Data processing device and system for detecting aging degree and application of data processing device and system

Abstract

The invention discloses a data processing device and system for detecting the aging degree and application of the data processing device and system. The technical problem to be solved is to detect the aging degree of an organism to be tested or cells to be tested. Specifically disclosed is a device, the device comprising: M1, a migration body condition acquisition module for acquiring the migration body condition of a subject body or a subject cell, the migration body condition comprising the number of migration bodies or the content of the migration bodies; the result output module is used for comparing the condition of the migration body of the tested organism or the tested cell with a reference value and giving a result, and the result comprises at least one of the following: C1, the aging degree of the organism or the cell; c2, physiological age of the organism or the cell, C3, whether the organism or the cell suffers from the senescence-related disease or not or the risk of the senescence-related disease, and C4, the senescence and / or age-related disease early-warning result can be judged through the device, and the senescence degree of the tested organism or the tested cell can be judged through the device.

Description

Technical Field

[0001] The present invention specifically relates to a data processing device, system and application thereof for detecting the degree of aging. Background Art

[0002] Aging generally refers to the process of functional decline in various tissues and organs within an organism and is a major risk factor for many chronic diseases, including cardiovascular disease, neurodegenerative diseases, diabetes, atherosclerosis, osteoarthritis, and chronic kidney disease. Therefore, identifying age-related aging markers and regulating the molecular mechanisms involved in aging are crucial for establishing a scientific aging assessment and early warning platform and for treating age-related diseases. Summary of the Invention

[0003] The technical problem solved by the present invention is how to detect the degree of cell aging.

[0004] In order to solve the above problems, the present invention provides a device

[0005] The device has at least one of the following uses:

[0006] B1. Identify or assist in identifying the degree of aging of an organism or cell;

[0007] B2. Assess the physiological age of an organism or cell;

[0008] B3. Diagnosis or auxiliary diagnosis of aging-related diseases;

[0009] B4. Early warning of aging and / or age-related diseases;

[0010] The device comprises:

[0011] M1. Migratoria status receiving module: used to receive the migratoria status of the test organism or test cells, wherein the migratoria status includes the formation of migratoria or the contents of migratoria;

[0012] M2. Result output module: used to compare the migratoria status of the subject or the test cell with the reference value, and output at least one of the following information from the computer based on the comparison result:

[0013] B1-1, the degree of aging of the body or cells,

[0014] B2-1, the physiological age of the body or cells,

[0015] B3-1. Do you have aging-related diseases or are at risk of aging-related diseases?

[0016] B4-1. Warning results of aging and / or age-related diseases.

[0017] The reference value is obtained by detecting the reference object or reference cell, and the reference value can be at least one of the following:

[0018] W1, the number of migratory bodies in each test cell;

[0019] W2, the number of migrasomes containing endogenous retroviruses in each test cell;

[0020] W3, the number of migratory bodies containing mitochondrial outer membrane proteins in each test cell;

[0021] W4, the number of migrasomes containing inflammatory factors in each test cell;

[0022] In the above, the degree of aging of the organism or cells can be determined by the percentage of migrasomes containing β-galactosidase in each test cell.

[0023] The reference object may be a cell or tissue. The reference cell may be a mesenchymal stem cell and / or a fibroblast.

[0024] In order to solve the above problems, the present invention also provides a device.

[0025] The device has at least one of the following uses:

[0026] A1. Compare the degree of aging of organisms or cells;

[0027] A2. Compare the physiological age of organisms or cells;

[0028] Characterized in that the device comprises:

[0029] M1. Migratoria status receiving module: used to receive migratoria status of two or more test subjects or test cells, wherein the migratoria status includes the formation of migratoria or the inclusion of contents;

[0030] M2, score calculation module: used to calculate the score according to the status of the migrator; the score is at least one of the following:

[0031] 1) Number of migratory bodies per cell;

[0032] 2) The content of positive migrasomes per cell; the positive migrasomes are migrasomes containing specific contents, such as endogenous retroviruses, inflammatory factors, and / or mitochondrial outer membrane proteins;

[0033] M3, result output module: used to output at least one of the following comparison results from the computer according to the score:

[0034] D1. The degree of aging of the body or cells;

[0035] D2. Physiological age of the body or cells.

[0036] In the above device, the score is at least one of the following:

[0037] A1, the number of migrasomes in each test cell;

[0038] A2, the number of migrasomes containing endogenous retrovirus in each test cell;

[0039] A3, the number of migratory bodies containing mitochondrial outer membrane proteins in each test cell;

[0040] A4, the number of migrasomes containing inflammatory factors in each test cell;

[0041] In the above, the comparison result in D1 is that the aging degree of the organism or cell with a high score is higher or is higher than that of the organism or cell with a low score.

[0042] In the above text, the unit of the number of migratory bodies is piece.

[0043] In the above, the number of migratory bodies can be detected by methods such as electron transmission microscopy, immunofluorescence staining, and Western blotting to detect migratory body markers. In some embodiments, the above-mentioned migratory body markers include TSPAN4 and wheat germ agglutinin (WGA). In addition, the migratory body markers also include CD63 and integrin α5.

[0044] In the above, the TSPAN4 can be detected by TSPAN4 antibody. The wheat germ agglutinin can be detected by fluorescently labeled WGA or wheat germ agglutinin antibody. The fluorescently labeled WGA can be Alexa Fluor TM 555-conjugated WGA. Alexa Fluor TM 555-conjugated WGA was purchased from Thermo Fisher Scientific.

[0045] In the above, the content of positive migratory bodies per cell in 2) of M2 may be the number of positive migratory bodies per cell or the percentage of positive migratory bodies per cell.

[0046] In the above, the endogenous retroviruses described in 2) of M2 include the genetic material, transcription products, protein levels, specific proteins and / or viral particles of endogenous retroviruses. The genetic material of the endogenous retrovirus may be double-stranded RNA (dsRNA), which can be detected by immunofluorescence technology, and the transcription products of the endogenous retrovirus include HERVK RNA levels, which can be detected by real-time quantitative polymerase chain reaction (qRT-PCR) and other technologies. The double-stranded RNA (dsRNA) can be detected by double-stranded RNA (dsRNA) antibodies. The double-stranded RNA (dsRNA) antibodies can be detected by mouse anti-dsRNA. The mouse anti-dsRNA is purchased from Kerafast. The specific protein may be an endogenous retroviral envelope protein. The endogenous retroviral envelope protein may be the endogenous retroviral envelope protein HERVK-Env. The endogenous retroviral envelope protein can be detected by endogenous retroviral envelope protein antibodies. The endogenous retroviral envelope protein antibody can be mouse anti-HERVK-Env, which is purchased from Austral Biologicals.

[0047] In the above, the inflammatory factors described in 2) of M2 include interleukin IL1β and / or IL6, etc. They can be detected by immunofluorescence or qRT-PCR. Interleukin IL1β can be detected using an IL1β antibody. The IL1β antibody is mouse anti-IL1β. The mouse anti-IL1β is purchased from Santa Cruz Biotechnology. Interleukin IL6 can be detected using an IL6 antibody. The IL6 antibody is mouse anti-IL6. The mouse anti-IL6 is purchased from Santa Cruz Biotechnology.

[0048] In the above, the mitochondrial outer membrane protein in 2) of M2 can be mitochondrial outer membrane protein Tom20. The mitochondrial outer membrane protein Tom20 can be detected by mitochondrial outer membrane protein Tom20 antibody. The mouse anti-Tom20 antibody was purchased from SantaCruz Biotechnology.

[0049] In order to solve the above problems, the present invention also provides a method.

[0050] The method is any of the following:

[0051] B1. Methods for identifying or assisting in identifying the degree of aging of an organism or cell;

[0052] B2. Methods for assessing the physiological age of an organism or cell;

[0053] B3. Methods for diagnosing or assisting in the diagnosis of aging-related diseases;

[0054] B4. Methods for early warning of aging and / or age-related diseases;

[0055] The method comprises:

[0056] S1. Receiving migratoria status: Receiving migratoria status of the subject or test cells, wherein the migratoria status includes the formation of migratoria or the inclusion of contents;

[0057] S2. Result output module: Compare the migratoria status of the subject or the test cell with a reference value, and output at least one of the following information from a computer based on the comparison result:

[0058] B1-1, the degree of aging of the body or cells;

[0059] B2-1, physiological age of the body or cell;

[0060] B3-1. Whether you suffer from aging-related diseases or are at risk of aging-related diseases;

[0061] B4-1. Warning results of aging and / or age-related diseases.

[0062] In order to solve the above problems, the present invention also provides a system.

[0063] The system includes the above-mentioned device and substance, wherein the substance is at least one of the following:

[0064] 1) Reagents and / or instruments for detecting migratory bodies;

[0065] 2) Reagents and / or instruments for detecting the above-mentioned specific contents.

[0066] In the above, the number of migratory bodies can be detected by methods such as electron transmission microscopy, immunofluorescence staining, and Western blotting to detect migratory body markers. In some embodiments, the above-mentioned migratory body markers include TSPAN4 and wheat germ agglutinin (WGA). In addition, the migratory body markers also include CD63 and integrin α5.

[0067] In the above, the TSPAN4 can be detected by TSPAN4 antibody. The wheat germ agglutinin can be detected by fluorescently labeled WGA or wheat germ agglutinin antibody. The fluorescently labeled WGA can be Alexa Fluor TM 555-conjugated WGA. Alexa Fluor TM 555-conjugated WGA was purchased from Thermo Fisher Scientific.

[0068] In the above, the inclusions may be endogenous retroviruses (including HERVK), including the genetic material, transcription products, protein levels, and / or viral particles of the endogenous retrovirus. The genetic material of the endogenous retrovirus may be double-stranded RNA (dsRNA), which can be detected by immunofluorescence techniques. The transcription products of the endogenous retrovirus, including HERVK RNA levels, can be detected by techniques such as real-time quantitative polymerase chain reaction (qRT-PCR). The double-stranded RNA (dsRNA) can be detected using double-stranded RNA (dsRNA) antibodies. The double-stranded RNA (dsRNA) antibodies can be detected using mouse anti-dsRNA. The mouse anti-dsRNA was purchased from Kerafast. The specific protein may be an endogenous retroviral envelope protein. The endogenous retroviral envelope protein can be detected using an endogenous retroviral envelope protein antibody. The endogenous retroviral envelope protein antibody may be mouse anti-HERVK-Env. The mouse anti-HERVK-Env was purchased from Austral Biologicals.

[0069] The above-mentioned endogenous retroviral protein levels include envelope protein, and / or capsid protein (gag) and reverse transcriptase (Pol), which can be detected by techniques such as immunofluorescence staining and Western blotting. The retroviral envelope protein can be the endogenous retroviral envelope protein HERVK-Env. Detection can be performed using a retroviral envelope protein antibody. The retroviral envelope protein antibody can be mouse anti-HERVK-Env. The mouse anti-HERVK-Env was purchased from Austral Biologicals.

[0070] The above-mentioned endogenous retroviral particles can be observed through an electron transmission microscope.

[0071] In the above, the inclusions may be inflammatory factors, including interleukin IL1β and / or IL6. These can be detected by immunofluorescence and qRT-PCR. Interleukin IL1β can be detected using an IL1β antibody. The IL1β antibody is mouse anti-IL1β. The mouse anti-IL1β antibody is purchased from Santa Cruz Biotechnology. Interleukin IL6 can be detected using an IL6 antibody. The IL6 antibody is mouse anti-IL6. The mouse anti-IL6 antibody is purchased from Santa Cruz Biotechnology.

[0072] In the above, the inclusions may be mitochondria, including the mitochondrial outer membrane protein Tom20. The mitochondrial outer membrane protein Tom20 can be detected using an antibody against the mitochondrial outer membrane protein Tom20. The mouse anti-Tom20 antibody was purchased from Santa Cruz Biotechnology. Detection can be performed using techniques such as immunofluorescence and transmission electron microscopy. In some embodiments, the reference value is obtained by testing a reference subject or reference cell.

[0073] In the above, the reference value is obtained by detecting a reference object or a reference cell. The reference object can be a cell or tissue. The reference cell can be a mesenchymal stem cell and / or a fibroblast.

[0074] The mesenchymal stem cells may be human mesenchymal stem cells. The human mesenchymal stem cells specifically refer to replicative aging mesenchymal stem cells obtained by continuous passage, and / or Hutchinson-Gilford progeria syndrome (HGPS, LMNA) obtained by gene editing. G608G / + ) mesenchymal stem cells, and / or inducing senescent mesenchymal stem cells by hydrogen peroxide (H2O2). The fibroblasts may be human fibroblasts. The human fibroblasts may be human skin fibroblasts.

[0075] In the above, the number of migrasomes containing endogenous retrovirus in each test cell can be any of the following:

[0076] Z1) The number of migratory bodies containing double-stranded RNA in each test cell;

[0077] Z2) The number of migrasomes containing endogenous retroviral membrane proteins per test cell.

