Gene mutant for controlling male sterility of tobacco and application thereof

Abstract

The invention belongs to the field of plant biotechnology breeding, and relates to a gene mutant for controlling male sterility of tobacco and application thereof. According to the gene mutant, two para-line homologous genes NtCYP704B1-T and NtCYP704B1-S of a tobacco male sterility related gene NtCYP704B1 are subjected to simultaneous mutation; compared with a gene NtCYP704B1-T with a nucleotide sequence as shown in SEQ ID NO.1, the nucleotide sequence of the NtCYP704B1-T mutant gene is characterized in that a basic group A is inserted behind the 103th basic group; compared with a gene NtCYP704B1-S of which the nucleotide sequence is shown as SEQ ID NO.2, the nucleotide sequence of the NtCYP704B1-S mutant gene is characterized in that a basic group T is inserted behind the 99th basic group; the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are respectively as shown in SEQ ID NO. 5 and SEQ ID NO. 6. The invention also discloses an application of the NtCYP704B1-S mutant gene. According to the invention, through a CRISPR / Cas9 gene editing technology, two para-line homologous genes NtCYP704B1 are simultaneously subjected to site-directed mutagenesis in common tobacco, and the NtCYP704B1-T / S double-process sterile line is created, so that complete male sterility can be caused; a primer combination is developed aiming at the NtCYP704B1-T / S double-process sterile line and is used for fertility gene identification of plants and screening of target single plants in molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology breeding, and in particular relates to a gene mutant for controlling tobacco male sterility and an application thereof. Background Art

[0002] Tobacco is a major cash crop, but the tobacco seed industry currently faces the following challenges: First, due to factors such as the lack of fundamental breakthroughs in basic research on tobacco male sterility, intellectual property protection for tobacco inbred lines is difficult. This has led to a long-standing phenomenon of follow-up and imitative breeding in the tobacco seed industry in recent years, and the efficiency of selecting and breeding major new varieties has been slow. Second, the cultivation of tobacco inbred lines is plagued by the problem of farmers retaining their own seeds, resulting in an unregulated production of cultivated varieties. The resulting tobacco leaves are of low purity and poor consistency, impacting the application of tobacco industry formulas and the stability of cigarette product quality. Third, the tobacco seed production industry remains labor-intensive and relies primarily on artificial pollination, which is costly, resource-intensive, and difficult to guarantee seed quality.

[0003] Compared to other model plants like rice and maize, tobacco still lags behind in the utilization of heterosis, primarily due to a lack of high-quality male sterility lines. Male sterility lines, primarily cytoplasmic male sterility (CMS) and nuclear male sterility (GMS), are crucial materials for harnessing heterosis and hybrid seed production in crops. CMS, controlled by both mitochondrial and nuclear genes, has been applied in tobacco breeding and hybrid production, but currently only one cytoplasmic male sterility line is available. This leads to problems such as low resource utilization, a single cytoplasmic male sterility line, and disease susceptibility. GMS, controlled solely by nuclear genes, can overcome the shortcomings of CMS, but it is difficult to mass-produce homozygous male sterile lines through conventional breeding methods. Recent advances in biotechnology have led to the development of tobacco multi-functional male sterility technologies and universal dominant male sterility techniques, developed through a combination of genetic engineering and molecular design breeding. These technologies have effectively addressed the maintenance and propagation of recessive nuclear male sterile lines in tobacco. A crucial prerequisite for the application of these technologies is the availability of a large number of GMS genes with well-defined functions that control male development in tobacco and the corresponding male sterile materials. Compared with the model plant Arabidopsis thaliana and the model crop rice, there are no reports on the cloning, identification and creation of GMS genes in tobacco.

[0004] Traditional sterile line breeding methods involve hybridization and backcrossing, planting offspring material, and then selecting target plants based on fertility observation after flowering. This requires planting a large number of offspring materials and takes a long time. Using modern molecular markers to select genotypes at the seedling stage can significantly reduce the financial, material, and labor investment in the selection process and improve the accuracy of selection, making it the key to modern hybrid breeding and seed production.

[0005] Single nucleotide polymorphisms (SNPs) are widely distributed throughout the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. While most SNPs distributed throughout the genome do not directly determine phenotype, their close linkage to phenotypic-determining loci makes them promising candidates for development as important molecular markers. SNPs have become one of the most ideal molecular markers for studying the inheritance of complex plant traits.

[0006] Competitive allele-specific PCR (KASP) genotypes single nucleotide polymorphisms (SNPs) by specifically matching primer terminal bases. The basic principle is that two primers with different terminal bases each carry a fluorescent linker sequence. Based on the different fluorescent signals carried by the amplified products, large numbers of samples can be rapidly tested and their genotypes accurately determined. Since its introduction, KASP technology has rapidly captured the market with its exceptional flexibility, accuracy, and cost-effectiveness, playing a vital role in assisted crop breeding.

[0007] At present, there are no reports on the use of co-dominant KASP markers for selection in backcross breeding of tobacco nuclear male sterility genes. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention provides gene mutants for controlling tobacco male sterility and their applications. The present invention utilizes CRISPR / Cas9 technology to edit the tobacco male sterility-related gene NtCYP704B1 and create male sterile materials, enriching tobacco sterile material resources.

