreatic enzyme-independent rAH2012 / 12-894-993aa by comparing the S2 gene of the PEDV classic strain and variant strain and screening in advance, based on the PEDV AH2012 / 12 infectious clone backbone, replacing only the 300bp minimum gene fragment 894-993aa. JS2008 The variant recombinant strain does not require exogenous addition of trypsin in cell culture and has a higher proliferation titer than the parent strain AH2012 / 12, providing a scientific basis for the exploration of PEDV trypsin-independent sites and other basic research.

[0022] (2) rAH2012 / 12-894-993aa constructed by the present invention JS2008 The recombinant strain is significantly attenuated and can simultaneously induce high levels of neutralizing antibodies against both classical and variant PEDV strains, providing a theoretical basis for the development of PEDV antiviral drugs and highly effective vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 pBAC-AH2012 / 12-894-993aa JS2008 Schematic diagram of recombinant plasmid construction;

[0025] Figure 2 sgRNA and 894-993aa JS2008 Electrophoresis of replacement fragment amplification; 1: DL2000 DNA Marker; 2, 3: sgRNA-F, sgRNA-R amplification products; 4: 894-993aa JS2008 Replacement fragment amplification product;

[0026] Figure 3 Electrophoresis diagram of pBAC-AH2012 / 12 in vitro cleavage; 1: 1kb DNA Marker; 2: pBAC-AH2012 / 12 plasmid Cas9 digestion product;

[0027] Figure 4 pBAC-AH2012 / 12-894-993aa JS2008 Bacterial liquid identification and sequencing; A: 1: DL2000 DNA Marker; 2-9: Amplification products of the bacterial liquid sample to be identified; 10: Amplification products of the negative control; B: Sequencing results of the amplification products of the positive bacterial liquid;

[0028] Figure 5 AH2012 / 12, JS2008 parental virus and rAH2012 / 12-894-993aa JS2008 Observation results of cytopathic effects of recombinant virus under different culture conditions;

[0029] Figure 6 AH2012 / 12, JS2008 parental virus and rAH2012 / 12-894-993aa JS2008Sequencing identification results of recombinant toxin;

[0030] Figure 7 AH2012 / 12, JS2008 parental virus and rAH2012 / 12-894-993aa JS2008 Indirect immunofluorescence identification results of recombinant virus under different culture conditions;

[0031] Figure 8 AH2012 / 12, JS2008 parental virus and rAH2012 / 12-894-993aa JS2008 Growth curve of recombinant virus;

[0032] Figure 9 AH2012 / 12, JS2008 parental virus and rAH2012 / 12-894-993aa JS2008 Statistical results of the survival rate of piglets challenged with recombinant poison;

[0033] Figure 10 Recombinant porcine epidemic diarrhea virus strain rAH2012 / 12-894-993aa JS2008 Results of immunogenicity evaluation; A: titer of specific antibodies against PEDV-S1 protein in the serum of each group of animals after the second immunization; B: cross-neutralization titer of rAH2012 / 12-894-993aa immune serum against classical strains and variant strains; C: survival rate of piglets in each group after infection. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] The main experimental materials, reagents and instruments involved in the following examples are:

[0040] (1) Strains, plasmids, and cells

[0041] The PEDVA H2012 / 12 strain (GenBank accession number: KU646831.1) and PEDV JS2008 strain (GenBank accession number: KC109141.1) are both deposited by the Veterinary Research Institute of Jiangsu Academy of Agricultural Sciences. pBAC-AH2012 / 12 is an infectious clone plasmid containing the full-length cDNA of the PEDVA H2012 / 12 strain (disclosed in the literature “Genetic signatures associated with the virulence of porcine epidemic diarrhea virus AH2012 / 12”) and was constructed and maintained in our laboratory. Vero cells are also maintained in our laboratory. NEB 10-beta competent cells were purchased from Biomed Gene Technology Co., Ltd.

