Editing tool for promoting target gene polyadenylation site and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to an editing tool for promoting target gene polyadenylation sites and application of the editing tool. According to the invention, the PAP alpha is modified according to the structural domain characteristics of the PAP alpha: an effect structural domain PAP structural domain is reserved, and an RRM structural domain is removed, so that a truncation body with high specificity and high-efficiency APA regulation and control functions is obtained. The truncated body protein PAP alpha delta RRM loses the original RNA binding capacity and cannot independently play an APA regulation function, the PAP alpha delta RRM is combined with dPspCas13b protein, the dPspCas13b protein is combined with crRNA, and then the PAP alpha delta RRM is guided to target precursor RNA, so that a target poly (A) site of a target gene is specifically promoted.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an editing tool for promoting the polyadenylation site of a target gene and its application. Background Art

[0002] The CRISPR / Cas system is an innate immune mechanism derived from bacteria and archaea that is used to recognize and cut foreign genetic material (such as phage DNA), thereby protecting the host from invasion. CRISPR / Cas systems are mainly divided into two categories: Class 1 (Type I, Type III, and Type IV) relies on a multi-protein complex to function, and Class 2 (Type II, Type V, and Type VI) only requires a single Cas protein to complete gene editing. Among them, the Type II system has become a core tool in the field of gene editing due to the high efficiency and ease of operation of the Cas9 protein. By artificially designing and in vitro transcribing RNA, sgRNA can be synthesized, which guides the Cas protein to specifically cut the target DNA sequence. By modifying the Cas protein, the CRISPR / Cas system can perform a variety of operations on genes, such as cutting, modifying, silencing, knocking out, and regulating expression. It has become an important tool for gene editing and research, with broad application prospects.

[0003] The CRISPR / Cas9 system performs gene editing by specifically recognizing target DNA and is primarily used to regulate gene expression. Studies have shown that the Cas13 protein can target mRNA for degradation.

[0004] During gene transcription in eukaryotic cells, precursor mRNA undergoes a series of processing steps, such as capping, cleavage, and tailing, ultimately becoming mature mRNA. Alternative polyadenylation (APA) often occurs at the 3' end of the precursor mRNA, resulting in mRNAs with varying 3' UTR lengths and even altering protein-coding sequences. Studies have found that APA is closely linked to tumorigenesis and progression, embryonic development, and immune responses. Therefore, a tool that can specifically intervene in APA is needed for basic APA research and targeted drug development.

[0005] However, currently, there are few tools for specifically intervening in APA, and most of them target the proximal poly(A) site. Using CRISPR / Cas9 technology, sgRNAs are designed near the poly(A) site to induce site-directed mutagenesis in the target DNA, thereby altering the APA events transcribed from the target mRNA (Wang et al., 2018)(Austin et al., 2024). However, this approach has significant limitations. CRISPR directly edits genomic DNA, resulting in low efficiency and potential harm. Naveed et al. (Naveed et al., 2021) used antisense oligonucleotides (ASOs) that bind to sequences surrounding the poly(A) site. These ASOs can physically block the recognition of nascent RNA by 3' end processing factors, thereby preventing tailing at the cut PAS. Although antisense oligonucleotides (ASOs) can effectively interfere with cleavage and polyadenylation and have even entered clinical trials (Havens and Hastings, 2016; MacLeod and Crooke, 2017), their cost is prohibitive for large-scale studies. Tian et al. (Tian et al., 2022) developed a CRISPR-iPAS approach to regulate poly(A) site utilization. They recruited a 3xEGFP-fused dPguCas13b protein to core regulatory elements near the poly(A) site, leveraging steric hindrance to prevent CPA factor recruitment and effectively promoting poly(A) site utilization. However, this approach requires precise gRNA targeting of poly(A) site elements. The high sequence similarity of poly(A) site elements increases the difficulty of gRNA design and compromises its specificity. Shin et al. (Shin et al., 2022) developed a CRISPR-pas approach to regulate APA, recruiting dCas9 to sequences downstream of the PAS. Steric hindrance from dCas9 leads to disengagement of the Pol II transcription complex, enhancing proximal PAS utilization. However, this approach also requires a high distance between the target sequence and the PAS site, which limits gRNA design.

[0006] Kelly et al. designed a fusion protein of dCas13b and the 3' processing factor NUDT21 to regulate APA (Kelly et al., 2019), but NUDT21 itself has the function of binding to RNA, which reduces its specificity. Summary of the Invention

[0007] To address the above-mentioned problems in the field, the present invention screened the PAPα protein truncations PAPαΔRRM based on the functions of the various PAPα domains, constructed the dPspCas13b-PAPαΔRRM fusion protein, designed crRNA for the target gene, and developed a new APA editing method. Experimental verification confirmed that it can specifically promote the target poly(A) site of the target gene. The technical solutions adopted by the present invention are as follows:

[0008] In a first aspect, the present invention provides a PAPα truncated protein, in which the RRM domain of PAPα is deleted. The amino acid sequence of the PAPα truncated protein is shown in SEQ ID NO: 1.