[0078] The endogenous retroviral membrane protein may be HERVK protein;

[0079] In the above, the number of migrasomes containing inflammatory factors in each test cell can be any of the following:

[0080] X1) The number of migrasomes containing interleukin IL-1β in each test cell;

[0081] X2) The number of IL6-containing migrasomes in each test cell;

[0082] In the above, the number of migrating bodies containing mitochondrial outer membrane protein in each test cell may be: the number of migrating bodies containing mitochondrial outer membrane protein Tom20 in each test cell.

[0083] In any of the above devices, methods or systems, the test cells are mesenchymal stem cells, fibroblasts and / or.

[0084] In order to solve the above problem, the present invention further provides a computer-readable storage medium storing a computer program.

[0085] The computer program enables a computer to execute the steps of the above method.

[0086] In the above system, the system further includes the following substances.

[0087] In order to solve the above problems, the present invention also provides a substance.

[0088] The substance is any of the following:

[0089] Y1. Substances for detecting the amount of migratory bodies;

[0090] Y2. Detection of endogenous retroviral substances in migrating bodies;

[0091] Y3. Detection of substances containing inflammatory factors in migratory bodies

[0092] Y4. Detect substances of mitochondrial outer membrane proteins in mitosomes.

[0093] In order to solve the above problems, the present invention also provides the following applications.

[0094] The substance is used in any of the following applications:

[0095] A1. Application in screening for cell senescence or preparing products for cell senescence;

[0096] A2. Application in the diagnosis of cell aging or in the preparation of products for cell aging;

[0097] A3. Application in assessing the risk of cellular senescence or preparing products for assessing the risk of cellular senescence;

[0098] A4. Application in the assessment of cell senescence or in the preparation of products for the assessment of cell senescence;

[0099] A5. Application in identifying and differentiating the degree of cell senescence or in preparing products for identifying the degree of cell senescence;

[0100] The substance may be any of the following:

[0101] Y1. Substances for detecting the amount of migratory bodies;

[0102] Y2. Detection of endogenous retroviral substances in migrating bodies;

[0103] Y3. Detection of substances containing inflammatory factors in migratory bodies

[0104] Y4. Detect substances of mitochondrial outer membrane proteins in mitosomes.

[0105] In the above, the reference value is obtained by detecting a reference object or a reference cell. The reference object can be a cell or a tissue. The reference cell can be a mesenchymal stem cell and / or a fibroblast and / or.

[0106] In the above, the mesenchymal stem cells may be human mesenchymal stem cells. The human mesenchymal stem cells specifically refer to replicative aging mesenchymal stem cells obtained by continuous passage, and / or Hutchinson-Gilford progeria syndrome (HGPS, LMNA) obtained by gene editing. G608G / + ) mesenchymal stem cells, and / or inducing senescent mesenchymal stem cells by hydrogen peroxide (H2O2). The fibroblasts may be human fibroblasts. The human fibroblasts may be human skin fibroblasts.

[0107] In the above, the number of migrasomes containing endogenous retrovirus in each test cell can be any of the following:

[0108] Z1) The number of migratory bodies containing double-stranded RNA in each test cell;

[0109] Z2) The number of migrasomes containing endogenous retroviral membrane proteins per test cell.

[0110] The endogenous retroviral membrane protein may be HERVK protein;

[0111] In the above, the number of migrasomes containing inflammatory factors in each test cell can be any of the following:

[0112] X1) The number of migrasomes containing interleukin IL-1β in each test cell;

[0113] X2) The number of IL6-containing migrasomes in each test cell;

[0114] In the above, the number of migrating bodies containing mitochondrial outer membrane protein in each test cell may be: the number of migrating bodies containing mitochondrial outer membrane protein Tom20 in each test cell.

[0115] In the above text, the unit of the number of migratory bodies is piece.

[0116] In the above, the number of migratory bodies can be detected by methods such as electron transmission microscopy, immunofluorescence staining, and Western blotting to detect migratory body markers. In some embodiments, the above-mentioned migratory body markers include TSPAN4 and wheat germ agglutinin (WGA). In addition, the migratory body markers also include CD63 and integrin α5.

[0117] In the above, the TSPAN4 can be detected by TSPAN4 antibody. The wheat germ agglutinin can be detected by fluorescently labeled WGA or wheat germ agglutinin antibody. The fluorescently labeled WGA can be Alexa Fluor TM 555-conjugated WGA. Alexa Fluor TM 555-conjugated WGA was purchased from Thermo Fisher Scientific.

[0118] In the above, the content of positive migratory bodies per cell in 2) of M2 may be the number of positive migratory bodies per cell or the percentage of positive migratory bodies per cell.

[0119] In the above, the endogenous retroviruses described in 2) of M2 include the genetic material, transcription products, protein levels, specific proteins and / or viral particles of endogenous retroviruses. The genetic material of the endogenous retrovirus may be double-stranded RNA (dsRNA), which can be detected by immunofluorescence technology, and the transcription products of the endogenous retrovirus include HERVK RNA levels, which can be detected by real-time quantitative polymerase chain reaction (qRT-PCR) and other technologies. The double-stranded RNA (dsRNA) can be detected by double-stranded RNA (dsRNA) antibodies. The double-stranded RNA (dsRNA) antibodies can be detected by mouse anti-dsRNA. The mouse anti-dsRNA is purchased from Kerafast. The specific protein may be an endogenous retroviral envelope protein. The endogenous retroviral envelope protein may be the endogenous retroviral envelope protein HERVK-Env. The endogenous retroviral envelope protein can be detected by endogenous retroviral envelope protein antibodies. The endogenous retroviral envelope protein antibody can be mouse anti-HERVK-Env, which is purchased from Austral Biologicals.

[0120] In the above, the inflammatory factors described in 2) of M2 include interleukin IL1β and / or IL6, among others. These can be detected by immunofluorescence or qRT-PCR. Interleukin IL1β can be detected using an IL1β antibody. The IL1β antibody is a mouse anti-IL1β antibody. The mouse anti-IL1β antibody is purchased from Santa Cruz Biotechnology. Interleukin IL6 can be detected using an IL6 antibody. The IL6 antibody is a mouse anti-IL6 antibody. The mouse anti-IL6 antibody is purchased from Santa Cruz Biotechnology.

[0121] In the above, the mitochondrial outer membrane protein in 2) of M2 can be mitochondrial outer membrane protein Tom20. The mitochondrial outer membrane protein Tom20 can be detected by mitochondrial outer membrane protein Tom20 antibody. The mouse anti-Tom20 antibody was purchased from SantaCruz Biotechnology.

[0122] The above applications or methods are non-disease diagnosis applications or methods. The above applications or methods are not directly intended to obtain disease diagnosis results or health status of living human or animal bodies.

[0123] The above-mentioned applications or methods are not for the purpose of treating diseases. The above-mentioned applications or methods are not intended to restore or obtain health or alleviate suffering in living humans or animals.

[0124] The sample to be tested in the above application may be a sample from a non-living human or animal body, such as an environmental sample (such as air) or a food (such as frozen food or fresh food).

[0125] Beneficial effects

[0126] Recent research has systematically and creatively proposed twelve hallmarks of aging, including stem cell exhaustion, altered intercellular communication, chronic inflammation, and mitochondrial dysfunction. Altered intercellular communication is a newly recognized hallmark of aging. Our recent research has identified human endogenous retroviruses (HERVs) as novel biomarkers and drivers of aging. HERVs are remnants of ancient retroviruses that infected humans and integrated into the human genome, becoming fixed in place during evolution and comprising approximately 8% of the human genome. We have found that epigenetic derepression in senescent cells leads to transcriptional activation of HERVs within the genome, which translate into viral proteins and are then packaged into viral particles. HERV reverse transcriptases in senescent cells induce cellular senescence and inflammation by activating the cGAS-STING innate immune pathway. Furthermore, ERV particles released by senescent cells can effectively transmit and amplify aging signals across organs, tissues, and cells through paracrine or humoral pathways, ultimately causing young cells to become "infected" and age. However, the molecular mechanisms by which senescent cells transmit HERVs and other aging-associated factors to young cells to promote intercellular communication and amplify pro-aging signals remain largely unknown.

[0127] Migrasomes are recently discovered pomegranate-like vesicular structures with diameters ranging from 0.5 to 3 microns that are present in various migrating cell types. Migrasomes originate from localized swellings on retractile fibers, forming stable structures by enriching the tetraspanin TSPAN4. Upon rupture of the retractile fibers, these structures are released into the media and ultimately taken up by neighboring cells in a process known as migracytosis. Migrasomes are enriched with a variety of cytoplasmic contents, including cytokines, chemokines, growth factors, mRNA, proteins, and damaged mitochondria. In addition to participating in cell migration, migrasomes have numerous important physiological functions: they maintain mitochondrial homeostasis by clearing damaged mitochondria; released migrasomes remain in place until rupture or are engulfed by other cells, thereby enabling intercellular material transfer; and migrasomes contain a large number of signaling molecules, participating in intercellular signal integration. Current research indicates that migrasomes play an important role in signaling during embryonic development, immune responses, and cancer metastasis. However, the formation and function of migrasomes during cellular aging remain unclear.

[0128] The inventors unexpectedly discovered that the number of migratory bodies is associated with cell aging and is rich in aging-related signaling factors such as damaged mitochondria, endogenous retroviruses and inflammatory factors. They can serve as biological markers of individual and cellular aging, as well as potential targets for anti-aging treatments.

[0129] The present invention discloses a data processing device, system and application for detecting the degree of aging, and the technical problem solved is to detect the degree of aging of a test organism or test cell. Specifically disclosed is a device, which includes: M1, a migrator status acquisition module: used to obtain the migrator status of the test organism or test cell, the migrator status including the number of migrators or the contents contained in the migrator; M2, a result output module: used to compare the migrator status of the test organism or test cell with a reference value and give a result, the result including at least one of the following: C1, the degree of aging of the organism or cell; C2, the physiological age of the organism or cell, C3, whether suffering from aging-related diseases or the risk of aging-related diseases, C4, aging and / or age-related disease warning results. The above device can be used to determine the degree of aging of the test organism or test cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0130] Figure 1 Figure 3 Senescence-associated β-galactosidase (SA-β-gal) staining in early- and late-passage wild-type replicatively senescent human mesenchymal stem cells (A) and transmission electron microscopy observation of early- and late-passage wild-type human mesenchymal stem cell migratory bodies (B).

[0131] Figure 2Immunofluorescence staining of wheat germ agglutinin (WGA) in early and late passage wild-type replicatively senescent human mesenchymal stem cells (A), and GFP green fluorescence detection in early and late passage wild-type replicatively senescent human mesenchymal stem cells infected with green fluorescent-tagged TSPAN4-GFP (B).

[0132] Figure 3 Immunofluorescence (A) and electron microscopy negative staining (B) were used to observe the morphology of migrasomes purified from early and late passage wild-type replicatively senescent human mesenchymal stem cells infected with TSPAN4-GFP and labeled with green fluorescence, and Western blotting was used to detect the content of purified migrasomes (C).

[0133] Figure 4 Senescence-associated-β-galactosidase (SA-β-gal) staining (A) and wheat germ agglutinin (WGA) immunofluorescence staining (B) were performed in wild-type WT and Hutchinson-Gilford progeria syndrome HGPS mesenchymal stem cells, and GFP green fluorescence detection was performed in wild-type and HGPS human mesenchymal stem cells infected with green fluorescent-tagged TSPAN4-GFP (C).

[0134] Figure 5 Figure 3 Senescence-associated-β-galactosidase (SA-β-gal) staining (A) and wheat germ agglutinin (WGA) immunofluorescence staining (B) in wild-type mesenchymal stem cells after hydrogen peroxide (H2O2) treatment.

[0135] Figure 6 Figure 3 Senescence-associated β-galactosidase (SA-β-gal) staining (A) and wheat germ agglutinin (WGA) immunofluorescence staining (B) in early- and late-passage replicative senescent human fibroblasts.

[0136] Figure 7 Co-immunofluorescence staining of the endogenous retroviral envelope protein HERVK-Env and wheat germ agglutinin (WGA) was performed in early- and late-passage wild-type replicatively senescent human mesenchymal stem cells (A). Immunofluorescence staining of the endogenous retroviral envelope protein HERVK-Env (B) and Western blotting (C) were performed in early- and late-passage wild-type replicatively senescent human mesenchymal stem cells infected with green fluorescent-labeled TSPAN4-GFP.

[0137] Figure 8 Figure 3 Immunofluorescence co-staining of the endogenous retroviral envelope protein HERVK-Env and wheat germ agglutinin (WGA) in wild-type and HGPS human mesenchymal stem cells (A), hydrogen peroxide (H2O2)-treated wild-type mesenchymal stem cells (B), and early and late passage replicatively senescent human fibroblasts (C).