[0042] (2) Test reagents

[0043] 2×Phanta Max Master Mix, FastPure Cell / Tissue Total RNA Isolation Kit, AceQ qPCR Probe Master Mix, and Fetal Bovine Serum were all purchased from Novozymes Biotech; Gel Extraction Kit and Cycle Pure Kit were all purchased from Omega; rNTP mix, T7 RNA polymerase, and Spy Cas9 nuclease were all purchased from New Brunswick; Recombinant RNase Inhibitor was purchased from Takara; DTT, Lipofectamine 3000, and crystal violet were all purchased from Thermo Fisher Scientific; DEPC water and 3M NaAc were purchased from Beyotime Biotechnology; Large-Construct Kit was purchased from QIAGEN; chloroform, isopropanol, and chloramphenicol were all purchased from Merck; 2×Seamless Cloning Mix was purchased from Bomade Gene Technology Co., Ltd.; high-glucose DMEM medium and penicillin-streptomycin dual antibody solution were purchased from Yuanpei Biotechnology Co., Ltd.; trypsin-EDTA digestion solution was purchased from Nanjing Shenghang Biotechnology Co., Ltd.; HiFiScript gDNARemoval RT MasterMix was purchased from Kangwei Century Technology Co., Ltd.; 4% paraformaldehyde fixative was purchased from Biosharp; PEDVN protein monoclonal antibody was prepared and stored in this laboratory (conventional PEDV N protein monoclonal antibody can be used, and the one used in this invention is stored in the laboratory); FITC Conjugated AffiniPure Goat Anti-mouse IgG and DAPI staining solution were purchased from Boster Biological Co., Ltd.

[0044] (3) Preparation of culture medium and buffer

[0045] Preparation of 25 mg / mL chloramphenicol stock solution: Weigh 2.5 g chloramphenicol into 100 mL of anhydrous ethanol, dissolve evenly, filter sterilize using a 0.22 μm filter, and store at -20°C until ready for use.

[0046] LB liquid medium: Weigh 10 g NaCl, 10 g tryptone, and 5 g yeast extract into a conical flask, add ddH2O to make up to 1 L, autoclave, and store at 4°C until use;

[0047] LB solid medium: Weigh 10 g NaCl, 10 g tryptone, 5 g yeast extract, and 15 g agar powder into a conical flask, add ddH2O to 1 L, sterilize, and cool to 60°C. Add 1 mL of 25 mg / mL chloramphenicol stock solution and mix thoroughly. Pour the medium into a sterile Petri dish, cool and solidify, and store upside down at 4°C.

[0048] Trypsin virus maintenance solution: add 100 μL of 0.25% trypsin digestion solution and 1 mL of penicillin-streptomycin solution to 100 mL of high-glucose DMEM and store at 4°C until use;

[0049] 2% FBS virus maintenance solution: add 2 mL of fetal bovine serum and 1 mL of penicillin-streptomycin solution to 98 mL of high-glucose DMEM and store at 4°C until use;

[0050] Virus Trypsin plaque solution: Weigh 3 g of carboxymethyl cellulose and add it to 100 mL of ddH2O. After autoclaving, add 100 mL of 2× DMEM solution, 200 μL of 0.25% trypsin digestion solution, and 2 mL of penicillin-streptomycin solution. Stir well and store at 4°C until use.

[0051] Virus 2% FBS plaque medium: Weigh 3 g of carboxymethyl cellulose and add it to 96 mL of ddH2O. After autoclaving, add 100 mL of 2× DMEM solution, 4 mL of fetal bovine serum, and 2 mL of penicillin-streptomycin solution. Stir well and store at 4°C until ready to use.

[0052] Crystal violet staining solution: Weigh 0.1 g of crystal violet powder and dissolve it in 100 mL of 4% paraformaldehyde fixative. Stir and mix thoroughly, then store at room temperature for later use.