[0009] Poly(A) polymerase α (PAPα) is a 3' end processing factor that plays a key role in polyadenylation, promoting the use of proximal poly(A) sites. PAPα consists of five main domains: a PAP domain, which is the core domain of PAPα tailing; an RRM domain, which primarily binds to RNA; a serine- and threonine-rich S / T-rich domain; a motB domain; and a domain that interacts with NUDT21.

[0010] The second aspect of the present invention provides a fusion protein comprising the PAPα truncated protein according to claim 1 and the dPspCas13b protein.

[0011] In some embodiments of the present invention, the amino acid sequence of the dPspCas13b protein is shown in SEQ ID NO: 2.

[0012] In some embodiments of the present invention, the connection order of the dPspCas13b protein and the PAPα truncation protein is not limited, and the dPspCas13b protein can be located at the N-terminus or C-terminus of the PAPα truncation protein.

[0013] In some embodiments of the present invention, the dPspCas13b protein and the PAPα truncated protein can be connected by a connecting peptide, a nuclear import sequence, or can be directly connected.

[0014] The third aspect of the present invention provides a polyadenylation site editing tool, comprising a PAPα truncated protein, a dPspCas13b protein, a nuclear import signal, a screening protein, and a tag protein.

[0015] In some embodiments of the present invention, the structure of the polyadenylation site editing tool is:

[0016] Nuclear import signal-A-Nuclear import signal-B-Tag protein-Screening protein; or

[0017] Nuclear import signal-BA-nuclear import signal-tag protein-screening protein.

[0018] Among them, A and B are dPspCas13b protein and PAPα truncated protein, respectively.

[0019] In some embodiments of the present invention, the nuclear localization signal (NLS) is selected from at least one of nucleoplasmin NLS and SV40 NLS.

[0020] In some embodiments of the present invention, the screening protein is selected from at least one of BSD protein, PAC protein, Hygro protein, and Neo protein.

[0021] In some embodiments of the present invention, a self-cleaving polypeptide 2A may be present between the screening protein and the tag protein.

[0022] In some embodiments of the present invention, the self-cleaving polypeptide 2A is P2A.

[0023] In some embodiments of the present invention, the tag protein includes but is not limited to HA, Flag, GFP, GST, His and other conventional tag proteins in the art.

[0024] In some embodiments of the present invention, the components of the polyadenylation site editing tool can be connected by a connecting peptide. The connecting peptide is conventionally selected in the art, including but not limited to GGGGSn and GSSn.

[0025] In some embodiments of the present invention, the sequence of the connecting peptide is GGGGS (SEQ ID NO: 4).

[0026] In some embodiments of the present invention, a polyadenylation site editing tool dPspCas13b-PAPαΔRRM is provided, the amino acid sequence of which is shown in SEQ ID NO: 9.

[0027] In some embodiments of the present invention, a polyadenylation site editing tool PAPαΔRRM-dPspCas13b is provided, the amino acid sequence of which is shown in SEQ ID NO: 10.

[0028] In some embodiments of the present invention, the polyadenylation site editing tool actually performs editing on combinations of PAPαΔRRM truncated proteins and dPspCas13b proteins in different sequences.

[0029] The purpose of the NLS nuclear import signal is to help the editing tool enter the cell nucleus. In non-nuclear scenarios, the nuclear import signal can also be omitted.

[0030] The purpose of the tag protein, screening protein, and the self-cleaving polypeptide between the screening protein and the tag protein is to facilitate the screening, expression, and purification of the editing tool and is unrelated to polyadenylation site editing. The HA tag, P2A cleavage peptide, and BSD screening protein used in the examples of the present invention are merely one option for the polyadenylation site editing screening, expression, and purification process of the present invention. Routine modifications to these components by those skilled in the art are all part of the same technical concept as the present invention and should still be included in the scope of protection of the present invention.

[0031] In the above aspects of the present invention, simple replacements, additions, and deletions to the above amino acid sequences with a homology of more than 95% all belong to the same technical concept as the present invention. Other modifications obtained by technicians in this field without creative work all fall within the scope of protection of the present invention.

[0032] In some embodiments of the present invention, the polyadenylation site editing tool may further include a multiple cloning site sequence on the vector, which provides an enzyme cutting site to facilitate the insertion of the target gene.

[0033] The fourth aspect of the present invention provides a nucleic acid molecule, which can encode the PAPα truncated protein described in the first aspect of the present invention, the fusion protein described in the second aspect of the present invention, and / or the polyadenylation site editing tool described in the third aspect of the present invention.