[0138] Figure 9 Co-immunofluorescence staining of double-stranded RNA (dsRNA) and wheat germ agglutinin (WGA) was performed in early- and late-passage wild-type replicatively senescent human mesenchymal stem cells (A), in early- and late-passage wild-type replicatively senescent human mesenchymal stem cells infected with green fluorescent-labeled TSPAN4-GFP (B), and in wild-type and HGPS human mesenchymal stem cells (C).

[0139] Figure 10 Immunofluorescence co-staining of interleukin IL1β and wheat germ agglutinin (WGA) was performed in early and late passage wild-type replicatively senescent human mesenchymal stem cells (A), wild-type and HGPS human mesenchymal stem cells (B), hydrogen peroxide (H2O2)-treated wild-type mesenchymal stem cells (C), and young and old replicatively senescent human fibroblasts (D).

[0140] Figure 11 Immunofluorescence co-staining of interleukin IL6 and wheat germ agglutinin (WGA) was performed in early and late passage wild-type replicatively senescent human mesenchymal stem cells (A) and wild-type mesenchymal stem cells treated with hydrogen peroxide (H2O2) (B).

[0141] Figure 12 Immunofluorescence co-staining of mitochondrial outer membrane protein Tom20 and wheat germ agglutinin (WGA) was performed in early and late passage wild-type replicatively senescent human mesenchymal stem cells (A), wild-type and HGPS human mesenchymal stem cells (B), hydrogen peroxide (H2O2)-treated wild-type mesenchymal stem cells (C), and young and old replicatively senescent human fibroblasts (D).

[0142] Figure 13 Young human mesenchymal stem cells (A) were treated with migrasomes purified from senescent human mesenchymal stem cells infected with green fluorescent-labeled TSPAN4-GFP, and then subjected to immunofluorescence staining (B), quantitative real-time polymerase chain reaction (qRT-PCR, C), senescence-associated-β-galactosidase (SA-β-gal) staining (D), cell detection by qRT-PCR (E), Western blotting (F), and SA-β-gal staining (G).

[0143] Figure 14 A computer flow chart for implementing the method of the present invention for identifying or assisting in identifying the degree of aging of an organism or cell.

[0144] Figure 15 A computer flow chart for implementing the method of comparing the degree of aging of an organism or cell and the method of comparing the physiological age of an organism or cell according to the present invention. DETAILED DESCRIPTION

[0145] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0146] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0147] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0148] The experimental data in the following examples are expressed as mean ± standard error and analyzed using GraphPad Prism 8.0 statistical software.

[0149] The antibodies used in the following examples are conventional commercial antibodies, such as those shown in Table 1:

[0150] Table 1

[0151]

[0152] The primer sequences used in qRT-PCR in the following examples are based on the published paper (Liu X, Liu Z, Wu Z, Ren J et al. Resurrection of endogenous retroviruses during aging reinforces senescence. Cell. 2023), as shown in Table 2 below:

[0153] Table 2

[0154]

[0155] The pLE4-TSPAN4-GFP plasmid used in the following examples is a recombinant vector obtained by replacing the small fragment between the restriction endonuclease ClaI recognition site and the XhoI recognition site of the lentiviral vector pLE4 (Addgene plasmid #12254) with the nucleotide sequence shown in SEQ ID NO: 13 in the sequence listing, while keeping the other sequences of the lentiviral vector pLE4 unchanged. This vector is named pLE4-TSPAN4-GFP plasmid.

[0156] The TSPAN4 cDNA sequence (SEQ ID NO. 13) is as follows:

[0157] ATGGCGCGCGCCTGCCTCCAGGCCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTCTTCTGGCTGGGAGGCTGTGGCGTGCTGGG

[0158] TGTCGGCATCTGGCTGGCCGCCACACAGGGGAGCTTCGCCACGCTGTCCTCTTCCTTCCCGTCCCTGTCGGCTGCCAACTTGCTCATCATC

[0159] ACCGGCGCCTTTGTCATGGCCATCGGCTTCGTGGGCTGCCTGGGTGCCATCAAGGAGAACAAGTGCCTCCTGCTCACTTTCTTCCTGCTGC

[0160] TGCTGCTGGTGTTCCTGCTGGAGGCCACCATCGCCATCCTCTTCTTCGCCTACACGGACAAGATTGACAGGTATGCCCAGCAAGACCTGAA

[0161] GAAAGGCTTGCACCTGTACGGCACGCAGGGCAACGTGGGCCTCACCAACGCCTGGAGCATCATCCAGACCGACTTCCGCTGCTGTGGCGTC

[0162] TCCAACTACACTGACTGGTTCGAGGTGTACAACGCCACGCGGGTACCTGACTCCTGCTGCTTGGAGTTCAGTGAGAGCTGTGGGCTGCACG

[0163] CCCCCGGCACCTGGTGGAAGGCGCCGTGCTACGAGACGGTGAAGGTGTGGCTTCAGGAGAACCTGCTGGCTGTGGGCATCTTTGGGCTGTG

[0164] CACGGCGCTGGTGCAGATCCTGGGCCTGACCTTCGCCATGACCATGTACTGCCAAGTGGTCAAGGCAGACACCTACTGCGCGTAG。

[0165] WT hMSCs were derived from H9 human embryonic stem cells (hESCs) (purchased from WiCell Research Institute, Cat. No. WA09) by directed differentiation. hESCs were dissociated into embryoid bodies (EBs) and then transferred to Matrigel (BD Biosciences)-coated culture dishes in MSC differentiation medium (α-MEM + GlutaMAX (Gibco), 10% FBS (Gemcell, Cat. No. A77E01F), 1% penicillin / streptomycin (Gibco), 10 ng / mL FGF2 (Joint Protein Central), and 5 ng / mL TGFβ (HumanZyme). Approximately 10 days later, cells were transferred to gelatin (Sigma)-coated culture dishes and cultured in MSC medium: 90% α-MEM + Glutmax (Gibco), 10% FBS (Gemcell, Cat. No. A77E01F), 1% penicillin / streptomycin (Gibco), and 1 ng / mL FGF2 (Joint Protein Central). Then, CD73 / CD90 / CD105 triple-positive cells were sorted using a flow cytometer (BD Biosciences) to obtain WT hMSCs.

[0166] Preparation of early passage WT hMSCs (EP WT hMSCs): hESCs (purchased from WiCell Research Institute, catalog number WA09) were placed in culture medium containing 90% MEM Alpha Medium (Thermo Fisher Scientific) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin and 1 ng / mL bFGF2 (Joint Protein Central)] and grown on 0.1% gelatin (Sigma Aldrich)-coated plates (CORNING) at 37°C and 5% CO2. When grown to the fourth passage, the cells had strong monoclonal ability and contained fewer senescence-associated-β-galactosidase-positive cells, and early passage WT hMSCs (EP WT hMSCs) were obtained.

[0167] Preparation of late passage WT hMSCs (LP WT hMSCs): hESCs (purchased from WiCell Research Institute, catalog number WA09) were placed in culture medium containing 90% MEM Alpha Medium (Thermo Fisher Scientific) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin and 1 ng / mL bFGF2 (Joint Protein Central)]. The hESCs were grown on 0.1% gelatin (Sigma Aldrich)-coated plates (CORNING) at 37°C and 5% CO2. At the 13th passage, the cells had weak monoclonal ability and contained a large number of senescence-associated-β-galactosidase-positive cells, and late passage WT hMSCs (LP WT hMSCs) were obtained.

[0168] Preparation of HGPS hMSCs: hESCs (purchased from WiCell Research Institute, catalog number WA09) were obtained by gene editing to produce Hutchinson-Gilford progeria syndrome (HGPS, LMNA G608G / + )hESCs were differentiated into mesenchymal stem cells by the above method to obtain HGPS hMSCs. G608G / + hESCs were derived from a previously published article (Wu et al. Protein Cell, 2018, https: / / link.springer.com / article / 10.1007 / s13238-018-0517-8, Differential stem cell aging kinetics in Hutchinson-Gilford progeria syndrome and Werner syndrome), and were referred to as LMNA in that article. G608G / + ).

[0169] Hydrochloric acid buffer (PBS): 8.0 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na2HPO4 and 0.24 g / L KH2PO4, pH 7.4.

[0170] 2.5% glutaraldehyde: 25% glutaraldehyde (TED PELLA INC, product number 18426) was diluted with hydrochloric acid buffer (PBS) to obtain 2.5% glutaraldehyde by volume.

[0171] PBS buffer containing 0.4% Triton X-100: Triton X-100 was diluted with hydrochloric acid buffer (PBS) to make the content of Triton X-100 2.5% by volume.

[0172] Example 1 Increased Migration Body Formation as a Novel Marker for Assessing Aging

[0173] SA-β-gal staining observation of early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WThMSC):

[0174] Early passage wild-type human mesenchymal stem cells (EP WT hMSCs) and late passage wild-type human mesenchymal stem cells (LPWT hMSCs) were fixed with fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) P, the rest was water) for 5 minutes, the fixative was aspirated, and the cells were washed once with PBS. They were then incubated overnight (12 hours) at 37°C with SA-β-gal staining solution (40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mM MgCl2, 1 mg / mL X-gal, the rest was water). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed using ImageJ software.

[0175] The results are as follows Figure 1 Middle A( Figure 1 Middle A, early passage EP WT hMSCs, late passage LP WT hMSCs. The cell status diagram on the left and the bar graph on the right (percentage of β-galactosidase-positive cells) show that compared with EP WT hMSCs, LP WT hMSCs exhibit an accelerated cellular senescence phenotype. Specifically, LP WT hMSCs exhibit a higher number of SA-β-gal-positive cells.

[0176] 1.1 Transmission electron microscopy observation of the morphology of wild-type replicatively aged mesenchymal stem cell migratory bodies

[0177] The late passage wild-type mesenchymal stem cells (LP WT hMSC) and early passage wild-type mesenchymal stem cells (EP WT hMSC) prepared above were precipitated (1000 rpm, room temperature for 5 min), washed with phosphate buffered saline (PBS, 8.0 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na2HPO4 and 0.24 g / L KH2PO4, pH 7.4), and then treated with phosphate buffered saline containing 2.5% (v / v) glutaraldehyde (PBS, 8.0 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na2HPO4 and 0.24 g / L KH2PO4, pH 7.4) at room temperature. 7.4) Fix the cells for 20 minutes and then incubate at 4°C overnight (12 hours) to obtain fixed late-passage wild-type mesenchymal stem cells and fixed early-passage wild-type mesenchymal stem cells, and then perform conventional heavy metal staining on the fixed late-passage wild-type mesenchymal stem cells and the fixed early-passage wild-type mesenchymal stem cells, respectively.

[0178] The cells (fixed late-passage wild-type MSCs and fixed early-passage wild-type MSCs) were pelleted by centrifugation (1000 rpm, 5 min at room temperature) and fixed with 1% (w / v) osmium tetroxide in phosphate buffered saline for 2 hours at 4°C. After dehydration through a graded ethanol series, the cells were placed in pure acetone and infiltrated in graded mixtures of acetone and resin. The cells were then embedded in pure resin containing 1.5% BDMA and polymerized at 45°C for 12 hours and 60°C for 48 hours. Ultrathin sections (70 nm thickness) were cut using a microtome (Leica EMUC6) and double-stained with uranyl acetate and lead citrate. The sections were then imaged using a 120 kV TEM Spirit (FEI Tecnai Spirit 120 kV), and the number of migratory bodies per cell was analyzed.

[0179] Observe under a transmission electron microscope and count the number of migratory bodies. Migratory body counting: Migratory bodies appear as pomegranate-shaped vesicle structures under the electron microscope. Some migratory bodies contain many smaller vesicles or damaged organelle fragments, while some are vacuoles or connected to retracted fibers, which are recorded as migratory bodies. Figure 1 Middle B( Figure 1 Middle B, late passage represents late-passage wild-type mesenchymal stem cells, early passage represents early-passage wild-type mesenchymal stem cells, the left side is a migratoria status diagram, and the right side is a migratoria number bar graph) shows that compared with early-passage wild-type mesenchymal stem cells, late-passage wild-type mesenchymal stem cells form more migratoria.

[0180] 1.2 Immunofluorescence staining showed an increase in the number of migratory bodies in late-passage wild-type mesenchymal stem cells

[0181] In early and late passage wild-type mesenchymal stem cells, wheat germ agglutinin (WGA) fluorescent probes were used to label migratory bodies, or lentivirus was transfected with the green fluorescent tetraspanin TSPAN4-GFP to observe the changes in the number of migratory bodies.

[0182] The above TSPAN4-GFP lentivirus and infection process are as follows:

[0183] To package the TSPAN4-GFP lentivirus, the pLE4-TSPAN4-GFP plasmid was transfected into HEK293T cells (purchased from ATCC, catalog number CRL-3216) along with the packaging plasmids pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) using Lipofectamine 3000 (Invitrogen). Lentivirus-containing supernatants were harvested 48 and 72 hours after transfection, filtered through a 0.2 μm filter, and concentrated by ultracentrifugation at 19,400 rpm for 2.5 hours. The viral pellet was resuspended and the viral titer was assessed by infecting cells with varying amounts of virus. Optimal titers were achieved when the infection efficiency exceeded 90%. This yielded lentivirus containing the pLE4-TSPAN4-GFP plasmid.