[0053] (4) Test equipment

[0054] The cell culture incubator, PCR instrument, electrophoresis instrument, inverted fluorescence microscope, fluorescence quantitative PCR instrument, gel imager, etc. are all owned by the Jiangsu Academy of Agricultural Sciences.

[0055] Example 1 Porcine epidemic diarrhea virus recombinant strain rAH2012 / 12-894-993aa JS2008 Construction

[0056] (1) Preparation of transcription templates for sgRNA-894-993aa F and sgRNA-894-993aa R of PEDV AH2012 / 12 strain: Two sgRNA primer pairs targeting 894-993aa on the S2 subunit of PEDV AH2012 / 12 strain were designed and named sgRNA-894-993aa F (SEQ ID NO: 1) and sgRNA-894-993aa R (SEQ ID NO: 2). Overlap extension PCR was performed using primer pairs sgRNA-894-993aa F and sgRNA-894-993aa R with scaffold oligo (SEQ ID NO: 3), respectively. The amplification system was as follows: 25 μL 2× Phanta Max Master Mix, 20 μM sgRNA primers F / R, 3 μL scaffold oligo, and ddH2O was added to a total volume of 50 μL.

[0057] The amplification conditions were as follows: 98°C for 30s; 98°C for 30s, 60°C for 30s, 72°C for 1min; after 34 cycles, extension was performed at 72°C for 10min. Figure 2 ), and the target fragments were recovered using a Gel Extraction Kit according to the instructions, which were the transcription templates for sgRNA-894-993aa F and sgRNA-894-993aa R of PEDV AH2012 / 12 strain.

[0058] (2) Preparation of sgRNA-894-993aa F and sgRNA-894-993aa R of PEDV AH2012 / 12 strain: The above-mentioned transcription template was transcribed in vitro using T7 in vitro transcription reagent. The reaction system was as follows: 10 μL sgRNA transcription template, 1.6 μL rNTP Mix, 0.5 μL RNase inhibitor, 2 μL T7 RNA polymerase, 2 μL 10× Transcription Buffer, 1 μL DTT, 2.9 μL RNase-free ddH2O. After mixing, the reaction was incubated at 37°C for 16 h. After the reaction, the reverse transcription product was purified as follows: 180 μL RNase-free ddH2O and 50 μL 3M NaAc (sodium acetate) were added to 20 μL of overnight transcription system, mixed, and then 250 μL chloroform was added, mixed, and centrifuged at 12000 rpm at room temperature for 2 min; the upper layer liquid was carefully pipetted into a new RNase-free EP tube, an equal volume of isopropanol was added, gently inverted to mix, centrifuged at 12000 rpm at room temperature for 10 min, and the supernatant was discarded; 700 μL 75% ethanol was added, centrifuged at 1200 rpm at room temperature for 10 min, and the supernatant was discarded; after air drying, 15 μL RNase-free ddH2O was added to dissolve sgRNA to obtain sgRNA-894-993aa F and sgRNA-894-993aa R. After measuring the concentration, it was stored at -80°C.

[0059] (3) Extraction and cleavage of pBAC-AH2012 / 12: The pBAC-AH2012 / 12 backbone plasmid was extracted according to the instructions of QIAGEN Large-Construct Kit. NEB Cas9 nuclease was used to cleave pBAC-AH2012 / 12 in vitro. The cleavage system and conditions were as follows: 10 μL sgRNA-894-993aa F, 10 μL sgRNA-894-993aa R, 3 μg pBAC-AH2012 / 12, 5 μL Cas9 nuclease, 5 μL 10×3.1 Reaction Buffer, add RNase-free ddH2O to a total volume of 50 μL, mix well and incubate at 37°C for 2.5 h. The cleavage product was recovered using Cycle Pure Kit according to the instructions. 5 μL of the recovered product was subjected to 1% agarose gel electrophoresis to detect the cleavage effect. Figure 3 As shown, pBAC-AH2012 / 12 was successfully cut.