[0009] In order to achieve the above technical objectives, the present invention provides the following technical solutions:

[0010] A gene mutant for controlling tobacco male sterility, wherein the gene mutant is obtained by simultaneously mutating two paralogous genes NtCYP704B1-T and NtCYP704B1-S of the tobacco male sterility-related gene NtCYP704B1;

[0011] Compared with the gene NtCYP704B1-T whose nucleotide sequence is shown in SEQ ID NO.1, the nucleotide sequence of the NtCYP704B1-T mutant gene has an A inserted after the 103rd base; compared with the gene NtCYP704B1-S whose nucleotide sequence is shown in SEQ ID NO.2, the nucleotide sequence of the NtCYP704B1-S mutant gene has a T inserted after the 99th base; the nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; and the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.6.

[0012] Furthermore, the amino acid sequences encoded by the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

[0013] Furthermore, the tobacco male sterile gene mutant is used in creating tobacco male sterile lines.

[0014] A method for creating a tobacco male sterile line, comprising: using the CRISPR / Cas9 method to simultaneously perform gene editing on two paralogous genes of the NtCYP704B1 gene, NtCYP704B1-T and NtCYP704B1-S, to obtain a gene editing vector; and using Agrobacterium-mediated transfection to obtain a NtCYP704B1-T / S double-mutant male sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited.

[0015] Among them, after gene editing using the CRISPR / Cas9 method, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0016] Furthermore, when using the CRISPR / Cas9 method for gene editing, CRISPR / Cas9 vector editing target sites with nucleotide sequences as shown in SEQ ID NO.9 and SEQ ID NO.10 were designed at the first exon and homologous regions of the NtCYP704B1-T gene and the NtCYP704B1-S gene.

[0017] Furthermore, an upstream primer NtCYP704B1-TF and a downstream primer NtCYP704B1-TR were designed for detecting the target site of the NtCYP704B1-T gene. The sequences of the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively.

[0018] Furthermore, an upstream primer NtCYP704B1-SF and a downstream primer NtCYP704B1-SR were designed for detecting the target site of the NtCYP704B1-S gene. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR are shown as SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0019] Application of NtCYP704B1-T / S double-mutant sterile line in hybrid breeding and seed production.

[0020] Furthermore, the application in hybrid breeding and seed production refers to using the NtCYP704B1-T / S double-mutant sterile line as the female parent to hybridize with other male parents to obtain fertile hybrid seeds F1, and using the hybrid seeds F1 for production and planting.

[0021] Furthermore, molecular marker screening is used to specifically detect mutant genes in the NtCYP704B1-T / S double-mutant sterile line and tobacco sterile materials bred from the NtCYP704B1-T / S double-mutant sterile line;

[0022] The molecular marker screening adopts a primer combination to detect seedling materials of tobacco plants to be tested; the primer combination is a PCR primer combination or a KASP primer combination.

[0023] Further, the PCR primer combination includes a first PCR primer set and a second PCR primer set;

[0024] The first PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs. 21-23; the second PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs. 24-26.

[0025] The KASP primer combination adopts the KASP41_T / S primer set; the KASP41_T / S primer set includes a KASP41_T primer set and a KASP41_S primer set; the KASP41_T primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.23; the KASP41_S primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.29, SEQ ID NO.30, and SEQ ID NO.26.

[0026] The beneficial effects of the present invention are:

[0027] This invention, for the first time, achieves tobacco male sterility by inhibiting the expression of the NtCYP704B1 gene. By using the CRISPR / Cas9 method to simultaneously mutate the tobacco genes NtCYP704B1-T and NtCYP704B1-S, the invention discovered that simultaneous mutations in two paralogous genes of NtCYP704B1, NtCYP704B1-T and NtCYP704B1-S, cause tobacco male sterility.

[0028] The present invention obtains a gene editing vector by utilizing a CRISPR / Cas9 gene editing method, and then obtains an NtCYP704B1-T / S double-mutant sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited through Agrobacterium-mediated transfection, thereby being applicable to tobacco hybrid breeding and seed production.

[0029] The present invention develops primer combinations (including PCR primer combinations or KASP primer combinations) for the NtCYP704B1-T / S double-mutant sterile line, which can be used for plant fertility gene identification, target plant screening in molecular marker-assisted breeding, and seed purity identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The phenotype of the wild-type flower of the tobacco inbred line K326 of the present invention;

[0031] Figure 2 The phenotypes of the male buds and stigmas of the wild-type tobacco inbred line K326 of the present invention are:

[0032] Figure 3 The results of the pollen viability test of the wild-type tobacco inbred line K326 in the present invention are as follows;

[0033] Figure 4 The phenotype of the flower of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention;

[0034] Figure 5The phenotypes of the male buds and stigmas of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention are shown;

[0035] Figure 6 The results of the pollen viability test of the mutant of the NtCYP704B1-T / S double-sterile line in the embodiment of the present invention are shown;

[0036] Figure 7 This is the anther of the NtCYP704B1-T / S double-male sterile line in the embodiment of the present invention;

[0037] Figure 8 The inner wall of the anther of the NtCYP704B1-T / S double-stranded sterile line in the embodiment of the present invention;

[0038] Figure 9 The anthers are wild-type anthers of the tobacco inbred line K326 of the present invention;

[0039] Figure 10 It is the anther inner wall of the wild type tobacco inbred line K326 in the present invention.