[0184] Preparation of early passage wild-type mesenchymal stem cells (EP WT hMSCs) transfected with pLE4-TSPAN4-GFP: When the EP WThMSCs grew to 50% confluence in the culture dish, they were replaced with a mesenchymal stem cell culture medium containing 90% MEM Alpha Medium (Thermo Fisher Scientific) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin and 1 ng / mL bFGF2 (Joint Protein Central)] with polybrene (Sigma-Aldrich), and the lentivirus containing the pLE4-TSPAN4-GFP plasmid prepared above was added. After incubation for 24 hours, the culture medium was replaced with normal mesenchymal stem cell culture medium to obtain early passage WT hMSCs transfected with pLE4-TSPAN4-GFP (EP WT hMSCs).

[0185] Preparation of late-passage wild-type mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP: When LP WThMSCs grew to 50% density in a culture dish, they were replaced with a mesenchymal stem cell culture medium containing 90% MEM Alpha Medium (Thermo Fisher Scientific) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin and 1 ng / mL bFGF2 (Joint Protein Central)] with polybrene (Sigma-Aldrich), and the lentivirus containing the pLE4-TSPAN4-GFP plasmid prepared above was added. After incubation for 24 hours, the culture medium was replaced with normal mesenchymal stem cell culture medium to obtain late-passage WT hMSCs transfected with pLE4-TSPAN4-GFP (LP WT hMSCs).

[0186] The early and late passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP prepared above were passaged and then used for immunofluorescence staining.

[0187] The procedure for fluorescent staining of migratoria is as follows:

[0188] The experiment was divided into two groups, namely Alexa Fluor TM 555-conjugated WGA and Hoechst 33342 staining group, TSPAN4-GFP and Hoechst 33342 staining group.

[0189] Alexa Fluor TM 555-conjugated WGA and Hoechst 33342 staining group:

[0190] The early passage wild-type mesenchymal stem cells and late passage wild-type mesenchymal stem cells prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with hydrochloric acid buffer (PBS). The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with hydrochloric acid buffer (PBS), with a glutaraldehyde content of 2.5% by volume) at room temperature for 10 minutes. After washing with hydrochloric acid buffer (PBS), PBS buffer containing 0.4% Triton X-100 (Triton X-100 diluted with hydrochloric acid buffer (PBS) was added. The content of X-100 was 2.5% by volume), permeabilized at room temperature for 10 minutes, and blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, donkey serum was purchased from Jackson, product number NC9624464) for one hour, and then stained with Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor), and the number of WGA-labeled extracellular migrasome vesicles was used as the detection parameter to detect the number of migrasomes in each cell.

[0191] The results are as follows Figure 2 Middle A (late passage is LP WT hMSC, early passage is EP WT hMSC, red is Alexa Fluor TM 555-conjugated WGA, blue is Hoechst 33342; the left side is the morphology of the stained migrasomes; the right side is the number of migrasomes in each cell) As shown, WGA fluorescence staining showed that the number of migrasomes in LP WT hMSCs was increased compared with that in EP WT hMSCs.

[0192] TSPAN4-GFP and Hoechst 33342 staining group:

[0193] The early passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP and the early passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP prepared above were respectively seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with hydrochloric acid buffer (PBS), the glutaraldehyde content was 2.5% by volume) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 (Triton X-100 diluted with hydrochloric acid buffer (PBS), Triton The cells were permeabilized at room temperature for 10 minutes and blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10; donkey serum was purchased from Jackson, Catalog No. NC9624464) for one hour at room temperature. After washing once with PBS, the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570) and images were captured using a Dragonfly confocal microscope (Andor). The number of migrasomes in each cell was detected, using the number of extracellular migrasome vesicles labeled with TSPAN4-GFP as the detection parameter.

[0194] The results are as follows Figure 2 As shown in B (the early passage is EP WT hMSCs transfected with pLE4-TSPAN4-GFPTSPAN4-GFP, the late passage is LP WT hMSCs transfected with pLE4-TSPAN4-GFP, green is TSPAN4-GFP, blue is Hoechst 33342; the left side is the morphology of stained migrasomes; the right bar graph is the number of migrasomes in each cell), compared with the migrasomes in EP WT hMSCs transfected with pLE4-TSPAN4-GFP, fluorescent staining showed that the number of migrasomes in LP WT hMSCs transfected with pLE4-TSPAN4-GFP was increased.

[0195] 1.3 Western blotting to detect purified migratoria

[0196] Migrasomes were purified from early- and late-passage wild-type mesenchymal stem cells infected with TSPAN4-GFP. The morphology of the purified migrasomes was observed by immunofluorescence and negative electron microscopy, and the level of TSPAN4-GFP was detected by Western blotting.

[0197] Migrate body purification:

[0198] The early passage wild-type mesenchymal stem cells (EP WT hMSC) transfected with pLE4-TSPAN4-GFP and the late passage wild-type mesenchymal stem cells (LP WT hMSC) transfected with pLE4-TSPAN4-GFP prepared above were seeded at 2E6 / dish on 15 cm culture dishes coated with gelatin (Sigma-Aldrich). The cells were grown until the next day. After washing with PBS, the cells were lysed with trypsin (TrypLE Express Enzyme (1X), no phenol The cells were digested and collected using a 1000g (red, GIBCO) digestion kit. The samples were centrifuged at 1000g for 10 minutes to remove cell clumps. The supernatant was collected and centrifuged at 4000g for 20 minutes to remove cell debris. The supernatant was collected again and ultracentrifuged at 20,000g for 40 minutes at 4°C. The supernatant was removed to obtain the precipitate, crude migrasomes. The cells were then resuspended in PBS and ultracentrifuged again at 20,000g for 40 minutes at 4°C. The supernatant was removed to obtain the precipitate, which was resuspended in a small amount of PBS to obtain purified migrasomes from early-passage wild-type mesenchymal stem cells (EP WT hMSCs) and late-passage wild-type mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP. A small amount was used directly for fluorescence microscopy observation, and the remaining amount was used for Western blotting and cell processing.

[0199] Fluorescence microscopy observation:

[0200] 3 μl of purified migrasomes (purified migrasomes of EP WT hMSCs transfected with pLE4-TSPAN4-GFP and purified migrasomes of LP WT hMSCs transfected with pLE4-TSPAN4-GFP) were respectively added dropwise onto a glass slide using a pipette, covered with a coverslip, and images were captured using a Dragonfly confocal microscope (Andor).

[0201] like Figure 3 As shown in A (the early passage is the purified migratoria from EP WT hMSCs transfected with pLE4-TSPAN4-GFP, and the late passage is the purified migratoria from LP WT hMSCs transfected with pLE4-TSPAN4-GFP). Migratoria were crudely extracted from EP and LP WT hMSCs infected with TSPAN4-GFP by ultracentrifugation, and the morphology of the purified migratoria was observed by immunofluorescence.

[0202] Negative staining for electron microscopy:

[0203] 3 μl of purified migrasomes (purified migrasomes of EP WT hMSCs transfected with pLE4-TSPAN4-GFP and purified migrasomes of LP WT hMSCs transfected with pLE4-TSPAN4-GFP) were respectively added dropwise onto a grid (purchased from Electron Microscopy Sciences, product number 71179-01) using a pipette. After a while, the protein solution was absorbed dry with filter paper, and then negative staining solution (phosphotungstic acid, UA, ammonium molybdate, etc. are more commonly used) was added for staining for 5 minutes, and then dried with filter paper and placed in a grid box (purchased from Electron Microscopy Sciences, product number 71179-01) to dry naturally. After drying, the grid was imaged using a transmission electron microscope H-7650 at 10-100 kV.

[0204] like Figure 3 As shown in B (the early passage is the purified migratoria from EP WT hMSCs transfected with pLE4-TSPAN4-GFP, and the late passage is the purified migratoria from LP WT hMSCs transfected with pLE4-TSPAN4-GFP), migratoria were crudely extracted from EP WT hMSCs and LPWT hMSCs infected with TSPAN4-GFP by ultracentrifugation, and the morphology of the purified migratoria was observed by negative staining under an electron microscope.

[0205] Western blotting:

[0206] 20ul of the above-mentioned migratoria (purified migratoria of early passage wild-type mesenchymal stem cells (EP WT hMSC) transfected with pLE4-TSPAN4-GFP and purified migratoria of late passage wild-type mesenchymal stem cells (LP WThMSC) transfected with pLE4-TSPAN4-GFP) were taken respectively, and 15ul of 5×SDS buffer (500mM Tris-HCl, pH 6.8, 50% glycerol, 10% SDS and 10% 2-mercaptoethanol) was added to lyse the purified migratoria, mix well, and boil at 105°C for 10 minutes to obtain migratoria lysates (purified migratoria lysates of early passage wild-type mesenchymal stem cells (EP WT hMSC) transfected with pLE4-TSPAN4-GFP and purified migratoria lysates of late passage wild-type mesenchymal stem cells (LP WT Migration lysates of hMSCs were prepared. The protein concentration was measured using a BCA kit (Dingguo Changsheng, BCA02) and then subjected to SDS-PAGE electrophoresis. The proteins were then transferred to a PVDF membrane (Millipore) using an electroporator. The membrane was incubated with the primary antibody (rabbit anti-GFP mixed with antibody diluent (Zhongshan Jinqiao, Cat. No. ZLI-9030D) at a volume ratio of 1:2000 (v / v)) at 4°C overnight, washed three times for 10 minutes each, and then incubated with the corresponding HRP-resistant secondary antibody (HRP-conjugated Goat-anti-Rabbit (H+L) mixed with antibody diluent (Zhongshan Jinqiao, Cat. No. ZLI-9030D) at a volume ratio of 1:5000 (v / v)) at room temperature for 1.5 hours and washed three times for 10 minutes each.

[0207] The PVDF membrane, labeled with the antibody, was then blotted with a substrate and placed in a ChemiDoc XRS system using ImageLab software (Bio-Rad Laboratories, Inc.). The membrane was then overlaid with substrate solution for chemiluminescent imaging. The substrates were either a mixture of 1000 μL of substrate A and 3 μL of substrate B (substrate A: 0.2 mM coumaric acid, 1.25 mM luminal, 0.1 M Tris-HCl, pH 8.5; substrate B: 3% H₂O₂) or Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Quantification was performed using ImageJ.

[0208] The results are as follows Figure 3Shown in center C (early passage: purified migrasomes from EP WT hMSCs transfected with pLE4-TSPAN4-GFP; late passage: purified migrasomes from LP WT hMSCs transfected with pLE4-TSPAN4-GFP; left: immunoblot image; right: histogram of GFP protein levels (fold increase). Purified migrasomes were lysed and the protein concentration was adjusted before western blotting analysis. Compared with EP WT hMSCs transfected with pLE4-TSPAN4-GFP, the GFP signal in the migrasomes purified from LP WT hMSCs transfected with pLE4-TSPAN4-GFP was increased, indicating that more migrasomes were formed in LP WT hMSCs.

[0209] 1.4 Immunofluorescence staining showed an increase in the number of migratory bodies in the pathological aging model HGPS hMSC

[0210] The above TSPAN4-GFP lentivirus and infection process are as follows:

[0211] To package the TSPAN4-GFP lentivirus, the pLE4-TSPAN4-GFP plasmid was transfected into HEK293T cells (purchased from ATCC, catalog number CRL-3216) along with the packaging plasmids pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) using Lipofectamine 3000 (Invitrogen). Lentivirus-containing supernatants were harvested 48 and 72 hours after transfection, filtered through a 0.2 μm filter, and concentrated by ultracentrifugation at 19,400 rpm for 2.5 hours. The viral pellet was resuspended and the viral titer was assessed by infecting cells with varying amounts of virus. Optimal titers were achieved when the infection efficiency exceeded 90%. This yielded lentivirus containing the pLE4-TSPAN4-GFP plasmid.

[0212] Preparation of wild-type mesenchymal stem cells (WT hMSCs) transfected with pLE4-TSPAN4-GFP: When WT hMSCs grew to 50% confluence in a culture dish, the culture medium was replaced with 90% MEM AlphaMedium (Thermo Fisher Scientific) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin, and 1 ng / mL bFGF2 (Joint Protein Central)] containing polybrene (Sigma-Aldrich), and the lentivirus containing the pLE4-TSPAN4-GFP plasmid prepared above was added. After incubation for 24 hours, the culture medium was replaced with normal mesenchymal stem cell culture to obtain WT hMSCs transfected with pLE4-TSPAN4-GFP.