[0060] (4)894-993aa JS2008Amplification of the replacement fragment: Using PEDV JS2008 strain cDNA as a template, primer pair 894-993aa JS F (SEQ ID NO: 4) and 894-993aa JS The gene sequence of 894-993aa of PEDV JS2008 strain was amplified by R (SEQ ID NO: 5). The reaction system was as follows: 25 μL 2×Phanta Max Master Mix, 20 μM 894-993aa JS F, 20 μM 894-993aa JS R, 2 μL cDNA, add ddH2O to a total volume of 50 μL. The reaction conditions are as follows: 98℃ for 30s; 98℃ for 30s, 60℃ for 30s, 72℃ for 1min; after 34 cycles, extend at 72℃ for 10min. After the reaction, the amplified products were electrophoresed on a 1% agarose gel ( Figure 2 ), and recovered the target fragment using Gel Extraction Kit according to the instructions, which was 894-993aa JS2008 The recovered product was stored at -20°C for future use.

[0061] (5)pBAC-AH2012 / 12-894-993aa JS2008 Ligation of recombinant plasmids: The purified cleavage product from step (3) and the replacement fragment recovered from step (4) were ligated with homologous recombinase. The ligation system and reaction conditions were as follows: 2 μL pBAC-AH2012 / 12 cleavage product, 3 μL 894-993aa JS2008 Replace the fragments with 5 μL of 2×Seamless Cloning Mix, mix well, and react at 50°C for 30 min.

[0062] (6) Transformation of ligation product: Take 10 μL of the ligation product from step (5) and add it to NEB10-beta competent cells. Mix well and place in an ice-water bath for 30 min. Heat shock at 42°C for 90 s, place in an ice-water bath for 2 min, then add 500 μL of LB liquid culture medium without antibiotics and culture at 37°C with shaking at 200 rpm for 1 h. After the culture is completed, centrifuge at 4000 rpm for 1 min, discard 500 μL, retain 100 μL of culture medium to resuspend the competent cells, take the bacterial solution and spread it on an LB solid culture plate containing chloramphenicol resistance. After the liquid is dried, invert the plate and place it in a 37°C incubator for overnight culture.

[0063] (7) Screening of positive clones: After visible colonies appear on the plate, pick 10 single colonies and inoculate them into an EP tube containing 1 mL of chloramphenicol-resistant LB, culture at 37°C and 200 rpm for 8 h, and use the identification primers PEDV 28F (SEQ ID NO: 7) and PEDV 28R (SEQ ID NO: 8) to perform PCR amplification and identification of the bacterial solution. The amplification system is as follows: 12 μL 2×Phanta MaxMaster Mix, 2 μL PEDV 28F, 2 μL PEDV 28R, 2 μL bacterial solution sample, 6 μL ddH2O. The amplification conditions are as follows: 98°C for 30 s; 98°C for 30 s, 60°C for 30 s, 72°C for 1 min; after 34 cycles, extend at 72°C for 10 min. After the reaction is completed, take 5 μL of the amplified product and perform electrophoresis on 1% agarose gel to identify the positive clones (see Figure 4 The PCR product identified as a positive clone was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the 894-993aa gene fragment of the PEDV JS2008 strain had been successfully replaced into the C-terminus of the pBAC-AH2012 / 12S gene (nt 23313 to nt 23612). The positive clone with the correct sequencing was named porcine epidemic diarrhea virus infectious clone plasmid pBAC-AH2012 / 12-894-993aa JS2008 (See the atlas Figure 1 , the identification results are shown in Figure 4 Middle B).

[0064] (8)pBAC-AH2012 / 12-894-993aa JS2008 Plasmid extraction: After the positive colonies identified in step (7) were expanded and cultured, large amounts of plasmids were extracted according to the instructions of the QIAGEN Large-Construct Kit. The plasmid concentration was measured and stored at -20°C for later use.