[0034] The fifth aspect of the present invention provides a vector comprising the nucleic acid molecule described in the fourth aspect of the present invention.

[0035] The sixth aspect of the present invention provides the use of the PAPα truncated protein described in the first aspect of the present invention, the fusion protein described in the second aspect of the present invention, the polyadenylation site editing tool described in the third aspect of the present invention, the nucleic acid molecule described in the fourth aspect of the present invention, and / or the vector described in the fifth aspect of the present invention in selective polyadenylation regulation.

[0036] In some embodiments of the present invention, the selective polyadenylation regulation is to promote the poly (A) site of the target gene.

[0037] In some embodiments of the present invention, the applications include the development of molecular biological reagents, the development of disease target drugs, and the development of agricultural resources.

[0038] The seventh aspect of the present invention provides a method for promoting the poly(A) site of the target gene precursor mRNA, using the polyadenylation site editing tool described in the third aspect of the present invention or the vector of the fifth aspect of the present invention to treat the sample.

[0039] In some embodiments of the invention, the method comprises the steps of:

[0040] (1) Using crRNA targeting the target pre-mRNA to recognize the target pre-mRNA;

[0041] (2) using polyadenylation site editing tools to inhibit the target poly(A) site of the target pre-mRNA to achieve APA editing;

[0042] (3) verify the APA events and 3'UTR length of the mature mRNA transcribed after treatment;

[0043] (4) Use polyadenylation site editing tools and corresponding crRNA to edit the APA of the target gene precursor mRNA, thereby regulating the target gene mRNA.

[0044] In some embodiments of the present invention, the 5' end of the crRNA is a specific sequence that targets the target precursor mRNA through complementary pairing with the template; and the 3' end of the crRNA contains a repeat sequence (Direct repeats).

[0045] In some embodiments of the present invention, the 5' end specific sequence of the crRNA can be complementary to the upstream sequence of the poly (A) site of the target mRNA, and the crRNA can bind to the region 0-200bp upstream of the poly (A) site; the 3' end of the crRNA can form an mRNA secondary structure similar to a hairpin structure, and can be recognized and bound by dPspCas13b, the polyadenylation site editing tool of the third aspect of the present invention, other active Cas13b, or other Cas13 protease variants.

[0046] In some embodiments of the present invention, in step (1) of the method, the 5' end of the crRNA is a specific sequence that can bind to the region 0-200bp upstream of the poly (A) site, but should avoid the APA key element; the 3' end of the crRNA is a dPspCas13b / Cas13b recognition sequence.

[0047] In some embodiments of the present invention, in step (2) of the method, the polyadenylation site editing tool comprises a fusion combination of multiple Cas13b protease variants and PAPαΔRRM protein variants.

[0048] In some embodiments of the present invention, in step (2) of the method, the polyadenylation site editing tool and a single or multiple crRNAs are added to the reaction system together, the polyadenylation site editing tool binds to the crRNA, the crRNA recognizes the target mRNA, and the polyadenylation site editing tool inhibits the target poly (A) site of the target precursor mRNA to achieve APA editing.

[0049] In some embodiments of the present invention, in step (3) of the method, the 3'UTR verification includes verification of the efficiency of the polyadenylation site editing tool / crRNA system and verification of various biological functions of the processed mRNA.

[0050] In some embodiments of the present invention, in step (4) of the method, the polyadenylation site editing tool / crRNA system is used to perform targeted regulation of specific mRNA, including expression regulation, stability regulation, translation efficiency regulation, regulation of nuclear entry and exit ability, etc.

[0051] In some embodiments of the present invention, the method is performed in living cells, living animals, or in vitro; when the method is used in living animals, the method is for purposes other than disease diagnosis and treatment.

[0052] The eighth aspect of the present invention provides a polyadenylation site editing system, comprising the polyadenylation site editing tool of the third aspect of the present invention and crRNA designed for the target gene.

[0053] In some embodiments of the present invention, the present invention takes the three genes CTNNBIP1, SMAD4, and COL1A2 as examples and designs different crRNAs for verification.

[0054] Those skilled in the art can design different crRNAs for other target genes and perform APA editing of other target genes.

[0055] The design of the above-mentioned crRNA is a conventional technical means in the field, and the specific crRNA used in the examples of the present invention does not constitute a limitation of the present invention.

[0056] The beneficial effects of the present invention are:

[0057] The present invention modifies PAPα based on its domain characteristics: the effector domain PAP domain is retained, and the RRM domain is removed to obtain a truncated protein with high specificity and high efficiency APA regulatory function. This truncated protein PAPαΔRRM loses its original ability to bind RNA and cannot perform APA regulatory function alone. By combining PAPαΔRRM with the dPspCas13b protein, the dPspCas13b protein binds to the crRNA and then guides PAPαΔRRM to the target precursor RNA, thereby achieving specific promotion of the target poly(A) site of the target gene.