[0213] Preparation of Hutchinson-Gilford progeria syndrome HGPS mesenchymal stem cells (HGPShMSCs) transfected with pLE4-TSPAN4-GFP: When HGPS hMSCs were grown in a culture dish to a confluence of 50%, the culture medium was replaced with 90% MEM Alpha Medium (Thermo Fisher Scientific) [10% FBS, 2mmol / L GlutaMAX, 0.1mmol / L NEEA, 1% penicillin / streptomycin and 1ng / mL bFGF2 (Joint ProteinCentral)] containing polybrene (Sigma-Aldrich), and the lentivirus containing the pLE4-TSPAN4-GFP plasmid prepared above was added. After incubation for 24 hours, the culture medium was replaced with normal mesenchymal stem cell culture medium to obtain HGPS hMSCs transfected with pLE4-TSPAN4-GFP.

[0214] 1. SA-β-gal staining of WT hMSCs and HGPS hMSCs:

[0215] The WT hMSCs and HGPS hMSCs prepared above were fixed with fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) PBS) for 5 minutes, the fixative was aspirated and washed once with PBS, and incubated overnight (12 h) at 37°C with SA-β-gal staining solution (40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mM MgCl2, 1 mg / mL X-gal). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed using ImageJ software.

[0216] The results are as follows Figure 4 Middle A( Figure 4 (A) WT or wild type refers to WT hMSCs, and HGPS refers to HGPS hMSCs; the left side shows the cell status after staining; the right side shows the percentage of β-galactosidase-positive cells. It shows that HGPS hMSCs exhibit an accelerated cellular senescence phenotype compared to WT hMSCs. Specifically, HGPS hMSCs exhibit a higher number of SA-β-gal-positive cells.

[0217] 2. The procedure for immunofluorescence staining of migratoria is as follows:

[0218] The experiment was divided into two groups, namely Alexa FluorTM 555-conjugated WGA and Hoechst 33342 staining group, TSPAN4-GFP and Hoechst 33342 staining group.

[0219] Alexa Fluor TM 555-conjugated WGA and Hoechst 33342 staining group:

[0220] The WT hMSCs and HGPS hMSCs prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with hydrochloric acid buffer (PBS), with a glutaraldehyde content of 2.5% by volume) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The cells were then incubated with Alexa Fluor 500-containing PBS. TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and AlexaFluor TM Cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor), and the number of WGA-labeled extracellular migrasome vesicles was used as the detection parameter to measure the number of migrasomes in each cell.

[0221] The results are as follows Figure 4 Middle B (WT is WT hMSC, HGPS is HGPS hMSC, red is Alexa Fluor TM (Figure 5A) shows that WGA fluorescence staining increased the number of migrasomes in HGPS hMSCs compared with that in WT hMSCs.

[0222] TSPAN4-GFP and Hoechst 33342 staining group:

[0223] The pLE4-TSPAN4-GFP-transfected WT hMSCs and pLE4-TSPAN4-GFP-transfected HGPShMSCs prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with hydrochloric acid buffer (PBS), with a glutaraldehyde content of 2.5% by volume) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 (Triton X-100 diluted with hydrochloric acid buffer (PBS), Triton The cells were permeabilized at room temperature for 10 minutes and blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10; donkey serum was purchased from Jackson, Catalog No. NC9624464) for one hour at room temperature. After washing once with PBS, the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. NC9624464) and images were captured using a Dragonfly confocal microscope (Andor). The number of migrasomes in each cell was detected, using the number of extracellular migrasome vesicles labeled with TSPAN4-GFP as the detection parameter.

[0224] The results are as follows Figure 4 As shown in C (WT or wild type refers to WT hMSCs transfected with pLE4-TSPAN4-GFP, HGPS refers to HGPS hMSCs transfected with pLE4-TSPAN4-GFP, green refers to TSPAN4-GFP, blue refers to Hoechst 33342; the left side shows the morphology of stained migrasomes; the right side bar graph shows the number of migrasomes in each cell), compared with the migrasomes in WT hMSCs transfected with pLE4-TSPAN4-GFP, the fluorescent staining showed that the number of migrasomes in HGPS hMSCs transfected with pLE4-TSPAN4-GFP increased.

[0225] 1.5 Immunofluorescence staining showed that the number of migratory bodies increased in the H2O2-induced WT hMSC aging model.

[0226] The changes in the number of migratory bodies were observed in control and H2O2-treated WT hMSCs using WGA fluorescent probe to label migratory bodies.

[0227] Preparation of H2O2-treated hMSCs: The WT hMSCs prepared above were seeded on a 0.1% gelatin (SigmaAldrich)-coated culture dish (CORNING). When the cells grew to a density of 60%-70%, they were treated with 100 μm H2O2 for 12 h. When the cells grew to a density of 80-90%, they were passaged to obtain H2O2-treated HGPS hMSCs.

[0228] 1. SA-β-gal staining of WT hMSCs and H2O2-treated WT hMSCs:

[0229] The WT hMSCs prepared above and the WT hMSCs treated with H2O2 were fixed with a fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) PBS) for 5 minutes, respectively. After aspirating the fixative, the cells were washed once with PBS and incubated overnight (12 h) at 37°C with SA-β-gal staining solution (40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mM MgCl2, 1 mg / mL X-gal). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed using ImageJ software.

[0230] The results are as follows Figure 5 Middle A( Figure 5 (A) The control group is WT hMSCs, and the hydrogen peroxide group is WT hMSCs treated with H2O2. The left side shows the cell status after staining; the right bar graph shows the percentage of β-galactosidase-positive cells. Compared with WT hMSCs, H2O2-treated WT hMSCs exhibit an accelerated cellular senescence phenotype. Specifically, H2O2-treated WT hMSCs exhibited a higher number of SA-β-gal-positive cells.

[0231] 2.Alexa Fluor TM 555-conjugated WGA and Hoechst 33342 staining group:

[0232] The WT hMSCs prepared above and the WT hMSCs treated with H2O2 were seeded in 24-well plates covered with coverslips (ThermoFisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with PBS) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, donkey serum was purchased from Jackson, product number NC9624464) at room temperature for one hour, and then stained with Alexa Fluor 5-conjugated ELISA kit containing Alexa Fluor 5-conjugated ELISA kit. TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor), and the number of WGA-labeled extracellular migrasome vesicles was used as the detection parameter to detect the number of migrasomes in each cell.

[0233] The results are as follows Figure 5 Middle B (control group is WT hMSC, hydrogen peroxide is H2O2 treated hMSC, red is AlexaFluor TM 555-conjugated WGA, blue is Hoechst 33342; the left side is the cell staining result; the right side is the number of migrasomes in each cell) As shown, WGA fluorescence staining showed that the number of migrasomes in H2O2-treated hMSCs increased compared with the migrasomes in WT hMSCs.

[0234] 1.6 WGA fluorescence staining showed an increase in the number of migratory bodies in replicatively senescent (RS) human fibroblasts.

[0235] The changes in the number of migratory bodies were observed in early and late passage human fibroblasts using WGA fluorescent probe to label migratory bodies.

[0236] Preparation of early-passage human fibroblasts: Human dermal fibroblasts (cells derived from the published article: Zou et al., Dev Cell, A Single-Cell Transcriptomic Atlas of Human Skin Aging; cell name in the literature: human dermal fibroblasts) were cultured in a culture dish containing 87% DMEM (Hyclone) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin] fibroblast culture medium and passaged to passage 10 to obtain early-passage human fibroblasts.

[0237] Preparation of late passage human fibroblasts: Human skin fibroblasts were cultured on culture dishes containing 87% DMEM (Hyclone) [10% FBS, 2 mmol / L GlutaMAX, 0.1 mmol / L NEEA, 1% penicillin / streptomycin] and passaged to passage 21 to obtain late passage human fibroblasts.

[0238] 1. SA-β-gal staining observation of early and late passage human fibroblasts:

[0239] The early passage human fibroblasts and late passage human fibroblasts prepared above were fixed with fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) PBS) for 5 minutes, respectively. After aspirating the fixative, the cells were washed once with PBS and incubated overnight (12 h) at 37°C with SA-β-gal staining solution (40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mM MgCl2, 1 mg / mL X-gal). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed using ImageJ software.

[0240] The results are as follows Figure 6 Middle A( Figure 6 Middle A: Early passage human fibroblasts (early passage), late passage human fibroblasts (late passage); left: stained cell status diagram, right: percentage of β-galactosidase-positive cells. Compared to early passage human fibroblasts, late passage human fibroblasts exhibit accelerated cellular senescence. Specifically, EP human fibroblasts exhibit a higher number of SA-β-gal-positive cells.

[0241] 2.Alexa Fluor TM555-conjugated WGA and Hoechst 33342 staining group:

[0242] The early passage human fibroblasts and late passage human fibroblasts prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA INC, 18426) diluted with hydrochloric acid buffer (PBS), with a glutaraldehyde content of 2.5% by volume) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 (Triton X-100 diluted with hydrochloric acid buffer (PBS), with a Triton X-100 content of 2.5% by volume) was added and permeabilized at room temperature for 10 minutes. The cells were then blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, product number NC9624464) at room temperature for one hour. The cells were then incubated with 5% PBS containing Alexa Fluor. TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor), and the number of WGA-labeled extracellular migrasome vesicles was used as the detection parameter to detect the number of migrasomes in each cell.

[0243] The results are as follows Figure 6 Middle B (early passage is early generation human fibroblasts, late passage is late generation human fibroblasts, red is Alexa Fluor TM 555-conjugated WGA, blue is Hoechst 33342; the left side is the stained migratoria status diagram, and the right side is the number of migratoria in each cell (as shown). WGA fluorescence staining shows that the number of migratoria in late-generation human fibroblasts is increased compared with that in early-generation human fibroblasts.

[0244] Example 2: Increased enrichment of endogenous retroviruses in migrasomes as a novel marker for assessing aging

[0245] In this example, immunofluorescence staining and Western blotting were used to detect the enrichment of endogenous retrovirus (HERVK) in mitosomes in replicatively aged WT hMSCs, pathologically aged HGPS hMSCs, H2O2-induced aged hMSCs, and replicatively aged human fibroblasts, and to study the relationship between its enrichment and cellular senescence.

[0246] HERVK-Env and WGA immunofluorescence co-staining was performed in EP and LP WT hMSCs, and HERVK-Env immunofluorescence staining was performed in EP and LP WT hMSCs infected with TSPAN4-GFP to detect changes in HERVK-Env-containing migrasomes in replicatively aged hMSCs. HERVK-Env protein levels in migrasomes purified from EP and LP WT hMSCs were measured by Western blotting to detect the enrichment of HERVK-Env in migrasomes.

[0247] 2.1 Endogenous retroviral envelope protein (HERVK-Env)-mouse anti-HERVK-Env increases migrasome enrichment in wild-type replicatively aged hMSCs

[0248] Alexa Fluor TM 555-conjugated WGA, mouse anti-HERVK-Env and Hoechst 33342 staining group:

[0249] The early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WT hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (25% glutaraldehyde (TEDPELLA INC, 18426) diluted with PBS) at room temperature for 10 minutes. After washing with PBS, 0.4% Triton X-ray dilution was added. The cells were permeabilized with PBS buffer containing X-100 at room temperature for 10 minutes and blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-HERVK-Env was mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from ThermoFisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles co-localized with green fluorescent-labeled HERVK-Env was used as the detection parameter to detect the number of migrasomes containing HERVK-Env in each cell.

[0250] like Figure 7 As shown in middle A (late passage LP WT hMSC, early passage EP WT hMSC; left side is the migratoria staining status diagram; right side is the number of migratoria containing HERVK-Env in each cell), HERVK-Env and WGA immunofluorescence co-staining showed that the number of migratoria containing HERVK-Env increased in LP WT hMSC.

[0251] TSPAN4-GFP, mouse anti-HERVK-Env and Hoechst 33342 staining group:

[0252] The prepared late passage wild-type human mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP and early passage wild-type human mesenchymal stem cells (EP WT hMSCs) transfected with pLE4-TSPAN4-GFP were plated in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to 40-50% density, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, 0.4% Triton X-100 was added to PBS buffer and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-HERVK-Env mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (Alexa Fluor 500 antibody) was added. The cells were incubated with 568Donkey Anti-Mouse IgG (H+L) mixed with PBS at a volume ratio of 1:500 (v / v) at room temperature for 1 hour. The nuclei were then labeled with Hoechst 33342 (Invitrogen). Images were captured using a Dragonfly confocal microscope (Andor). The number of extracellular migrasome vesicles labeled with TSPAN4-GFP and colocalized with red fluorescent-labeled HERVK-Env was used as the detection parameter to detect the number of migrasomes containing HERVK-Env in each cell.

[0253] The results are as follows Figure 7 As shown in middle B (the late passage is LP WT hMSCs transfected with pLE4-TSPAN4-GFP, and the early passage is EP WT hMSCs transfected with pLE4-TSPAN4-GFP; the left side is the result of migrasome color development, and the right side is the number of migrasomes containing HERVK-Env in each cell), the number of migrasomes containing HERVK-Env increased in LP WThMSCs transfected with pLE4-TSPAN4-GFP compared with EP WT hMSCs transfected with pLE4-TSPAN4-GFP.