[0065] (9) Recombinant virus rAH2012 / 12-894-993aa JS2008 Rescue: 6 μg pBAC-AH2012 / 12-894-993aa was transfected with Lipofectamine 3000 according to the instructions. JS2008The recombinant plasmid was transfected into two wells of a 6-well plate containing 80% confluent Vero cells. Six hours after transfection, cells in one well were washed twice with DMEM supplemented with 2% fetal bovine serum, followed by the addition of 2 mL of DMEM supplemented with 2% fetal bovine serum. Cells in the other well were washed twice with DMEM supplemented with 2% fetal bovine serum, followed by the addition of 2 mL of serum-free DMEM supplemented with 5 μg / mL trypsin. Culture was continued until cytopathic activity exceeded 80%. Cell cultures were then harvested, frozen and thawed twice at -80°C, and centrifuged at 4000 rpm for 5 minutes. The supernatant was collected, labeled as the P0 seed virus, and 200 μL of the supernatant was inoculated into Vero cells for viral amplification.

[0066] like Figure 5 As shown, pBAC-AH2012 / 12-894-993aa JS2008 48 hours after transfection of Vero cells, cells cultured in DMEM containing 2% fetal bovine serum showed significant cytopathic effects, primarily cell swelling and lysis, consistent with the cytopathic effects caused by the PEDV JS2008 strain, but inconsistent with the cell fusion effects caused by the PEDV AH2012 / 12 strain. Cells cultured in serum-free DMEM containing 5 μg / mL trypsin showed no significant cytopathic effects, and blind passage on Vero cells for three generations also showed no significant cytopathic effects. This indicates that the recombinant virus can be successfully rescued in DMEM virus maintenance medium containing 2% fetal bovine serum, and it was named PEDV rAH2012 / 12-894-993aa. JS2008 Recombinant virus.

[0067] (10) Recombinant virus rAH2012 / 12-894-993aa JS2008 Sequencing identification: P0 generation PEDV rAH2012 / 12-894-993aa JS2008 RNA from the recombinant virus strain was isolated according to the Cell / Tissue Total RNA Isolation Kit instructions. cDNA was obtained by reverse transcription using 5×HiFiScript qRT SuperMix. The reverse transcription system consisted of 4 μL 5×HiScriptⅡ qRT SuperMix and 16 μL rAH2012 / 12-894-993aa. JS2008 The reaction conditions were: 37℃ for 15min; 85℃ for 5s. RT-PCR amplification and sequencing were performed using identification primers PEDV 28F and PEDV 28R as shown in step (7). Figure 6 As shown, the results were consistent with the 884-993aa fragment sequence of JS2008, with no deletions, insertions or mutations, confirming that PEDV rAH2012 / 12-894-993aa had been rescued JS2008 Recombinant virus.

[0068] (11) Recombinant virus rAH2012 / 12-894-993aa JS2008 Indirect immunofluorescence identification: PEDVAH2012 / 12, PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 Vero cells were inoculated and cultured with DMEM virus maintenance medium containing 2% fetal bovine serum and serum-free DMEM virus maintenance medium containing 5 μg / mL trypsin, respectively. Indirect immunofluorescence (IFA) detection was performed using a monoclonal antibody against the PEDV N protein as the primary antibody. The results are shown in Figure 2. Figure 7 As shown, PEDV JS2008 strain and rAH2012 / 12-894-993aa were cultured in DMEM virus maintenance medium containing 2% fetal bovine serum. JS2008 All inoculated cells showed specific fluorescence, but the cells inoculated with PEDV AH2012 / 12 strain had less specific fluorescence. When cultured in serum-free DMEM virus maintenance medium containing 5 μg / mL trypsin, the cells inoculated with PEDV AH2012 / 12 strain showed specific fluorescence, while PEDV JS2008 strain and rAH2012 / 12-894-993aa JS2008 The inoculated cells showed less specific fluorescence, and the uninoculated control group cells had no fluorescence, further confirming that the rescued virus was PEDV.