[0040] Figure 11 The results of SNP genotyping using the KASP primer combination provided by the present invention;

[0041] Figure 12 The results are as follows: the KASP primer combination provided by the present invention was used to screen sterile lines and maintainer lines in the F2 offspring segregating population. DETAILED DESCRIPTION

[0042] The following examples are used to illustrate the present invention, but do not limit the scope of the present invention. Without departing from the spirit and essence of the present invention, the modifications or replacements made to the method, steps or conditions of the present invention are within the scope of the present invention. Unless otherwise specified, the primers used in the examples were completed by Beijing Qingke Biotechnology Co., Ltd., and sequencing was completed by Quintiles (Wuhan) Biotechnology Co., Ltd. Other biochemical reagents are conventional commercial reagents unless otherwise specified, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0043] Example 1: Functional Study of the Tobacco Ntcyp704b1 Gene and Creation of Tobacco Male Sterile Lines Using CRISPR / Cas9 Method:

[0044] In the tobacco database (National Center for Biotechnology Information (nih.gov)), it was found that tobacco NtCYP704B1 has two paralogous genes, namely NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664). In the tobacco inbred line K326, the nucleotide sequences of the NtCYP704B1-T gene and the NtCYP704B1-S gene are shown in SEQ ID NO.1 and SEQ ID NO.2; the NtCYP704B1-T (LOC107791425) gene is functionally annotated as cytochrome P450704B1-like, and its encoded protein contains 510 amino acids, the sequence of which is shown in SEQ ID NO. NO.3; the NtCYP704B1-S (LOC107809664) gene function is annotated as cytochrome P450704B1-like, and its encoded protein contains 519 amino acids, and the sequence is shown in SEQ ID NO.4.

[0045] There is no published research data on the actual function of the Ntcyp704b1 gene in tobacco. To clarify the functions of tobacco NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes in tobacco, the present invention uses CRISPR / Cas9 gene editing to mutate the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) gene sequences and knock out the function of the gene in tobacco.

[0046] The present invention uses the tobacco inbred line K326 as the receptor material for gene editing. Construction of the CRISPR / Cas9 gene editing vector for NtCYP704B1: The gene editing vector of the present invention is PKSE401-GFP-Ntcyp704b1, which uses the base vector PKSE401-GFP and the intermediate vector pCBC mT1T2 to provide gRNA. The present invention designs target sites on primers, then uses PCR to obtain MT-sgRNA, which is then ligated into the base vector via enzyme digestion. The specific construction process is as follows:

[0047] (1) The gene sequences of NtCYP704B1 (including two paralogous genes, NtCYP704B1-T and NtCYP704B1-S) were input into http: / / targetDesign(scau.edu.cn) for target design. CRISPR / Cas9 vector editing targets were designed with nucleotide sequences such as those shown in SEQ ID NO. 9 and SEQ ID NO. 10 at the first exon and homologous regions of the NtCYP704B1-T and NtCYP704B1-S genes. The sgRNA backbone sequence of the present invention was directly amplified from the intermediate vector pCBC mT1T2.

[0048] (2) MT-sgRNA was obtained by designing target sites on primers and then PCR amplification. Primers Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, and Ntcyp704b1-MT1-BsR were used to amplify the intermediate vector pCBCmT1T2. Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. -BsF / -BsR are normal primer concentrations; -F0 / -R0 are diluted 20-fold. The fragments used to obtain sgRNA were all 626 bp in length. The PCR system and conditions were as follows: 2 μL template DNA (intermediate vector pCBCmT1T2 ≥ 30 ng / μL); 1 μL each of primers BsF, F0 / BsR, and R0; 1 μL enzyme; 1 μL dNTP; 25 μL buffer; 17 μL sterile ddH2O; PCR temperature program: ① 95°C for 5 minutes; ② 95°C for 30 seconds; ③ 58°C for 30 seconds; ④ 72°C for 35 seconds; ⑤ 34 cycles from ② to ④; ⑥ 72°C for 10 minutes; ⑦ 25°C for 10 minutes. The PCR product was recovered.

[0049] Among them, the sequences of the primers Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, and Ntcyp704b1-MT1-BsR required for vector construction are as follows:

[0050] Ntcyp704b1-MT1-BsF:5'-ATATATGGTCTCGATTGCATACATTGGCCTATTATTGTT-3'(SEQID NO.11)

[0051] Ntcyp704b1-MT1-F0:5'-TGCATACATTGGCCTATTATTGTTTTAGAGCTAGAAATA GC-3'(SEQ ID NO.12)

[0052] Ntcyp704b1-MT1-R0:5'-AACAAGTTGTAGACCACGTTGGCAATCTCTTAGTCGA CTCTAC-3'(SEQ ID NO.13)

[0053] Ntcyp704b1-MT1-BsR:5'-ATTATTGGTCTCGAAACAAGTTGTAGACCACGTTGG CAA-3'(SEQID NO.14)

[0054] (3) Enzyme digestion-ligation system: The PKSE401-GFP vector and the recovered target-carrying sgRNA fragment were digested with BsaI, and T4 ligase was added to connect the vector and sgRNA fragment. The 15 μL enzyme digestion and ligation system is as follows: sgRNA fragment: 2 μL, PKSE401-GFP vector (≥60 ng / μL): 2 μL, 10x NEB Buffer: 1.5 μL, 10x T4 DNA Ligase Buffer: 1.5 μL, BsaI endonuclease (product number: #R3733): 1 μL, T4 ligase (product number: EL0011): 1 μL, sterile ddH2O: 6 μL; the expression vector PKSE401-GFP-NtCYP704B1 was constructed; the expression vector includes the target (MT1) of the target gene NtCYP704B1-T (LOC107791425) and the target (MT1) of NtCYP704B1-S (LOC107809664), the marker gene Cas9 and the resistance Kana. Among them, from the left border to the right border of T-DNA are the expression cassette of resistance Kana; the expression cassette of nuclease encoding gene Cas9; 35S enhancer; the expression cassette of NtCYP704B1-T and NtCYP704B1-S gene target 1 (MT1); U6 promoter; GFP fluorescent protein tag; 35S promoter.