[0254] Western blotting to detect HERVK-Env levels in purified mitosomes

[0255] 20ul of the migrasomes prepared in Example 1 (migrasomes of purified late-generation wild-type human mesenchymal stem cells (LP WThMSC) and migrasomes of purified early-generation wild-type human mesenchymal stem cells (EP WT hMSC)) were added to 15ul of 5×SDS buffer (500mM Tris-HCl, pH 6.8, 50% glycerol, 10% SDS and 10% 2-mercaptoethanol), the purified migrasomes were lysed, mixed, and boiled at 105°C for 10 minutes to obtain migrasome lysates (migrasome lysates of purified LP WT hMSC and migrasome lysates of purified early-generation EP WT hMSC). Migratoria lysates of hMSC migrasomes) were prepared, and the protein concentration was measured using a BCA kit. SDS-PAGE electrophoresis was performed, and the proteins were then transferred to a PVDF membrane (Millipore) using an electroporator. The membrane was incubated with the primary antibody (the primary antibody was mouse anti-HERVK-Env mixed with antibody diluent (Zhongshan Jinqiao, cat. no. ZLI-9030D) at a volume ratio of 1:1000 (v / v)) at 4°C overnight, washed three times for 10 minutes each, and then incubated with the corresponding HRP-resistant secondary antibody (the secondary antibody was HRP-conjugated Goat-anti-mouse (H+L) mixed with antibody diluent (Zhongshan Jinqiao, cat. no. ZLI-9030D) at a volume ratio of 1:5000 (v / v)).

[0256] The PVDF membrane, incubated with the above antibodies, was then blotted with a ChemiDoc XRS system and Image Lab software (Bio-Rad Laboratories, Inc.). The membrane was then covered with substrate solution for chemiluminescent imaging. The substrates were either a mixture of 1000 μL of substrate A and 3 μL of substrate B (substrate A: 0.2 mM coumaric acid, 1.25 mM luminal, 0.1 M Tris-HCl, pH 8.5; substrate B: 3% H₂O₂) or Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Quantification was performed using ImageJ.

[0257] like Figure 7 As shown in C (the early passage is the migratoria lysate of the purified EP WT hMSC migratoria, and the late passage is the migratoria lysate of the purified LP WThMSC migratoria; the left side is the immunoblot and the right side is the HERVK-Env protein level (multiple)), the purified migratoria was subjected to protein lysis and protein concentration adjustment and then subjected to protein immunoblotting analysis. Compared with the migratoria lysate of the purified EP WT hMSC migratoria, the HERVK-Env signal in the migratoria lysate of the purified LP WT hMSC migratoria was increased, indicating that the enrichment of HERVK-Env in the migratoria was increased in LP WT hMSC.

[0258] 2.2HERVK-Env enrichment increases in migrasomes in multiple cell aging models

[0259] HERVK-Env and WGA immunofluorescence co-staining was performed in pathologically aged HGPS hMSCs, H2O2-induced aged hMSCs and replicatively aged human fibroblasts to detect the enrichment of HERVK-Env in migrasomes.

[0260] Alexa Fluor TM 555-conjugated WGA, mouse anti-HERVK-Env and Hoechst 33342 staining panel:

[0261] The wild-type human mesenchymal stem cells (WT hMSC) and Hutchinson-Gilford progeria syndrome human mesenchymal stem cells (HGPS hMSC) prepared above were seeded in 24-well plates covered with cover glass (Thermo Fisher Scientific). When the cells grew to 40-50% density, the culture medium was aspirated and washed with PBS. The cells were incubated in 2.5% glutaraldehyde (25% glutaraldehyde (TED PELLA) INC,18426) diluted in PBS) was fixed at room temperature for 10 minutes, washed with PBS, and then permeabilized with PBS buffer containing 0.4% TritonX-100 at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-HERVK-Env was mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles co-localized with green fluorescent-labeled HERVK-Env was used as the detection parameter to detect the number of migrasomes containing HERVK-Env in each cell.

[0262] like Figure 8 As shown in Figure A (WT or wild type is WT hMSC, HGPS is HGPS hMSC; the left side is the migratoria staining result, and the right side is the number of migratoria containing HERVK-Env in each cell), HERVK-Env and WGA immunofluorescence co-staining showed that the number of migratoria containing HERVK-Env increased in HGPS hMSC.

[0263] Alexa Fluor TM555-conjugated WGA, mouse anti-HERVK-Env and Hoechst 33342 staining panel:

[0264] The wild-type human mesenchymal stem cells (WT hMSCs) and H2O2-treated human mesenchymal stem cells prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-HERVK-Env was mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (AlexaFluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles co-localized with green fluorescent-labeled HERVK-Env was used as the detection parameter to detect the number of migrasomes containing HERVK-Env in each cell.

[0265] like Figure 8 As shown in B (the control group is WT hMSC, and hydrogen peroxide is H2O2-treated hMSC; the left side is the migratoria staining result; the right side is the number of migratoria containing HERVK-Env in each cell), HERVK-Env and WGA immunofluorescence co-staining showed that the number of migratoria containing HERVK-Env increased in WT hMSCs treated with H2O2.

[0266] Alexa Fluor TM555-conjugated WGA, mouse anti-HERVK-Env and Hoechst 33342 staining panel:

[0267] The early passage human fibroblasts and late passage human fibroblasts prepared above were seeded in 24-well plates covered with coverslips (ThermoFisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (the primary antibody was mouse anti-HERVK-Env mixed with 10% donkey serum diluted at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4 degrees. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles co-localized with green fluorescent-labeled HERVK-Env was used as the detection parameter to detect the number of migrasomes containing HERVK-Env in each cell.

[0268] like Figure 8 As shown in middle C (early passage is early-passage human fibroblasts, late passage is late-passage human fibroblasts; the left side is the result of migratoria staining; the right side is the number of migratoria containing HERVK-Env in each cell), HERVK-Env and WGA immunofluorescence co-staining showed that the number of migratoria containing HERVK-Env increased in LP human fibroblasts.

[0269] 2.3 Endogenous retroviral double-stranded RNA (dsRNA)-mouse anti-dsRNA increases migrasome enrichment in multiple cellular aging models

[0270] Co-immunofluorescence staining of dsRNA and WGA was performed in early-passage wild-type human mesenchymal stem cells and late-passage wild-type human mesenchymal stem cells, in early-passage wild-type human mesenchymal stem cells infected with TSPAN4-GFP and late-passage wild-type human mesenchymal stem cells, and in WT and HGPS hMSCs to detect changes in migrasomes containing endogenous retroviral genetic material dsRNA in replicatively senescent and pathologically senescent hMSCs.

[0271] Alexa Fluor TM 555-conjugated WGA, mouse anti-dsRNA and Hoechst 33342 staining panel:

[0272] The early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WT hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-HERVK-Env mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and AlexaFluor TMThe cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled dsRNA was used as the detection parameter to detect the number of migrasomes containing dsRNA in each cell.

[0273] like Figure 9 As shown in center A (late passage LP WT hMSC, early passage EP WT hMSC; left side is the result of migrasome staining; right side is the number of migrasomes containing dsRNA in each cell), dsRNA and WGA immunofluorescence co-staining showed that the number of migrasomes containing dsRNA increased in LPWT hMSC.

[0274] TSPAN4-GFP, mouse anti-dsRNA and Hoechst 33342 staining group:

[0275] The late passage wild-type human mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP and the early passage wild-type human mesenchymal stem cells (EP WT hMSCs) transfected with pLE4-TSPAN4-GFP prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated, washed with PBS, and fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, 0.4% Triton X-ray distilled water was added. The cells were permeabilized with PBS buffer containing X-100 at room temperature for 10 minutes and blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-dsRNA was mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and incubated at room temperature for 1 hour. The nuclei were then labeled with Hoechst 33342 (Invitrogen, Cat. No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of TSPAN4-GFP-labeled extracellular migrasome vesicles colocalized with red fluorescently labeled dsRNA was used as the detection parameter to measure the number of migrasomes containing dsRNA in each cell.

[0276] The results are as follows Figure 9 As shown in middle B (late passage LP WT hMSCs transfected with pLE4-TSPAN4-GFP, early passage EP WT hMSCs transfected with pLE4-TSPAN4-GFP; the left side is a graph showing the results of migrasome staining; the right side is a graph showing the number of migrasomes containing dsRNA in each cell), the number of migrasomes containing dsRNA in LP WThMSCs transfected with pLE4-TSPAN4-GFP increased compared with that in early passage EP WT hMSCs transfected with pLE4-TSPAN4-GFP.

[0277] Alexa Fluor TM 555-conjugated WGA, mouse anti-dsRNA and Hoechst 33342 staining panel:

[0278] The wild-type human mesenchymal stem cells (WT hMSC) and Hutchinson-Gilford progeria syndrome human mesenchymal stem cells (HGPS hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to 40-50% density, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour, and primary antibodies (mouse anti-HERVK-Env mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) were added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibodies (secondary antibodies were Alexa Fluor 500-900). 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and AlexaFluor TMThe cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled dsRNA was used as the detection parameter to detect the number of migrasomes containing dsRNA in each cell.

[0279] like Figure 9 As shown in C (WT or wild type is WT hMSC, HGPS is HGPS hMSC; the left side is the result of migrasome staining; the right side is the number of migrasomes containing dsRNA in each cell), dsRNA and WGA immunofluorescence co-staining showed that the number of migrasomes containing dsRNA in HGPS hMSC increased.

[0280] Conclusions: Increased enrichment of endogenous retroviruses in mitosomes serves as a novel marker for assessing aging.

[0281] Example 3: Increased enrichment of inflammatory factors in migrasomes as novel markers for assessing aging

[0282] In this example, immunofluorescence staining and Western blotting were used to detect the enrichment of inflammatory factors IL1β and IL6 in migrasomes in replicatively aged WT hMSCs, pathologically aged HGPS hMSCs, H2O2-induced aged hMSCs, and replicatively aged human fibroblasts, as well as the relationship between their enrichment and cell senescence.

[0283] 3.1 The inflammatory factor IL1β is enriched in migrasomes in various cell aging models

[0284] IL1β and WGA immunofluorescence co-staining was performed on early-passage wild-type human mesenchymal stem cells and late-passage wild-type human mesenchymal stem cells, wild-type human mesenchymal stem cells and Hutchinson-Gilford progeria syndrome human mesenchymal stem cells, control group and H2O2-treated wild-type human mesenchymal stem cells, and early-passage human fibroblasts and late-passage human fibroblasts to detect changes in IL1β-containing mitosomes in various aging models.

[0285] Alexa Fluor TM 555-conjugated WGA, mouse anti-IL1β and Hoechst 33342 staining group:

[0286] The early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WT hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-IL1β mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL1β was used as the detection parameter to detect the number of migrasomes containing IL1β in each cell.

[0287] like Figure 10 As shown in center A (late passage LP WT hMSCs, early passage EP WT hMSCs; left side shows the results of migrasome staining; right side shows the number of migrasomes containing IL1β in each cell), IL1β and WGA immunofluorescence co-staining showed that the number of migrasomes containing IL1β increased in LP WThMSCs.

[0288] Alexa Fluor TM 555-conjugated WGA, mouse anti-IL1β and Hoechst 33342 staining group:

[0289] The wild-type human mesenchymal stem cells (WT hMSC) and Hutchinson-Gilford progeria syndrome human mesenchymal stem cells (HGPS hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to 40-50% density, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-IL1β mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and AlexaFluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL1β was used as the detection parameter to detect the number of migrasomes containing IL1β in each cell.

[0290] like Figure 10 As shown in B (WT or wild type is WT hMSC, HGPS is HGPS hMSC; the left side is the result of migrasome staining; the right side is the number of migrasomes containing IL1β in each cell), IL1β and WGA immunofluorescence co-staining showed that the number of migrasomes containing IL1β was increased in HGPShMSC.

[0291] Alexa Fluor TM 555-conjugated WGA, mouse anti-IL1β and Hoechst 33342 staining group:

[0292] The wild-type human mesenchymal stem cells (WT hMSCs) and H2O2-treated human mesenchymal stem cells prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (diluted in PBS) at room temperature for 10 minutes. After washing with PBS, 0.4% Triton X-100 was added to PBS buffer and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (mixed with PBS at a volume ratio of 1:10, purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-IL1β mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (Alexa Fluor 500 antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (AlexaFluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL1β was used as the detection parameter to detect the number of migrasomes containing IL1β in each cell.

[0293] like Figure 10 As shown in C (the control group is WT hMSC, and hydrogen peroxide is H2O2-treated hMSC; the left side is the migrasome staining result; the right side is the number of migrasomes containing IL1β in each cell), IL1β and WGA immunofluorescence co-staining showed that the number of migrasomes containing IL1β increased in WT hMSCs treated with H2O2.