[0069] (12) Recombinant virus rAH2012 / 12-894-993aa JS2008 Proliferation characteristics and stability in cell culture: PEDV AH2012 / 12, PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 Vero cells were inoculated with 0.1 MOI and incubated at 37°C for 1 h. The supernatant was discarded and the cells were washed twice with serum-free DMEM. PEDV AH2012 / 12 strain was cultured in serum-free DMEM virus maintenance medium containing 5 μg / mL trypsin. PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 The cells were cultured in DMEM virus maintenance medium containing 2% fetal bovine serum, and the culture supernatants were collected at 6, 12, 24, 36, 48, and 60 hours after infection to determine the virus titer. Figure 8 As shown, PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 The proliferation curves of rAH2012 / 12-894-993aa were similar, but the proliferation titer of PEDV AH2012 / 12 was low throughout the infection process, indicating that rAH2012 / 12-894-993aa JS2008The proliferation characteristics of the PEDV strain were different from those of the PEDV AH2012 / 12 strain, but similar to those of the PEDV JS2008 strain.

[0070] rAH2012 / 12-894-993aa JS2008 After continuous passage to 10 on Vero cells, typical cell fragmentation-like lesions were stably induced. PCR amplification and sequencing of P0, P5 and P10 virus samples were performed using identification primers. The results showed that the 894-993aa of the recombinant virus JS2008 The replacement genome existed stably and the gene sequence was consistent with the 894-993aa sequence of the PEDV JS2008 strain, indicating that the recombinant virus could be stably propagated on Vero cells.

[0071] Example 2 Porcine epidemic diarrhea virus recombinant strain rAH2012 / 12-894-993aa JS2008 Toxicity evaluation

[0072] Twenty newborn piglets that tested negative for porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and rotavirus (PRV) were randomly divided into four groups, with five pigs in each group. JS2008 The virus titer was adjusted to 5 × 10 5 TCID 50 After inoculation, 2 mL / pig was orally inoculated into piglets, and the control group was inoculated with the same volume of DMEM medium. After inoculation, the mortality of piglets in each group was recorded every day. Figure 9 As shown, compared with PEDV AH2012 / 12 strain, PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 The mortality rate of piglets in the inoculated groups was significantly reduced. Specifically, the PEDV AH2012 / 12 strain inoculated group began to die on the first day after inoculation, and the mortality rate reached 80% on the fifth day; while the PEDV JS2008 and rAH2012 / 12-894-993aa JS2008 No piglet died in the vaccination group during the entire observation period. JS2008 Compared to the wild-type AH2012 / 12 strain, the recombinant strain exhibits significantly reduced virulence and improved safety. This recombinant strain exhibits low pathogenicity in piglets and can be used in the development and preparation of PEDV vaccines.

[0073] Example 3 Porcine epidemic diarrhea virus recombinant strain rAH2012 / 12-894-993aa JS2008Immunogenicity evaluation

[0074] (1) Vaccine preparation: rAH2012 / 12 and rAH2012 / 12-894-993aa JS2008 The virus titer was adjusted to 5 × 10 5 TCID 50 / mL. Add 0.5‰ (volume fraction) of β-propiolactone to the virus solution and treat in the dark at 4°C for 24 hours to inactivate the virus. After inactivation, place it in a 37°C water bath for 2 hours to hydrolyze β-propiolactone. The inactivated virus solution was inoculated into cells and blindly passaged for three consecutive generations. The virus was confirmed to be completely inactivated by cytopathic effect observation. Subsequently, GEL 02 adjuvant was added at a volume fraction of 20%, fully emulsified and stored at 4°C for later use.