[0055] Agrobacterium-mediated genetic transformation of tobacco:

[0056] (1) Preparation of sterile seedlings

[0057] Place an appropriate amount of K326 seeds in a 2.0mL centrifuge tube and soak in 1.5mL of room-temperature distilled water for 12-24 hours. Wash away any unfilled seeds and impurities floating on the water surface. Sterilize the seeds in a laminar flow hood. First, add 1.5mL of 75% medical alcohol and invert the tube for 45 seconds. Allow the tube to settle and discard the alcohol with a pipette. Add 1.5mL of sterile water and invert the tube twice. Allow the tube to settle and discard the water with a pipette. Repeat this step twice. Then, add 1.5mL of 84 disinfectant (NaClO) and invert the tube for 4 minutes. Allow the tube to settle and discard the 84 disinfectant with a pipette. Add 1.5mL of sterile water and invert the tube twice. Allow the tube to settle and discard the water with a pipette. Repeat this step five times. Finally, the sterilized seeds were evenly spread on the MS plate (culture medium: MS + 30g / L sucrose + 7g / L agar + pH 5.8), the water on the surface of the MS plate was blown dry, and then the plate was sealed and placed in a 25°C light culture room for culture.

[0058] After the seeds germinate and begin to grow true leaves (about 2 weeks), the tobacco plants are transferred to tissue culture boxes for cultivation. When the tobacco seedlings have 10 cotyledons (about 4 weeks) in the tissue culture boxes, they can be used for infection.

[0059] (2) Preparation of bacterial solution

[0060] Remove the transformed strain from -80°C and inoculate it into 5 mL of triple-antibody (rifampicin, gentamicin, and kanamycin) LB medium. Incubate at 28°C in a shaker (180 rpm) for 24 hours. Inoculate 1 mL of the bacterial suspension into a 50 mL LB flask containing triple-antibody LB medium. Incubate at 28°C until the OD600 is approximately 0.6-0.8 (4-6 hours). Pour the mixture into a culture dish and set aside.

[0061] (3) Pre-culture

[0062] Select the fully expanded and strong leaves in the middle of the sterile tobacco seedlings, cut off the leaf margins, main veins and petioles, cut the leaves into 0.8cm × 0.8cm size, place the leaves with the back facing up on the pre-culture medium, the composition of the pre-culture medium is the same as the co-culture medium, 6-8 leaves per dish, and pre-culture at 28℃ in the dark for 3 days.

[0063] (4) Agrobacterium infection.

[0064] Place the pre-cultured leaves into the prepared Agrobacterium solution and soak for 8-10 minutes. During this time, gently shake the culture dish several times to ensure full contact between the bacterial solution and the material. Take out the leaves and place them on sterile filter paper to absorb excess bacterial solution.

[0065] (5) Co-cultivation.

[0066] The leaves were inoculated on the co-culture medium with the back of the leaves facing upwards, and co-cultured at 28°C in the dark for 2 days.

[0067] (6) Screening and differentiation.

[0068] The leaves were transferred to screening medium for screening and differentiation of resistant buds, and the medium was replaced every 15 days.

[0069] (7) Rooting culture.

[0070] When the leaves on the screening medium grow obvious resistant buds, cut the resistant buds and transfer them to the rooting medium for rooting culture. After the roots grow, transfer them to nutrient pots for hardening. After one month, transfer them to the greenhouse. After 3-4 months, harvest the offspring seeds.

[0071] Detection of CRISPR / Cas9 mutation results in T0 generation plants: To determine the CRISPR / Cas9 mutation results in T0 generation plants, the following steps were taken:

[0072] First, the CTAB method was used to extract tobacco leaf DNA: 2 cm long seedling leaves were cut and placed in a 2 mL centrifuge tube filled with steel balls; the centrifuge tube containing the leaves was immersed in liquid nitrogen for 5 minutes, and then the leaf samples were broken up using a grinder; 700 μL of CTAB extraction buffer (containing 1% β-mercaptoethanol) was vigorously shaken and mixed, and preheated in a constant temperature water bath at 65°C for 20-30 minutes (during which time, the tube was taken out and inverted 1-2 times, and attention was paid to the correspondence of the experimental sample number); after the centrifuge tube was cooled to room temperature, 700 μL of chloroform: isoamyl alcohol (24:1) extraction solution was added, and after vigorous shaking for 30 seconds, it was allowed to stand for a while at room temperature; at 4°C, centrifuged at 12000 rpm for 5 minutes, and 500 μL of the supernatant after centrifugation was taken into a new 1.5 mL centrifuge tube; an equal volume of isopropanol was added to the centrifuge tube containing the supernatant and gently shaken to mix, and allowed to stand at room temperature for about 10 minutes; then the centrifuge tube containing the sample was placed in a 4°C centrifuge, centrifuged at 12000 rpm for 10 minutes, and the supernatant was gently aspirated, the supernatant was discarded, and the precipitate was retained; 800 μL Wash the precipitate twice with 75% ethanol, centrifuge at 10,000 rpm for 5 minutes, and discard the supernatant. Allow the sample to dry naturally at room temperature for 2-4 hours to obtain a DNA precipitate. Dissolve the DNA in sterile water and gently shake until the DNA is fully dissolved. Store the DNA sample at -20°C.