[0058] Quantitative PCR results showed that the dPspCas13b-PAPαΔRRM fusion protein can effectively promote the use of the proximal target poly(A) site of the target gene in the cell, transcribing mRNA with a shorter 3'UTR. The present invention integrates dPspCas13b and the modified PAPαΔRRM to achieve efficient and specific promotion of gene target poly(A) sites, providing a selective polyadenylation site editing tool with high specificity and flexibility in crRNA design for regulating the expression and function of target genes. This method can be used to study the biological functions of selective polyadenylation and provide new tools for the treatment of tumors and other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 It is a schematic diagram of the principle of the present invention.

[0060] Figure 2 Schematic diagram of dPspCas13b-PAPαΔRRM fusion protein and its variants.

[0061] Figure 3 Schematic diagram of the dual-luciferase reporter system.

[0062] Figure 4 The dPspCas13b-PAPαΔRRM fusion protein and its variant PAPαΔRRM-dPspCas13b fusion protein promote the use of the target poly(A) site of the target pre-mRNA to achieve APA editing.

[0063] Figure 5 Schematic diagram of crRNA targeting the endogenous CTNNBIP1 site.

[0064] Figure 6 Quantitative qPCR showed that the dPspCas13b-PAPαΔRRM fusion protein bound to crRNA targeting CTNNBIP1 and promoted the efficient use of the target poly(A) site in its pre-mRNA.

[0065] Figure 7Schematic diagram of crRNA targeting the SMAD4 site.

[0066] Figure 8 Schematic diagram of crRNA targeting the COL1A2 site.

[0067] Figure 9 Quantitative qPCR showed that the dPspCas13b-PAPαΔRRM fusion protein bound to crRNA targeting SMAD4 and COL1A2 to promote the efficient use of target poly(A) sites in their pre-mRNA. DETAILED DESCRIPTION

[0068] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0069] Example 1

[0070] This example analyzes the domain characteristics of PAPα and modifies PAPα based on its domain characteristics: retaining the effector domain PAP domain and removing the RRM domain to obtain a truncated form with high specificity and high efficiency APA regulatory function.

[0071] The amino acid sequence of the truncated protein PAPαΔRRM fragment is:

[0072] (SEQ ID NO: 1).

[0073] This truncated protein PAPαΔRRM loses its original ability to bind RNA and cannot play the APA regulatory function alone. By combining PAPαΔRRM with the dPspCas13b protein, the dPspCas13b protein binds to the crRNA and then guides PAPαΔRRM to the target precursor RNA, thereby achieving specific promotion of the target poly (A) site of the target gene.

[0074] The amino acid sequence of the dPspCas13b protein is as follows, which has H133A and H1058a mutations:

[0075]

[0076] In this example, two fusion proteins were designed, including dPspCas13b-PAPA-PAPαΔRRM and PAPαΔRRM-dPspCas13b.

[0077] dPspCas13b-PAPΑ-PAPαΔRRM, from N-terminus to C-terminus, contains: nucleoplasmin NLS (nuclear import signal) peptide fragment, dPspCas13b fragment, SV40 NLS (nuclear import signal) peptide fragment, linker peptide fragment, PAPαΔRRM fragment, linker peptide fragment, 3×HA fragment, P2A fragment, BSD fragment.

[0078] PAPαΔRRM-dPspCas13b, from N-terminus to C-terminus, contains: nucleoplasmin NLS (nuclear import signal) peptide fragment, PAPαΔRRM fragment, linker fragment, dPspCas13b fragment, SV40 NLS (nuclear import signal) peptide fragment, linker peptide fragment, 3×HA fragment, P2A fragment, and BSD fragment.

[0079] Among them, the amino acid sequence of the nucleoplasmin NLS (nuclear import signal) peptide fragment is:

[0080] KRPAATKKAGQAKKKK (SEQ ID NO: 3);

[0081] The amino acid sequence of the linker fragment is GGGGS (SEQ ID NO: 4);

[0082] The amino acid sequence of the SV40 NLS (nuclear import signal) peptide fragment is: PKKKRKV (SEQ ID NO: 5);

[0083] The amino acid sequence of the 3×HA fragment is: YPYDVPDYAYPYDVPDYAYPYDVPDYA (SEQ ID NO: 6); the amino acid sequence of the P2A fragment is: ATNFSLLKQAGDVEENPGP (SEQ ID NO: 7);

[0084] The amino acid sequence of the BSD fragment is:

[0085] MAKPLSQEESTLIERATATINSIPISEDYSVASAALSSDGRIFTGVNVYHFTGGPCAELVV LGTAAAAAAGNLTCIVAIGNENRGILSPCGRCRQVLLDLHPGIKAIVKDSDGQPTAVGIRELL PSGYVWEG (SEQ ID NO: 8).