[0075] (2) Piglet immunization: 20 newborn piglets that tested negative for porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and rotavirus (PRV) were randomly divided into 4 groups, with 5 pigs in each group. In Group 1 and Group 2, rAH2012 / 12 inactivated vaccine and rAH2012 / 12-894-993aa were injected intramuscularly, respectively. JS2008 Inactivated vaccine, immunization dose is 2mL / head. Experimental groups 3 and 4 were injected with equal amounts of a mixture of DMEM medium and GEL 02 adjuvant as controls. The immunization procedure is as follows: the second immunization (second immunization) was performed 14 days after the first immunization (first immunization). On the 0th day, 14th day and 24th day after the first immunization, 2mL of whole blood was collected from each group of animals, and the serum was separated. The enzyme-linked immunosorbent assay (ELISA) test method was used to detect the specific antibody titer in the serum of each immunization group using PEDV-S1 protein as the antigen. The results are shown in Figure 2. Figure 10 As shown in A, the rAH2012 / 12 inactivated vaccine immunization group and rAH2012 / 12-894-993aa after the second immunization JS2008 The serum antibody titers against PEDV-S1 protein in the inactivated vaccine immunization groups were significantly increased. At the same time, the antibody titers of the two immunization groups were compared, and the results showed that there was no significant difference between the immunization groups, proving that both inactivated vaccines can induce piglets to produce high levels of antibodies against PEDV-S1 protein.

[0076] (3) Immunization of piglets: On the 24th day after the first immunization, the virus titer of PEDV rAH2012 / 12 was adjusted to 10 6 TCID 50 After the challenge, 2 mL / pig was orally inoculated into the piglets of test group 1, test group 2 and test group 3 respectively; the same volume of DMEM medium was inoculated into test group 4. The mortality of piglets in each group was recorded every day after the challenge. Figure 10 As shown in B, on the fifth day after the challenge, two piglets died in the non-immunized challenge group, and on the 13th day after the challenge, another piglet died in the group, with a survival rate of 40%. No piglet died in the rAH2012 / 12 inactivated vaccine immunization group during the observation period; rAH2012 / 12-894-993aa JS2008 In the inactivated vaccine immunization group, one piglet died on the 13th day after the virus challenge, and the survival rate was 80%. The above results show that the rAH2012 / 12 inactivated vaccine has a good protective effect on piglets and can effectively resist the attack of PEDV. At the same time, rAH2012 / 12-894-993aa JS2008 The inactivated vaccine prepared from the recombinant strain also has good immunogenicity and can significantly reduce the mortality rate of piglets, indicating that the recombinant strain can be used as a candidate vaccine for the prevention and control of porcine epidemic diarrhea.

[0077] Gene sequences involved in this application:

[0078] (1)sgRNA-894-993aa F (SEQ ID NO: 1):

[0079] TTCTAATACGACTCACTATAGGTGGCAGGGGTGGTACAAAAAGTTTTAGAGCTAGA;

[0080] (2)sgRNA-894-993aa F (SEQ ID NO: 2):

[0081] TTCTAATACGACTCACTATAGGTACAGACGGATGTTCTACAGGTTTTAGAGCTAGA;

[0082] (3) scaffold oligo (SEQ ID NO: 3):

[0083] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC;

[0084] (4)894-993aaJS F (SEQ ID NO: 4):

[0085] CAAGTGGCAGGGTGGTACAA;

[0086] (5)894-993aaJS R (SEQ ID NO: 5):

[0087] AGCAATTGCTGGTTCCGCTG;

[0088] (6)894-993aaJS (SEQ ID NO: 6):

[0089] GGGTCTTTTATTGAAGACCTGCTTTTAATAAAGTGGTTACTAATGGCCTTGGTACTGTTGATGAAGACTATAAGCGCTGTTCTAATGGTCGCTCTGTGGCAGATCTAGTCTGTGCGCAGTATTACTCTGGTGTCATGGTACTACCTGGC GTTGTTGACGCTGAGAAGCTTCACATGTATAGTGCGTCTCTCATCGGTGGTATGGCGCTAGGAGGTCTTACTACTGCAGCGGCATTGCCTTTTAGCCATGCTGTTCAAGCGAGGCTCAATTATCTTGCTTTACAGACGGATGTTCTACAG;

[0090] (7) PEDV 28F (SEQ ID NO: 7):

[0091] AGGGAGTTGCCTGGTTTCTTC;

[0092] (8) PEDV 28R (SEQ ID NO: 8):

[0093] AATGGCTTGGAAGTTGTGTTG.