[0073] PCR primers were designed based on the NtCYP704B1-T (LOC107791425) gene sequence to detect the target MT1. The designed primers include the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR for detecting the NtCYP704B1-T gene target site. The primer sequences are as follows:

[0074] NtCYP704B1-T upstream primer: CACAGCATGCAAAGACTGTTGA (SEQ ID NO.15)

[0075] NtCYP704B1-T downstream primer: TCCCCACCGAAAGAATAACAA (SEQ ID NO.16)

[0076] PCR primers were designed based on the NtCYP704B1-S (LOC107809664) gene sequence to detect the target MT1. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene. The primer sequences are as follows:

[0077] NtCYP704B1-S upstream primer: TGAGGTGTGTTGTGGAAGTCA (SEQ ID NO.17)

[0078] NtCYP704B1-S downstream primer: AGTTGTAGACCACGTTGGGAC (SEQ ID NO.18)

[0079] In order to detect gene mutations in transgenic positive plants and their offspring with high throughput, high-throughput self-built library sequencing was performed. The experimental principle is to perform sequencing after two rounds of PCR: (1) Use site-specific primers (SSP) to perform the first round of PCR amplification on the DNA fragment containing the target site; the designed specific primers need to add common bridging sequences at their 5' end: the 5' end of the F primer is added with: 5'-ggagtgagtacggtgtgc-3'; the 5' end of the R primer is added with: 5'-gagttggatgctggatgg-3'; (2) Use a set of universal barcoding primers for the second round of amplification; (3) The second round amplification products from different plants are mixed in equal amounts, tested, and sent to the company for double-end 150bp second-generation sequencing; (4) The mutation sequence is decoded and analyzed online on the Hi-TOM website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type of each plant at each target site.

[0080] Through high-throughput detection, it was determined whether gene editing occurred in the target region. Ultimately, it was found that the target region sequences of both genes in one T0 transformation event had changed, and a gene mutant was determined to have been produced. The gene mutant was a simultaneous mutation of two paralogous genes, NtCYP704B1-T and NtCYP704B1-S, of the tobacco male sterility-related gene NtCYP704B1. In the gene mutant, the nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.6.

[0081] The mutant is a homozygous double mutant of Ntcyp704b1: NtCYP704B1-T / S-Cas9. The wild-type NtCYP704B1-T (WT-NtCYP704B1-T) gene is 1533 bp long, including 6 exons and 5 introns; the wild-type NtCYP704B1-S (WT-NtCYP704B1-S) gene is 1560 bp long, including 6 exons and 5 introns. Ntcyp704b1 double mutant: Compared to the gene NtCYP704B1-T with a nucleotide sequence as shown in SEQ ID NO.1, the nucleotide sequence of the NtCYP704B1-T mutant gene has an A inserted after base 103; compared to the gene NtCYP704B1-S with a nucleotide sequence as shown in SEQ ID NO.2, the nucleotide sequence of the NtCYP704B1-S mutant gene has a T inserted after base 99. These mutations result in a frameshift mutation in the amino acids and a premature termination of the subsequent amino acids, resulting in a loss of function of the proteins of both NTCYP704B1 genes in this mutant.

[0082] Genotyping of F1 generation plants: Since the stigma and anther development of T0 generation tobacco plants grown in the greenhouse are often uncoordinated, and when the edited gene is related to male development, it will also affect fertility, therefore, in order to reproduce T0 generation plants and pass on the obtained gene editing type, the present invention uses wild-type pollen of the tobacco inbred line K326 to pollinate the T0 generation plants of NtCYP704B1-T / S-Cas9 obtained above, and then obtains F1 generation seeds, and the grown plants are F1 generation plants.

[0083] The F1 generation plants include two segregation types, one is Cas9-positive plants (transgenic plants), and the other is Cas9-negative plants (non-transgenic plants). In order to avoid the continuous editing of the K326 wild-type allele introduced by hybrid pollination by sgRNA and Cas9, thereby causing the complexity of mutation types, it is necessary to select plants that do not contain the Cas9 gene but contain the T0 generation mutation type from the F1 generation plants through genotyping. After self-pollination, these plants can obtain the non-transgenic F2 generation.

[0084] The genotyping steps for F1 plants are as follows:

[0085] After leaf DNA was extracted using the CTAB method, PCR amplification was performed using the Cas9 gene-specific primers Cas9-F (SEQ ID NO. 19) and Cas9-R (SEQ ID NO. 20).

[0086] Cas9-F primer sequence: 5'-TGTCCCAGGATTAGAATGATTAGGC-3'

[0087] Cas9-R primer sequence: 5′-AGCCCTCTTCTTTCGATCCATCAAC-3′;

[0088] After the PCR products were subjected to agarose gel electrophoresis, Cas9-positive plants and Cas9-negative plants were distinguished based on the results.