[0086] Specifically, the sequence of dPspCas13b-PAPαΔRRM is:

[0087]

[0088] The sequence of PAPαΔRRM-dPspCas13b is:

[0089]

[0090] The structural diagrams of the two fusion proteins are shown in Figure 2. Figure 2 shown.

[0091] Example 2dPspCas13b-PAPαΔRRM fusion protein or its variant PAPαΔRRM-dPspCas13b can promote the use of the CTNNBIP1 proximal poly (A) site.

[0092] 1 Experimental Materials and Methods

[0093] 1.1 Main reagents and instruments

[0094] HEK293T cells were maintained in our laboratory or obtained from other routine laboratory laboratories and cell banks. Fetal bovine serum was purchased from Gbico, jetPRIME DNA / siRNA transfection reagent from Polyplus, Dual Luciferase Reporter Assay Kit from Vazyme, and luminescence detector from Glomax.

[0095] 1.2 Dual luciferase reporter system

[0096] The proximal poly (A) site signal of the CTNNBIP1 gene and 100bp upstream and downstream were cloned into the psiCHECK-2 plasmid. An element that can be accurately recognized and targeted by crRNA was also designed at the 5' end of this element. The dPspCas13b-PAPαΔRRM fusion protein or its variant can recognize and target this site through crRNA. The reporter system contains a Renilla luciferase reporter gene (hRluc) and a Firefly luciferase reporter gene (hLuc) at both ends, which are mediated by IRES to enable independent translation. When the proximal poly (A) site of CTNNBIP1 is used, the transcribed mRNA will be cut after the poly (A) site, and the Firefly luciferase reporter gene at the 3' end will not be translated, and hRluc / hluc will become larger, otherwise it will become smaller. Therefore, the value of hRluc / hluc can reflect the usage of the poly (A) site. The structural diagram of the dual luciferase reporter system is shown in the figure. Figure 3 shown.

[0097] The sequence of the dual-luciferase reporter system is as follows:

[0098] ATGGCTTCCAAGGTGTACGACCCCGAGCAACGCAAACGCATGATCACTGGGCCTCA

[0099] GTGGTGGGCTCGCTGCAAGCAAATGAACGTGCTGGACTCCTTCATCAACTACTATGATTC

[0100] CGAGAAGCACGCCGAGAACGCCGTGATTTTTCTGCATGGTAACGCTGCCTCCAGCTACC

[0101] TGTGGAGGCACGTCGTGCCTCACATCGAGCCCGTGGCTAGATGCATCATCCCTGATCTGA

[0102] TCGGAATGGGTAAGTCCGGCAAGAGCGGGAATGGCTCATATCGCCTCCTGGATCACTAC

[0103] AAGTACCTCACCGCTTGGTTCGAGCTGCTGAACCTTCCAAAGAAAATCATCTTTGTGGG

[0104] CCACGACTGGGGGGCTTGTCTGGCCTTTCACTACTCCTACGAGCACCAAGACAAGATCA

[0105] AGGCCATCGTCCATGCTGAGAGTGTCGTGGACGTGATCGAGTCCTGGGACGAGTGGCCT

[0106] GACATCGAGGAGGATATCGCCCTGATCAAGAGCGAAGAGGGCGAGAAAATGGTGCTTG

[0107] AGAATAACTTCTTCGTCGAGACCATGCTCCCAAGCAAGATCATGCGGAAACTGGAGCCT

[0108] GAGGAGTTCGCTGCCTACCTGGAGCCATTCAAGGAGAAGGGCGAGGTTAGACGGCCTA

[0109] CCCTCTCCTGGCCTCGCGAGATCCCTCTCGTTAAGGGAGGCAAGCCCGACGTCGTCCAG

[0110] ATTGTCCGCAACTACAACGCCTACCTTCGGGCCAGCGACGATCTGCCTAAGATGTTCATC

[0111] GAGTCCGACCCTGGGTTCTTTTCCAACGCTATTGTCGAGGGAGCTAAGAAGTTCCCTAA

[0112] CACCGAGTTCGTGAAGGTGAAGGGCCTCCACTTCAGCCAGGAGGACGCTCCAGATGAA

[0113] ATGGGTAAGTACATCAAGAGCTTCGTGGAGCGCGTGCTGAAGAACGAGCAGTAATTCTA

[0114] GGCGATCGCTCGAGctgctttcaaagaattaccattttttctttggctgcaggtgttctgctgatatcaacagcttccctattttgaatgca