[0094] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A recombinant strain of porcine epidemic diarrhea virus that is attenuated, broad-spectrum, and independent of pancreatic enzymes, characterized in that: The porcine epidemic diarrhea virus recombinant strain is obtained by replacing the 894-993 amino acids of the S protein of the PEDV AH2012 / 12 strain with the 894-993 amino acids of the S protein of the PEDVJS2008 strain, and the attenuated, broad-spectrum and pancreatic enzyme-independent porcine epidemic diarrhea virus recombinant strain is obtained by virus rescue.

2. The attenuated, broad-spectrum, and pancreatin-independent recombinant strain of porcine epidemic diarrhea virus according to claim 1, characterized in that: The genome accession number of the PEDV AH2012 / 12 strain on NCBI is KU646831.1, and the genome accession number of the PEDV JS2008 strain on NCBI is KC109141.

1.

3. A method for constructing a recombinant strain of attenuated, broad-spectrum, and pancreatic-independent porcine epidemic diarrhea virus according to claim 1 or 2, characterized in that: The following steps are involved: (1) Designed and synthesized specific upstream and downstream sgRNA primers targeting amino acids 894-993 of the S protein of the PEDV AH2012 / 12 strain, and amplified the sgRNA tracrRNA sequence by extension PCR using scaffold oligo to obtain in vitro transcription templates of sgRNA-894-993aa F and sgRNA-894-993aa R, which were then transcribed in vitro to obtain sgRNA-894-993aaF and sgRNA-894-993aa R; (2) The plasmid pBAC-AH2012 / 12 containing the full-length cDNA sequence of the PEDV AH2012 / 12 strain was cut using the CRISPR / Cas9 system to obtain the linearized pBAC-AH2012 / 12 plasmid; (3) The coding gene sequence of amino acids 894-993 of the S protein of the PEDV JS2008 strain was cloned and homologously recombined with the linearized pBAC-AH2012 / 12 plasmid. The homologous recombination product was then transformed into competent cells. The plasmid was extracted from the positive clones with correct sequencing by PCR screening and sequencing to obtain pBAC-AH2012 / 12-894-993aa. JS2008 Recombinant plasmid; (4) The pBAC-AH2012 / 12-894-993aa JS2008 The recombinant plasmid was transfected into Vero cells, and the attenuated, broad-spectrum and trypsin-independent porcine epidemic diarrhea virus recombinant strain was obtained through virus rescue.

4. The construction method according to claim 3, wherein: The nucleotide sequences of the upstream and downstream sgRNA primers are shown in SEQ ID NOs: 1-2, and the sequence of the scaffold oligo is shown in SEQ ID NO:

3.

5. The construction method according to claim 3, wherein: The gene sequence encoding amino acids 894-993 of the S protein of the PEDV JS2008 strain is shown in SEQ ID NO:

6.

6. Use of the attenuated, broad-spectrum, and pancreatic enzyme-independent porcine epidemic diarrhea virus recombinant strain according to claim 1 or 2 in the preparation of an attenuated porcine epidemic diarrhea vaccine.

7. The use according to claim 6, characterized in that The porcine epidemic diarrhea attenuated vaccine is an inactivated vaccine.

8. An attenuated porcine epidemic diarrhea vaccine, characterized in that: It contains the recombinant strain of porcine epidemic diarrhea virus according to claim 1 or 2.

9. The attenuated porcine epidemic diarrhea vaccine according to claim 8, characterized in that The attenuated porcine epidemic diarrhea vaccine further comprises an adjuvant.