[0294] Alexa Fluor TM 555-conjugated WGA, mouse anti-IL1β and Hoechst 33342 staining group:

[0295] The early passage human fibroblasts and late passage human fibroblasts prepared above were seeded in 24-well plates covered with coverslips (ThermoFisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (the primary antibody was mouse anti-IL1β mixed with 10% donkey serum diluted at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL1β was used as the detection parameter to detect the number of migrasomes containing IL1β in each cell.

[0296] like Figure 10 As shown in D (early passage represents early-passage human fibroblasts, late passage represents late-passage human fibroblasts; the left side shows the results of migratoria staining; the right side shows the number of migratoria containing IL1β in each cell), IL1β and WGA immunofluorescence co-staining showed that the number of migratoria containing IL1β increased in late-passage human fibroblasts.

[0297] 3.2 Inflammatory cytokine IL6 increases migratoria enrichment in various cell aging models

[0298] IL6 and WGA immunofluorescence co-staining was performed in early-passage wild-type human mesenchymal stem cells, late-passage wild-type human mesenchymal stem cells, as well as control and H2O2-treated wild-type human mesenchymal stem cells to detect changes in IL6-containing mitosomes in various aging models.

[0299] Alexa Fluor TM 555-conjugated WGA, mouse anti-IL6 and Hoechst 33342 staining group:

[0300] The early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WT hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-IL6 was mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 547 antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (AlexaFluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL6 was used as the detection parameter to detect the number of migrasomes containing IL6 in each cell.

[0301] like Figure 11 As shown in center A (late passage LP WT hMSCs, early passage EP WT hMSCs; left side shows the results of migrasome staining; right side shows the number of migrasomes containing IL6 in each cell), IL6 and WGA immunofluorescence co-staining showed that the number of migrasomes containing IL6 increased in LP WThMSCs.

[0302] Alexa Fluor TM555-conjugated WGA, mouse anti-IL6 and Hoechst 33342 staining group:

[0303] The wild-type human mesenchymal stem cells (WT hMSCs) and H2O2-treated human mesenchymal stem cells prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (diluted in PBS) at room temperature for 10 minutes. After washing with PBS, 0.4% Triton X-100 was added to PBS buffer and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (mouse anti-IL6 mixed with 10% donkey serum at a volume ratio of 1:200 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500). 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (AlexaFluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled IL6 was used as the detection parameter to detect the number of migrasomes containing IL6 in each cell.

[0304] like Figure 11 As shown in B (the control group is WT hMSC, and hydrogen peroxide is H2O2-treated hMSC; the left side is the migratoria staining result; the right side is the number of migratoria containing IL6 in each cell), IL6 and WGA immunofluorescence co-staining showed that the number of migratoria containing IL6 increased in WT hMSCs treated with H2O2.

[0305] This suggests that the increased enrichment of inflammatory factors in mitosomes serves as a novel marker for assessing aging.

[0306] Example 4: Increased accumulation of damaged mitochondria in mitosomes as a novel marker for assessing aging

[0307] In this example, immunofluorescence staining and Western blotting were used to examine the enrichment of mitochondria in mitosomes and the relationship between mitochondrial enrichment and cellular senescence in replicatively aged WT hMSCs, pathologically aged HGPS hMSCs, H2O2-induced aged hMSCs, and replicatively aged human fibroblasts.

[0308] Alexa Fluor TM 555-conjugated WGA, mouse anti-Tom20 and Hoechst 33342 staining group:

[0309] The early passage wild-type human mesenchymal stem cells (EP WT hMSC) and late passage wild-type human mesenchymal stem cells (LP WT hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-Tom20 diluted with 10% donkey serum at a volume ratio of 1:400 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled Tom20 was used as the detection parameter to detect the number of migrasomes containing Tom20 in each cell.

[0310] like Figure 12 As shown in middle A (late passage LP WT hMSC, early passage EP WT hMSC; left side is the result of migrasome staining; right side is the number of migrasomes containing Tom20 in each cell), immunofluorescence co-staining of mitochondrial outer membrane protein Tom20 and WGA showed that the number of migrasomes containing mitochondria increased in LPWThMSC.

[0311] Alexa Fluor TM 555-conjugated WGA, mouse anti-Tom20 and Hoechst 33342 staining group:

[0312] The wild-type human mesenchymal stem cells (WT hMSC) and Hutchinson-Gilford progeria syndrome human mesenchymal stem cells (HGPS hMSC) prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to 40-50% density, the medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) for one hour at room temperature. The primary antibody (mouse anti-Tom20 diluted with 10% donkey serum at a volume ratio of 1:400 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500). 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and AlexaFluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled Tom20 was used as the detection parameter to detect the number of migrasomes containing Tom20 in each cell.

[0313] like Figure 12 As shown in Figure B (WT or wild type is WT hMSC, HGPS is HGPS hMSC; the left side is the results of migrasome staining; the right side is the number of migrasomes containing Tom20 in each cell), immunofluorescence co-staining of the mitochondrial outer membrane protein Tom20 and WGA showed that the number of migrasomes containing mitochondria was increased in HGPS hMSC.

[0314] Alexa Fluor TM 555-conjugated WGA, mouse anti-Tom20 and Hoechst 33342 staining group:

[0315] The wild-type human mesenchymal stem cells (WT hMSCs) and H2O2-treated human mesenchymal stem cells prepared above were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde (diluted with PBS) at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (Jackson) at room temperature for one hour. Primary antibody (mouse anti-Tom20, 1:400 (v / v) diluted in 10% donkey serum) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (Alexa Fluor 500 antibody) was added. 488Donkey Anti-Mouse IgG (H+L), 1:500 (v / v) diluted in PBS) and containing Alexa Fluor TM The cells were incubated with PBS buffer containing 555-conjugated WGA at room temperature for 1 hour, and then the nuclei were labeled with Hoechst33342 (Invitrogen). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles co-localized with green fluorescent-labeled Tom20 was used as the detection parameter to detect the number of migrasomes containing Tom20 in each cell.

[0316] like Figure 12 As shown in C (the control group is WT hMSC, and the hydrogen peroxide is H2O2-treated hMSC; the left side is the result of migrasome staining; the right side is the number of migrasomes containing Tom20 in each cell), the mitochondrial outer membrane protein Tom20 and WGA immunofluorescence co-staining showed that the number of migrasomes containing mitochondria increased in H2O2-treated WT hMSC.

[0317] Alexa Fluor TM555-conjugated WGA, mouse anti-Tom20 and Hoechst 33342 staining group:

[0318] The early passage human fibroblasts and late passage human fibroblasts prepared above were seeded in 24-well plates covered with coverslips (ThermoFisher Scientific) and cultured. When the cells grew to a density of 40-50%, the culture medium was aspirated and washed with PBS. The cells were fixed in 2.5% glutaraldehyde at room temperature for 10 minutes. After washing with PBS, PBS buffer containing 0.4% Triton X-100 was added and permeabilized at room temperature for 10 minutes. The cells were blocked with 10% donkey serum (donkey serum and PBS were mixed at a volume ratio of 1:10, and donkey serum was purchased from Jackson, catalog number NC9624464) at room temperature for one hour. The primary antibody (the primary antibody was mouse anti-Tom20 mixed with 10% donkey serum at a volume ratio of 1:400 (v / v)) was added and incubated overnight at 4°C. After washing three times with PBS, the corresponding secondary antibody (the secondary antibody was Alexa Fluor 500 Antibody) was added. 488Donkey Anti-Mouse IgG (H+L) was mixed with PBS at a volume ratio of 1:500 (v / v) and Alexa Fluor TM 555-conjugated WGA in PBS buffer (Alexa Fluor TM 555-conjugated WGA was mixed with PBS at a mass volume ratio of 1:500, and Alexa Fluor TM The cells were incubated with 555-conjugated WGA (purchased from Thermo Fisher, Catalog No. W32464) at room temperature for 1 hour, and then the nuclei were labeled with Hoechst 33342 (Invitrogen, Catalog No. H3570). Images were captured using a Dragonfly confocal microscope (Andor). The number of WGA-labeled extracellular migrasome vesicles colocalized with green fluorescent-labeled Tom20 was used as the detection parameter to detect the number of migrasomes containing Tom20 in each cell.

[0319] like Figure 12 As shown in middle D (early passage represents early-passage human fibroblasts, late passage represents late-passage human fibroblasts; the left side shows the results of migrasome staining; the right side shows the number of migrasomes containing Tom20 in each cell), immunofluorescence co-staining of the mitochondrial outer membrane protein Tom20 and WGA showed that the number of migrasomes containing mitochondria increased in late-passage human fibroblasts.

[0320] Conclusions: Damaged mitochondria are enriched in mitosomes and serve as a novel marker for assessing aging.

[0321] Example 5: Application of migrasomes released by senescent cells to regulate the degree of cell senescence

[0322] In this example, young hMSCs were treated with migrasomes purified from senescent hMSCs infected with TSPAN4-GFP, and then immunofluorescence staining, qRT-PCR, and SA-β-gal staining were performed to investigate whether migrasomes transmit senescence signals and promote senescence of young cells.

[0323] The preparation of lentivirus containing the pLE4-TSPAN4-GFP plasmid, the preparation of early-passage wild-type human mesenchymal stem cells transfected with pLE4-TSPAN4-GFP, the preparation of late-passage wild-type human mesenchymal stem cells transfected with pLE4-TSPAN4-GFP, and the preparation of purified migratory bodies of early-passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP (EP WT hMSC) and purified migratory bodies of late-passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP (LP WT hMSC) are shown in Example 1.

[0324] Preparation of hMSCs treated with pLE4-TSPAN4-GFP transgenic senescent hMSC migrasomes: Early passage WT hMSC cells were seeded at a cell number of 1E5 on 0.1% gelatin (Sigma Aldrich) coated six-well plates (CORNING), cultured with mesenchymal stem cell culture medium (90% α-MEM + Glutmax (Gibco), 10% FBS (Gemcell, Cat. No. A77E01F), 1% penicillin / streptomycin (Gibco) and 1 ng / mL FGF2 (Joint Protein Central)), and the purified pLE4-TSPAN4-GFP transgenic late passage wild-type mesenchymal stem cells (LP WT hMSCs) prepared above were added. The culture medium containing purified pLE4-TSPAN4-GFP transgenic late passage wild-type mesenchymal stem cells (LP WT hMSCs) was replaced every 2 days. The mesenchymal stem cell culture medium of the migratory bodies of hMSC) was added, and the cells were subcultured when they grew to 90% density. The above steps were repeated, and the treatment and subculture were repeated twice to obtain hMSCs treated with senescent hMSC migratory bodies transfected with pLE4-TSPAN4-GFP. The process is as follows: Figure 13 As shown in A.

[0325] SA-β-gal staining observation:

[0326] The early passage WT hMSCs and hMSCs treated with senescent hMSC migratory bodies transfected with pLE4-TSPAN4-GFP prepared above were fixed with fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) P) for 5 minutes, the fixative was aspirated and washed once with PBS, and incubated overnight (12 h) at 37°C with SA-β-gal staining solution (40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mMM MgCl2, 1 mg / mL X-gal). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed by ImageJ software.

[0327] The results are as follows Figure 13 Middle B (young refers to young or early-passage hMSCs, and late-passage refers to hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP; left: cell staining results; right: percentage of β-galactosidase-positive cells). Compared with early-passage hMSCs, hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP exhibited an accelerated senescence phenotype. Specifically, hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP exhibited a higher number of cells positive for senescence-associated β-galactosidase (SA-β-gal).

[0328] Fluorescence microscopy observation of TSPAN4-GFP expression in late passage WT hMSCs transfected with pLE4-TSPAN4-GFP and migratory bodies of purified late passage wild-type mesenchymal stem cells transfected with pLE4-TSPAN4-GFP (LP WT hMSCs):

[0329] Observe the expression of TSPAN4-GFP in late passage WT hMSCs transfected with pLE4-TSPAN4-GFP under a fluorescence microscope: Take out the late passage WT hMSCs transfected with pLE4-TSPAN4-GFP prepared above and observe the expression of TSPAN4-GFP under a fluorescence microscope. After observation, replace the mesenchymal stem cell culture medium and continue culturing.

[0330] Fluorescence microscopy observation of the migratory bodies of purified late-passage wild-type mesenchymal stem cells (LP WThMSCs) transfected with pLE4-TSPAN4-GFP: 3 μl of purified migratory bodies (migratory bodies of purified late-passage wild-type mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP) were respectively added dropwise to a glass slide using a pipette, covered with a coverslip, and images were captured using a Dragonfly confocal microscope (Andor).

[0331] The results are as follows Figure 13 As shown in middle C (the left side shows the expression of TSPAN4-GFP in late-passage WT hMSCs transfected with pLE4-TSPAN4-GFP observed by fluorescence microscopy, and the right side shows the results of migrasomes purified from late-passage wild-type mesenchymal stem cells (LP WT hMSCs) transfected with pLE4-TSPAN4-GFP observed by fluorescence microscopy), senescent hMSCs successfully infected with TSPAN4-GFP lentivirus and expressing TSPAN4-GFP were observed by fluorescence microscopy, as well as migrasomes purified from senescent hMSCs infected with TSPAN4-GFP and expressing TSPAN4-GFP were observed by fluorescence microscopy.