[0089] Further sequencing was performed on the targets of the NtCYP704B1-T (LOC107791425) gene and the NtCYP704B1-S gene in the Cas9-negative plants; the inheritance of the T0 generation mutation type was determined based on the sequencing results.

[0090] Example 2: Phenotypic Analysis of NtCYP704B1-T / S Double-Sterile Male Sterile Line

[0091] F2 seeds were obtained by self-pollinating F1 plants lacking the Cas9 gene identified in Example 1. A single target plant of the Ntcyp704b1 double mutant (NtCYP704B1-T / S-Cas9) was sown and phenotypic analysis was performed at maturity. The F2 lines showed a consistent segregation ratio of fertile to sterile plants of 15:1, further demonstrating that the sterility trait of the NtCYP704B1-T / S double-mutant sterile line is controlled by two recessive genes. Detailed phenotypic comparisons were then conducted between the stable, non-transgenic NtCYP704B1-T / S sterile lines obtained in the F2 generation and the wild type.

[0092] Observation of flower, anther, and pollen vitality: In terms of vegetative growth and flower development, the NtCYP704B1-T / S double-stranded sterile line (NtCYP704B1-T / S-Cas9) showed essentially no difference from the wild type. In terms of flower development, the wild type was able to bud normally, anthers could dehisce and shed pollen normally, and could set fruit normally after self-pollination (see Figure 1-Figure 2 ), while the NtCYP704B1-T / S double-stranded sterile line can bud normally, but cannot flower normally. The anther husk does not crack, the anther is obviously smaller, shrunken and not exposed (see Figure 4-Figure 5 ); further analysis of pollen from wild type and mutants with acetic acid carmine revealed that wild type pollen developed normally (see Figure 3 ), pollen grains are stained black, but the mutant has no pollen grains (see Figure 6 This indicates that the NtCYP704B1-T and NtCYP704B1-S genes jointly control male development in tobacco. The NtCYP704B1-T / S double-stranded male sterile line created by gene editing is a pollen-free male sterile line, showing the characteristics of complete sterility.

[0093] Scanning electron microscopy (SEM) of anthers: To further characterize the cytological characteristics of the NtCYP704B1-T / S double-mutant sterile line, scanning electron microscopy (SEM) analysis of the inner and outer anther walls of wild-type and homozygous double mutant anthers was performed. Anthers of the wild-type and mutant (i.e., the NtCYP704B1-T / S-Cas9 sterile line) at the mature stage (S13) were excised and immediately fixed in FAA solution (Coolaber, China). The volume of the fixative was at least 20 times the volume of the material being studied. For mutant anthers, the anther wall was perforated with a dissecting needle to enhance the penetration of the fixative, or vacuum was repeatedly applied until the anther sank to the bottom of the solution. After fixation at room temperature for 2 hours, the material was stored at 4°C or dehydrated in 50%, 60%, 70%, 80%, 90%, and 100% ethanol, with each gradient maintained for 15 minutes. The material was then placed in 70% ethanol overnight or stored. The dehydrated samples were subjected to carbon dioxide critical point drying and then gold-plated for observation.

[0094] The anthers of the wild type WT and NtCYP704B1-T / S double-stranded sterile line after peeling, such as Figure 7 and Figure 9 As shown, the anthers of the wild type are plump ( Figure 9 ), while the anthers of the NtCYP704B1-T / S double-stranded sterile line were shrunken; the inner wall of the wild-type anthers was covered with well-developed pollen grains (such as Figure 10 ); while the inner wall of anther of NtCYP704B1-T / S double-stranded sterile line has no mature pollen grains (as shown in Figure 8 shown);

[0095] The researchers also found that the anthers of the NtCYP704B1-T / S mutant (i.e., the NtCYP704B1-T / S-Cas9 sterile line) had a smooth outer cuticle and failed to form a reticular cuticle, whereas the wild-type strain formed a dense reticular cuticle. Similarly, the inner cuticle of the anthers of the NtCYP704B1-T / S mutant was smooth, lacking the dense, granular Wurtz bodies. The anther cuticle is an extracellular lipid layer covering the anther surface, protecting it from external abiotic stresses, internal tissue dehydration, and pathogen invasion. Wurtz bodies, located on the inner wall of the anther, are believed to transport sporopollenin precursors from the tapetum cells to the microspores. The above results indicate that simultaneous mutation of NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes can affect the formation of anther cuticle and block the synthesis of pollen precursors in the tapetum.

[0096] Example 3: Development and application of primer combinations for molecular marker screening

[0097] In the present invention, a PCR primer combination or a KASP primer combination was developed targeting the mutation sites of the two genes in the obtained NtCYP704B1-T / S double-mutant sterile line.

[0098] The PCR primer combination includes a first PCR primer set and a second PCR primer set;

[0099] The first PCR primer set consists of three primers whose nucleotide sequences are shown as SEQ ID NOs. 21-23; the second PCR primer set consists of three primers whose nucleotide sequences are shown as SEQ ID NOs. 24-26 (see Table 1).