[0115] gaaaacagggtctgggacattagtcgttatatttgacttgaaaagaaagaaaccaagtgcgctttgcaatatttattacacaaagaacttgctgctg

[0116] ccttcacatttggggtttgtgtttgattggctttcgatgcgtgtgtttggtttccGAATTCGCCCCTCTCCCTCCCCCCCCCCT

[0117] AACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTT

[0118] TCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTG

[0119] ACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGT

[0120] CGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACC

[0121] CTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCAC

[0122] GTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATA

[0123] GTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGC

[0124] CCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATG

[0125] TGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCC

[0126] TTTGAAAAACACGATGATAATATGGCCACAACCATGGCCGATGCTAAGAACATTAAGAA

[0127] GGGCCCTGCTCCCTTCTACCCTCTGGAGGATGGCACCGCTGGCGAGCAGCTGCACAAGG

[0128] CCATGAAGAGGTATGCCCTGGTGCCTGGCACCATTGCCTTCACCGATGCCCACATTGAG

[0129] GTGGACATCACCTATGCCGAGTACTTCGAGATGTCTGTGCGCCTGGCCGAGGCCATGAA

[0130] GAGGTACGGCCTGAACACCAACCACCGCATCGTGGTGTGCTCTGAGAACTCTCTGCAGT

[0131] TCTTCATGCCAGTGCTGGGCGCCCTGTTCATCGGAGTGGCCGTGGCCCCTGCTAACGAC

[0132] ATTTACAACGAGCGCGAGCTGCTGAACAGCATGGGCATTTCTCAGCCTACCGTGGTGTT

[0133] CGTGTCTAAGAAGGGCCTGCAGAAGATCCTGAACGTGCAGAAGAAGCTGCCTATCATCC

[0134] AGAAGATCATCATCATGGACTCTAAGACCGACTACCAGGGCTTCCAGAGCATGTACACA

[0135] TTCGTGACATCTCATCTGCCTCCTGGCTTCAACGAGTACGACTTCGTGCCAGAGTCTTTC

[0136] GACAGGGACAAAACCATTGCCCTGATCATGAACAGCTCTGGGTCTACCGGCCTGCCTAA

[0137] GGGCGTGGCCCTGCCTCATCGCACCGCCTGTGTGCGCTTCTCTCACGCCCGCGACCCTAT

[0138] TTTCGGCAACCAGATCATCCCCGACACCGCTATTCTGAGCGTGGTGCCATTCCACCACGG

[0139] CTTCGGCATGTTCACCACCCTGGGCTACCTGATTTGCGGCTTTCGGGTGGTGCTGATGTA

[0140] CCGCTTCGAGGAGGAGCTGTTCCTGCGCAGCCTGCAAGACTACAAAATTCAGTCTGCCC

[0141] TGCTGGTGCCAACCCTGTTCAGCTTCTTCGCTAAGAGCACCCTGATCGACAAGTACGAC

[0142] CTGTCTAACCTGCACGAGATTGCCTCTGGCGGCGCCCCACTGTCTAAGGAGGTGGGCGA

[0143] AGCCGTGGCCAAGCGCTTTCATCTGCCAGGCATCCGCCAGGGCTACGGCCTGACCGAGA

[0144] CAACCAGCGCCATTCTGATTACCCCAGAGGGCGACGACAAGCCTGGCGCCGTGGGCAA

[0145] GGTGGTGCCATTCTTCGAGGCCAAGGTGGTGGACCTGGACACCGGCAAGACCCTGGGA

[0146] GTGAACCAGCGCGGCGAGCTGTGTGTGCGCGGCCCTATGATTATGTCCGGCTACGTGAA

[0147] TAACCCTGAGGCCACAAACGCCCTGATCGACAAGGACGGCTGGCTGCACTCTGGCGAC

[0148] ATTGCCTACTGGGACGAGGACGAGCACTTCTTCATCGTGGACCGCCTGAAGTCTCTGAT

[0149] CAAGTACAAGGGCTACCAGGTGGCCCCAGCCGAGCTGGAGTCTATCCTGCTGCAGCACC

[0150] CTAACATTTTCGACGCCGGAGTGGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCT

[0151] GCCGCCGTCGTCGTGCTGGAACACGGCAAGACCATGACCGAGAAGGAGATCGTGGACT

[0152] ATGTGGCCAGCCAGGTGACAACCGCCAAGAAGCTGCGCGGCGGAGTGGTGTTCGTGGA

[0153] CGAGGTGCCCAAGGGCCTGACCGGCAAGCTGGACGCCCGCAAGATCCGCGAGATCCTG

[0154] ATCAAGGCTAAGAAAGGCGGCAAGATCGCCGTGTAA(SEQ ID NO:11).