[0332] Immunofluorescence staining showed that green fluorescence was detected in young hMSCs treated with migrasomes: early-passage WT hMSC cells and hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP were seeded in 24-well plates covered with coverslips (Thermo Fisher Scientific). When the cells grew to 40-50% density, the culture medium was aspirated and washed with PBS. The cells were fixed in 4% paraformaldehyde (PFA) for 10 min at room temperature, washed twice with PBS, permeabilized in PBS buffer containing 0.4% TritonX-100 for 10 min, and blocked with 10% donkey serum (Jackson) at room temperature for one hour. After washing once with PBS, the nuclei were labeled with Hoechst 33342 (Invitrogen). Images were captured using a Dragonfly confocal microscope (Andor). TSPAN4-GFP-labeled migrasome vesicles were used as the detection parameter to detect the expression of migrasomes in hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP.

[0333] The results are as follows Figure 13 As shown in D (the control group is early-passage WT hMSC cells; the migrasomes are hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP), green fluorescence was detected in young hMSCs treated with migrasomes by immunofluorescence staining, indicating that the migrasomes were absorbed by young cells.

[0334] qRT-PCR cell detection:

[0335] Total RNA was extracted from hMSCs and early passage WThMSCs treated with pLE4-TSPAN4-GFP-transfected senescent hMSC migrasomes prepared above using TRIzol (Thermo Fisher Scientific) according to the manufacturer's instructions; reverse transcribed into cDNA using the GoScript reverse transcription system (Promega) for RT-qPCR; young control hMSCs were used as controls, and the HERVK-env, IL1β, IL6, LAP2β, β-actin, and p21 listed in Table 2 were expressed. Cip1 Primers were used to detect HERVK-env, IL1B, and IL6 RNA levels.

[0336] The results are as follows Figure 13 E (HERVK-env is HERVK-env, IL1B is IL1β, IL6 is IL6, TMPO is LAP2β, CDKN1A is p21 Cip1 , the control group was early-passage WT hMSC cells C, and the migrasomes were hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP). qRT-PCR showed that in hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP, HERVK-env, IL1B, and IL6 RNA levels were increased, while the expression of the aging-related gene CDKN1A was increased and TMPO expression was decreased, indicating that migrasomes can transmit aging-related signals such as endogenous retroviruses and inflammatory factors between cells and promote the aging of young cells.

[0337] Western blotting:

[0338] The hMSCs and early passage WThMSCs treated with the pLE4-TSPAN4-GFP-transfected senescent hMSC migratory bodies prepared above were added to 1× SDS buffer (500 mM Tris-HCl, pH 6.8, 10% glycerol, 1% SDS and 1% 2-mercaptoethanol), the purified migratory bodies were lysed, mixed, and boiled at 105°C for 10 minutes to obtain protein lysates. The protein concentration was measured using a BCA kit and then subjected to SDS-PAGE electrophoresis. The proteins were then transferred to a PVDF membrane (Millipore) using an electroporator. The membrane was incubated with primary antibodies (mouse anti-HERVK-Env diluted with antibody diluent (Zhongshan Jinqiao, product number ZLI-9030D) at a volume ratio of 1:1000 (v / v), mouse anti-IL6 diluted with antibody diluent (Zhongshan Jinqiao, product number ZLI-9030D) at a volume ratio of 1:1000 (v / v), rabbit anti-p21 Cip1The cells were incubated with antibody diluent (Zhongshan Jinqiao, catalog number ZLI-9030D) at a volume ratio of 1:1000 (v / v) and mouse anti-β-actin diluted with antibody diluent (Zhongshan Jinqiao, catalog number ZLI-9030D) at a volume ratio of 1:3000 (v / v), incubated at 4°C overnight, washed three times, 10 minutes each time, and then incubated with the corresponding HRP-resistant secondary antibody (the secondary antibody was HRP-conjugated Goat-anti-Rabbit (H+L) diluted with antibody diluent (Zhongshan Jinqiao, catalog number ZLI-9030D) at a volume ratio of 1:5000 (v / v), the secondary antibody was HRP-conjugated Goat-anti-Rabbit (H+L) diluted with antibody diluent (Zhongshan Jinqiao, catalog number ZLI-9030D) at a volume ratio of 1:5000 (v / v), and the secondary antibody was HRP-conjugated Goat-anti-Rabbit (H+L) diluted with antibody diluent (Zhongshan Jinqiao, catalog number ZLI-9030D) at a volume ratio of 1:5000 (v / v). Goat-anti-mouse (H+L) was mixed with antibody diluent (Zhongshan Jinqiao, Cat. No. ZLI-9030D) at a volume ratio of 1:5000 (v / v) and incubated.

[0339] The protein-transferred PVDF membrane was then blotted with a substrate and placed in a ChemiDoc XRS system using ImageLab software (Bio-Rad Laboratories, Inc.). The membrane was then overlaid with substrate solution for chemiluminescent imaging. The substrates were either a mixture of 1000 μL of Substrate A and 3 μL of Substrate B (Substrate A: 0.2 mM coumaric acid, 1.25 mM luminal, 0.1 M Tris-HCl, pH 8.5; Substrate B: 3% H₂O₂) or Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Quantification was performed using ImageJ.

[0340] The results are as follows Figure 13 As shown in Figure F, Western blotting showed that the levels of HERVK-Env and IL6 proteins were increased in hMSCs treated with pLE4-TSPAN4-GFP-transfected senescent hMSC migrasomes, while the senescence-associated protein p21 was expressed. Cip1 The increase in protein indicates that migrasomes can transmit aging-related signals such as endogenous retroviruses and inflammatory factors between cells and promote the aging of young cells.

[0341] SA-β-gal staining observation:

[0342] The early passage WT hMSC cells prepared above and the hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP were fixed with fixative (2% (volume percentage, v / v) formaldehyde + 0.2% (volume percentage, v / v) glutaraldehyde + 97.8% (volume percentage, v / v) P) for 5 minutes, the fixative was aspirated and washed once with PBS, and incubated overnight (12 hours) at 37°C with SA-β-gal staining solution (40mM citric acid / sodium phosphate buffer, 5mM K4[Fe(CN)6], 5mM K3[Fe(CN)6], 150mMNaCl, 2mM MgCl2, 1mg / mL X-gal). After staining, the cells were washed twice with PBS. The stained cells were observed under an optical microscope, and the percentage of positive cells was analyzed by ImageJ software.

[0343] like Figure 13 Middle G shows (the control group is early-passage WT hMSC cells, and the migrasomes are hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP. The left side is a cell state diagram, and the right side is a bar graph showing the percentage of β-galactosidase-positive cells). SA-β-gal staining shows that the number of SA-β-gal-positive cells increased in hMSCs treated with senescent hMSC migrasomes transfected with pLE4-TSPAN4-GFP, indicating that the migrasomes of old cells promote the senescence of young cells.

[0344] This shows that migrasomes can transmit aging signals, and migrasomes released by senescent cells regulate cell aging.

[0345] The invention provides a corresponding data processing device and a diagnostic system.

[0346] Figure 14 A computer flow chart for implementing the method of the present invention for identifying or assisting in identifying the degree of aging of an organism or cell.

[0347] In step S1, the migratoria status of the subject or the test cell is received. The migratoria status can be at least one of the following:

[0348] 1) Number of migratory bodies per cell;

[0349] 2) The content of positive migratory bodies in each cell; the positive migratory bodies are migratory bodies containing specific contents, and the specific contents are endogenous retroviruses, inflammatory factors and / or mitochondrial outer membrane proteins.

[0350] In step S2, the migratoria status of the subject or the test cell is compared with the reference value.

[0351] In step S3, the degree of aging of the organism or cells is output from the computer based on the comparison result.

[0352] Figure 15 A computer flow chart for implementing the method of comparing the degree of aging of an organism or cell and the method of comparing the physiological age of an organism or cell according to the present invention.

[0353] In step S1, the migratoria status of the subject or the test cell is received.

[0354] In step S2, the migratoria status of the subject or the test cell is compared with a reference value. The migratoria status can be at least any one of the following:

[0355] 1) Number of migratory bodies per cell;

[0356] 2) The content of positive migratory bodies in each cell; the positive migratory bodies are migratory bodies containing specific contents, and the specific contents are endogenous retroviruses, inflammatory factors and / or mitochondrial outer membrane proteins.

[0357] In step S3, the degree of aging of the organism or cells is output from the computer based on the comparison result.

[0358] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A device having at least one of the following uses: B1. Identify or assist in identifying the degree of aging of an organism or cell; B2. Assess the physiological age of an organism or cell; B3. Diagnosis or auxiliary diagnosis of aging-related diseases; B4. Early warning of aging and / or age-related diseases; Characterized in that the device comprises: M1. Migratoria status receiving module: used to receive the migratoria status of the test organism or test cells, wherein the migratoria status includes the formation of migratoria or the contents of migratoria; M2. Result output module: used to compare the migratoria status of the subject or the test cell with the reference value, and output at least one of the following information from the computer based on the comparison result: B1-1, the degree of aging of the body or cells, B2-1, the physiological age of the body or cells, B3-1. Do you have aging-related diseases or are at risk of aging-related diseases? B4-1. Warning results of aging and / or age-related diseases.

2. A device having at least one of the following uses: A1. Compare the degree of aging of organisms or cells; A2. Compare the physiological age of organisms or cells; It is characterized by: The device comprises: M1. Migratoria status receiving module: used to receive migratoria status of two or more test subjects or test cells, wherein the migratoria status includes the formation of migratoria or the inclusion of contents; M2, score calculation module: used to calculate the score according to the status of the migrator; the score is at least one of the following: 1) Number of migratory bodies per cell; 2) The content of positive migrasomes per cell; the positive migrasomes are migrasomes containing specific contents, such as endogenous retroviruses, inflammatory factors, and / or mitochondrial outer membrane proteins; M3, result output module: used to output at least one of the following comparison results from the computer according to the score: D1. The degree of aging of the body or cells; D2. Physiological age of the body or cells.

3. The device according to claim 2, wherein The score is at least one of the following: A1, the number of migrasomes in each test cell; A2, the number of migrasomes containing endogenous retrovirus in each test cell; A3, the number of migratory bodies containing mitochondrial outer membrane proteins in each test cell; A4. The number of migrasomes containing inflammatory factors in each test cell.

4. Method, the method is any of the following: B1. Methods for identifying or assisting in identifying the degree of aging of an organism or cell; B2. Methods for assessing the physiological age of an organism or cell; B3. Methods for diagnosing or assisting in the diagnosis of aging-related diseases; B4. Methods for early warning of aging and / or age-related diseases; Its characteristics are: The method comprises: S1. Receiving migratoria status: Receiving migratoria status of the subject or test cells, wherein the migratoria status includes the formation of migratoria or the inclusion of contents; S2. Result output module: Compare the migratoria status of the subject or the test cell with a reference value, and output at least one of the following information from a computer based on the comparison result: B1-1, the degree of aging of the body or cells; B2-1, physiological age of the body or cell; B3-1. Whether you suffer from aging-related diseases or are at risk of aging-related diseases; B4-1. Warning results of aging and / or age-related diseases.

5. A system comprising the device of claim 1 or 2 and a substance, wherein the substance is at least one of the following: 1) Reagents and / or instruments for detecting migratory bodies; 2) Reagents and / or instruments for detecting the specific contents according to claim 1 or 2.

6. The device according to any one of claims 1 to 3, the method according to claim 4, or the system according to claim 5, characterized in that: The test cells are mesenchymal stem cells, fibroblasts and / or.

7. A computer-readable storage medium storing a computer program, wherein the computer program causes a computer to execute the steps of the method according to claim 4.

8. The system according to claim 7, characterized in that: The system further comprises the substance of claim 9.

9. A substance characterized in that The substance is any of the following: Y1. Substances for detecting the amount of migratory bodies; Y2. Detection of endogenous retroviral substances in migrating bodies; Y3. Detection of substances containing inflammatory factors in migratory bodies Y4. Detect substances of mitochondrial outer membrane proteins in mitosomes.

10. Any of the following uses of the substance: A1. Application in screening for cell senescence or preparing products for cell senescence; A2. Application in the diagnosis of cell aging or in the preparation of products for cell aging; A3. Application in assessing the risk of cellular senescence or preparing products for assessing the risk of cellular senescence; A4. Application in the assessment of cell senescence or in the preparation of products for the assessment of cell senescence; A5. Application in identifying and differentiating the degree of cell senescence or in preparing products for identifying the degree of cell senescence; The substance may be any of the following: Y1. Substances for detecting the amount of migratory bodies; Y2. Detection of endogenous retroviral substances in migrating bodies; Y3. Detection of substances containing inflammatory factors in migratory bodies Y4. Detect substances of mitochondrial outer membrane proteins in mitosomes.

Images