[0100] Table 1 Primer sequences in PCR primer combinations

[0101]

[0102]

[0103] The first PCR primer set is used to amplify the SNP site at 103 bp of tobacco NtCYP704B1-T, and insert a base A at this site; the second PCR primer set is used to amplify the SNP site at 99 bp of tobacco NtCYP704B1-S, and insert a base T at this site;

[0104] The KASP primer combination uses a KASP41_T / S primer set; the KASP41_T / S primer set includes a KASP41_T primer set and a KASP41_S primer set; the KASP41_T primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.23; the KASP41_S primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.29, SEQ ID NO.30, and SEQ ID NO.26; the specific nucleotide sequences are shown in Table 2:

[0105] Table 2 Primer sequences in KASP primer combination

[0106]

[0107] The KASP primer combination for screening tobacco nuclear male sterile lines consists of two primer sets, each consisting of three primers: a first upstream primer, a second upstream primer, and a downstream primer, designed to amplify a single single nucleotide polymorphism (SNP). The last base at the 3' end of the first upstream primer corresponds to the SNP genotype of tobacco K326; the last base at the 3' end of the second upstream primer corresponds to the SNP genotype of the tobacco NtCYP704B1-T / S double-mutant male sterile line. In each primer set, the first upstream primer contains a FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) at its 5' end, and the second upstream primer contains a HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT) at its 5' end.

[0108] The KASP41_T primer set is used to amplify the SNP site at 103 bp of tobacco NtCYP704B1-T and insert a base A at this site; the KASP41_S primer set is used to amplify the SNP site at 99 bp of tobacco NtCYP704B1-S and insert a base T at this site.

[0109] In this embodiment, a PCR primer combination is used to detect seedling materials of the F2 tobacco plants, and the screening method includes the following steps:

[0110] a) extracting DNA from leaves of tobacco plants in the F2 population;

[0111] b) performing PCR amplification on the tobacco DNA using the PCR primer set;

[0112] c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco, and screening the SNP site to be the NtCYP704B1_41 genotype of both the first PCR primer set and the second PCR primer set, which is a new sterile line;

[0113] The SNP site is a maintainer line when the first PCR primer set is NtCYP704B1_41 genotype and the second PCR primer set is heterozygous, or when the second PCR primer set is NtCYP704B1_41 genotype and the first PCR primer set is heterozygous.

[0114] In this embodiment, the molecular marker screening uses a kit to detect seedling materials of F2 tobacco plants; the kit includes the PCR primer combination or the KASP primer combination.

[0115] When the kit includes the KASP primer combination, the kit also includes a PCR premix; the PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;

[0116] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer combination, and the 5' end of the first fluorescent probe is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first tag sequence, and the 3' end of the first quencher probe is connected to the quencher group;

[0117] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer combination, and the 5' end of the second fluorescent probe is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second tag sequence, and the 3' end of the second quencher probe is connected to the quencher group.

[0118] In an embodiment of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0119] In this embodiment, the kit is used to detect the seedling materials of the F2 tobacco plants, and the screening method includes the following steps:

[0120] a) extracting DNA from leaves of tobacco plants in the F2 population;

[0121] b) adding a KASP primer set and a PCR premix to DNA from leaves of tobacco plants in the F2 population to perform KASP amplification;

[0122] c) detecting fluorescence signals to determine the genotypes of the new sterile and maintainer tobacco lines at the SNP sites amplified by each KASP primer set, screening for SNP sites where both the first and second PCR primer sets have the NtCYP704B1_41 genotype, indicating a new sterile line; screening for SNP sites where the first PCR primer set has the NtCYP704B1_41 genotype and the second PCR primer set is heterozygous, or where the second PCR primer set has the NtCYP704B1_41 genotype and the first PCR primer set is heterozygous, indicating a maintainer line. The new sterile and maintainer lines are hybrids and backcrosses of a donor parent, NtCYP704B1_41 tobacco, and a recipient parent, such as common tobacco, K326.

[0123] The method for SNP labeling using the KASP41_T / S primer set provided in this example includes:

[0124] Preparation of KASP primer working solution: Take 12 μL (100 μM) of each upstream primer (first upstream primer, second upstream primer) and 30 μL (100 μM) of downstream primer, add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP primer working solution.

[0125] PCR system: 2 μL DNA template (about 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.02X Master Mix (LGC, product number LGC-KBS-1050-132), and add sterile ultrapure water to 5 μL.

[0126] PCR program: Step 1, pre-denaturation at 95°C for 15 min; Step 2, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for a total of 32 cycles; Storage at 10°C.

[0127] A blank control (NTC) without adding DNA template to the PCR system was also set up in the experiment, and one blank control was set up for each primer set.

[0128] The PCR results are as follows: After the reaction, the amplified products were amplified using a fluorescence microplate reader (FLUOstar OPTIMA, BMG Labtech, Germany), and the fluorescence signal data was read using SNPviewer software to determine the genotype. Figure 11As shown, if the fluorescence signal data of the amplified product of the tobacco to be tested is close to the X-axis after SNPviewer analysis, the genotype of the tobacco to be tested is the K326 parental type; if the fluorescence signal data of the amplified product of the tobacco to be tested is close to the Y-axis after SNPviewer analysis, the genotype of the tobacco to be tested is the NtCYP704B1-T / S double-mutant sterile line parental type; if the fluorescence signal data of the amplified product of the tobacco to be tested is close to the diagonal after SNPviewer analysis, the genotype of the tobacco to be tested is heterozygous; the fluorescence signal data of the amplified product of the negative control after SNPviewer analysis appears black near the origin. Therefore, the SNP typing results screened using the KASP41_T / S primer set provided in this example are consistent with the genotype and have good typing effect.