[0155] 1.3 Cell resuscitation and culture

[0156] Remove HEK293T cells from a liquid nitrogen tank and rapidly thaw in a 37°C water bath. Transfer the cell suspension to a 1.5 mL centrifuge tube in a clean bench and centrifuge at 290 g for 5 minutes. Discard the supernatant and add 5 mL of DMEM medium containing 10% FBS. Incubate in a 5% CO2, 37°C atmosphere.

[0157] 1.4 Cell treatment and transfection experiments

[0158] The adherent HEK293T cells were digested and resuspended, plated into 48-well plates, and 5x10 4 Cells were pre-cultured in the culture plate in an incubator for 24 hours. When the cell density reached 50-60% confluence, transfection was performed using jetPRIME DNA / siRNA transfection reagent. The main steps were as follows: 500 ng of dPspCas13b-PAPαΔRRM / PAPαΔRRM-dPspCas13b overexpression plasmid, 500 ng of crRNA overexpression plasmid, and 300 ng of dual-luciferase reporter system overexpression plasmid were diluted with 100 μL jetPRIME buffer, 2.6 μL of jetPRIME was added and vortexed to mix, incubated at room temperature for 10 minutes, and then added to each set of culture wells of the culture plate containing cells and culture medium, with four replicates per set. After the cells were cultured in a 37°C CO2 incubator for 4-6 hours, the culture medium containing the transfection reagent was removed and replaced with fresh cell culture medium containing 10% FBS, and cultured for another 48 hours.

[0159] The crRNA overexpression plasmid is U6-BsmBI-crRNA plasmid, and the sequence is as follows:

[0160] gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaat tatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccggagacgggataccgtctctgttgtggaaggtccagttttgaggggctattacaactttttt(SEQ ID NO: 12).

[0161] According to the target site sequence, upstream and downstream primers with specific structure and complementary base pairing are designed respectively, and after annealing, they are connected to the U6-BsmBI-crRNA vector to construct target-specific crRNA.

[0162] Primer structure: linker crRNA; the upstream primer linker is acaccg, the downstream primer linker is acaaca, and the crRNA sequence is as follows:

[0163] target-crRNA: tggtaattctttgaaagcag (SEQ ID NO: 13);

[0164] 1.5 Dual luciferase reporter system to test the use of proximal poly(A) sites

[0165] The Dual Luciferase Reporter Assay Kit (Vazyme) was used to detect the fluorescence signal of the dual-luciferase reporter system. The main steps were as follows: After 48 hours of culture, cells were lysed with 50 μL of 1× Cell Lysis Buffer on a shaker at room temperature for 5 minutes. The lysate was aspirated into a 1.5 ml centrifuge tube, 20 μL of Luciferase Substrate equilibrated to room temperature was added, mixed rapidly, and the activity of the Firefly luciferase reporter gene (hluc) was immediately measured in a luminometer. To this reaction solution, 20 μL of freshly prepared Renilla substrate was added, mixed rapidly, and the activity of the Renilla luciferase reporter gene (hRluc) was immediately measured in a luminometer. The results were statistically analyzed, and the hRluc / hluc ratio of each group was normalized to the control group's hRluc / hluc ratio of 1. The resulting values were used to compare the treated and control groups.

[0166] 2 Results

[0167] In this example, the crRNA targeting site (ctgctttcaaagaattacca, SEQ ID NO: 14) and the proximal PAS of CTNNBIP1 were cloned into the psiCHECK-2 plasmid to construct a dual luciferase reporter system ( Figure 3). dPspCas13b-PAPαΔRRM fusion protein or its variant PAPαΔRRM-dPspCas13b combined with crRNA that can target the target position in the dual luciferase reporter system and the dual luciferase reporter system were transfected into HEK293T cells. The experiment found that hRluc / hluc increased, indicating that dPspCas13b-PAPαΔRRM fusion protein or its variant PAPαΔRRM-dPspCas13b can promote the use of proximal PAS of CTNNBIP1 ( Figure 4 ).

[0168] Example 3d PspCas13b-PAPαΔRRM fusion protein promotes the target poly (A) site of CTNNBIP1 pre-mRNA

[0169] 1 Experimental Materials and Methods

[0170] 1.1 Main reagents and instruments

[0171] The SW620-dPspCas13b-PAPαΔRRM stably expressing cell line was maintained in our laboratory (SW620 cells stably expressing dPspCas13b-PAPαΔRRM). Fetal bovine serum was purchased from Gbico, jetPRIME DNA / siRNA transfection reagent was purchased from Polyplus, the high-temperature resistant premixed first-strand cDNA synthesis kit was purchased from TransGen Biotech, and the SYBR Green Pro Taq HS premixed qPCR kit was purchased from Accurium Biotech (AG). The LightCycler 480II fluorescence quantitative PCR instrument was purchased from Roche.