[0129] Validation of SNP markers for screening of tobacco nuclear male sterile lines:

[0130] The SNP markers used for screening tobacco nuclear male sterile lines were verified using the F2 segregating population of the hybridization and self-pollination progeny of NtCYP704B1-41 and K326.

[0131] The KASP41_T / S primer set was used to test the DNA of 376 plants. The two homozygous parents (NtCYP704B1-41 and K326) and the F1 generation plants obtained by their hybridization were used as controls, and ultrapure water without DNA was used as a negative control. Figure 12 shown. Figure 12 In the typing results for each primer set, the sample in the upper left corner is homozygous for NtCYP704B1-41, the sample in the lower right corner is homozygous for K326, the sample in the middle diagonal position is heterozygous, and the sample in the lower left corner is unamplified. A total of 414 samples were analyzed, including 376 F2 tobacco DNA samples, 2 NtCYP704B1-41 DNA samples, 2 K326 DNA samples, 2 NtCYP704B1-41 × K326 F1 DNA samples, and 2 ultrapure water samples without DNA added as negative controls.

[0132] Compared to traditional marker screening, the KASP primer set developed in this invention offers advantages such as high accuracy, low cost, and high detection efficiency, making it suitable for large-scale screening of sterile and maintainer tobacco lines. The identification method using the KASP primer set of this invention enables early generation screening of sterile and maintainer lines and hybrid breeding, significantly shortening the breeding cycle for sterile line conversion and improving breeding efficiency.

[0133] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For ordinary technicians in this field, they can still modify or improve the technical solutions described above, which all fall within the scope of protection of the present invention.

Claims

1. A gene mutant for controlling tobacco male sterility, characterized in that: The gene mutant is obtained by simultaneously mutating two paralogous genes NtCYP704B1-T and NtCYP704B1-S of the tobacco male sterility-related gene NtCYP704B1; Compared with the gene NtCYP704B1-T whose nucleotide sequence is shown in SEQ ID NO.1, the nucleotide sequence of the NtCYP704B1-T mutant gene has an A inserted after the 103rd base; compared with the gene NtCYP704B1-S whose nucleotide sequence is shown in SEQ ID NO.2, the nucleotide sequence of the NtCYP704B1-S mutant gene has a T inserted after the 99th base; the nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; and the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.

6.

2. A gene mutant for controlling tobacco male sterility according to claim 1, characterized in that: The amino acid sequences encoded by the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

3. The use of a gene mutant for controlling tobacco male sterility according to claim 1 or 2, characterized in that: The tobacco male sterile gene mutant is used in creating tobacco male sterile lines.

4. A method for creating a tobacco male sterile line, characterized in that: The method comprises: using a CRISPR / Cas9 method to simultaneously perform gene editing on two paralogous genes of the NtCYP704B1 gene, NtCYP704B1-T and NtCYP704B1-S, to obtain a gene editing vector; and using Agrobacterium-mediated transfection to obtain an NtCYP704B1-T / S double-mutant sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited. Among them, after gene editing using the CRISPR / Cas9 method, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown as SEQ ID NO.5 and SEQ ID NO.6, respectively.

5. The method for creating a tobacco male sterile line according to claim 4, characterized in that: When using the CRISPR / Cas9 method for gene editing, a CRISPR / Cas9 vector editing target site with a nucleotide sequence as shown in SEQ ID NO.9 and SEQ ID NO.10 is designed at the first exon and homologous region of the NtCYP704B1-T gene and the NtCYP704B1-S gene.

6. The method for creating a tobacco male sterile line according to claim 4, characterized in that: An upstream primer NtCYP704B1-TF and a downstream primer NtCYP704B1-TR were designed for detecting the target site of the NtCYP704B1-T gene. The sequences of the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively. An upstream primer NtCYP704B1-SF and a downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR are shown as SEQ ID NO.17 and SEQ ID NO.18, respectively.

7. Use of the NtCYP704B1-T / S double-mutant sterile line prepared according to the method according to any one of claims 4 to 6 in hybrid breeding and seed production.

8. The application according to claim 9, characterized in that: The application in hybrid breeding and seed production refers to using the NtCYP704B1-T / S double-mutant sterile line as the female parent to hybridize with other male parents to obtain fertile hybrid seeds F1, and then using the hybrid seeds F1 for production and planting.

9. The application according to claim 7, characterized in that: Using molecular marker screening to specifically detect mutant genes in the NtCYP704B1-T / S double-mutant sterile line and tobacco sterile materials bred from the NtCYP704B1-T / S double-mutant sterile line; The molecular marker screening adopts a primer combination to detect seedling materials of tobacco plants to be tested; the primer combination is a PCR primer combination or a KASP primer combination.

10. The use according to claim 9, characterized in that: The PCR primer combination includes a first PCR primer set and a second PCR primer set; The first PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs. 21-23; the second PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs. 24-26; The KASP primer combination adopts the KASP41_T / S primer set; the KASP41_T / S primer set includes a KASP41_T primer set and a KASP41_S primer set; the KASP41_T primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.23; the KASP41_S primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.29, SEQ ID NO.30, and SEQ ID NO.26.

Images