[0172] 1.2 Cell recovery and culture

[0173] Remove the SW620-dPspCas13b-PAPαΔRRM stably expressing cell line from a liquid nitrogen tank and rapidly thaw in a 37°C water bath. Transfer the cell suspension to a 1.5 mL centrifuge tube in a clean bench and centrifuge at low speed at 290 g for 5 minutes. Discard the supernatant and add 5 mL of 1640 medium containing 10% FBS. Incubate in a 5% CO2, 37°C atmosphere.

[0174] 1.3 Cell treatment and transfection experiments

[0175] Adherent SW620-dPspCas13b-PAPαΔRRM cells were digested and resuspended, then plated into 12-well plates at 2x105 cells per well. The plates were pre-incubated in an incubator for 24 hours. When the cells reached 50-60% confluence, transfection was performed using jetPRIME DNA / siRNA transfection reagent. The main steps were: 1.5 μg of crRNA overexpression plasmid was diluted in 150 μL jetPRIME buffer, 3 μL jetPRIME was added, and the cells were vortexed to mix. After incubation at room temperature for 10 minutes, the cells were added to each well of the culture plate containing cells and culture medium. After incubation at 37°C in a CO2 incubator for 4-6 hours, the culture medium containing the transfection reagent was removed and replaced with fresh cell culture medium containing 10% FBS, and the culture was continued for 48 hours.

[0176] The crRNA overexpression plasmid was U6-BsmBI-crRNA plasmid, the same as in Example 2.

[0177] The crRNA was designed for the CTNNBIP1 gene, and the specific sequence is as follows:

[0178] CTNNBIP1-crRNA1: acctaactaaagcaccagagctc (SEQ ID NO: 15);

[0179] CTNNBIP1-crRNA2:tctaaaaaaatgacctaactaaa (SEQ ID NO: 16);

[0180] CTNNBIP1-crRNA3:acagatcctttccagtttaagca (SEQ ID NO: 17);

[0181] CTNNBIP1-crRNA4:ttgatatcagcagaacacctgca (SEQ ID NO: 18);

[0182] CTNNBIP1-crRNA5: tctgcattcaaaatagggaagct (SEQ ID NO: 19).

[0183] 1.4 Total RNA extraction from cells and RT-qPCR detection of target mRNA APA editing

[0184] Total RNA was extracted from cells using TRIzol reagent (Invitrogen), and the extracted RNA was reverse transcribed using a high-temperature resistant fully premixed first-strand cDNA synthesis kit (TransGen Biotech). The reverse transcription reaction was carried out at 50°C for 5 minutes to obtain cDNA, which was then analyzed by quantitative real-time PCR using a SYBR Green Pro Taq HS premixed qPCR kit (AG). After the completion of the quantitative real-time PCR reaction, the amplification curve and melting curve of the quantitative real-time PCR were confirmed, and the results were statistically analyzed using the △△Ct method. Where △Ct = mRNA proximal PAS Ct value - mRNA distal PAS Ct value, △△Ct = experimental group △Ct - control group △Ct, and gene relative expression = 2 -△△Ct .

[0185] 2 Results

[0186] In this example, the crRNA targeting position is located 40-200 bp upstream of the proximal poly(A) site of endogenous CTNNBIP1 ( Figure 5 RT-qPCR analysis showed that crRNA combined with dPspCas13b-PAPαΔRRM targeting upstream of CTNNBIP1 significantly increased the ratio of proximal PAS usage to distal PAS usage ( Figure 6 ), indicating that the dPspCas13b-PAPαΔRRM / crRNA system can significantly promote single-gene APA. In addition, the effect of crRNA5 in promoting APA is not ideal, considering that the target site covers the APA key element USE, so the crRNA design of this system should avoid APA key elements.

[0187] Example 4d PspCas13b-PAPαΔRRM fusion protein enables multiple crRNAs to promote the target poly (A) site of target gene pre-mRNA

[0188] 1 Experimental Materials and Methods

[0189] 1.1 Main reagents and instruments

[0190] The SW620-dPspCas13b-PAPαΔRRM stably expressing cell line was maintained in our laboratory. Fetal bovine serum was purchased from Gbico, jetPRIME DNA / siRNA transfection reagent was purchased from Polyplus, the high-temperature resistant premixed first-strand cDNA synthesis kit was purchased from TransGen Biotech, and the SYBR Green Pro Taq HS premixed qPCR kit was purchased from Accurium Biotechnology (AG). The LightCycler 480II fluorescence quantitative PCR instrument was purchased from Roche.

[0191] 1.2 Cell recovery and culture

[0192] Remove the SW620-dPspCas13b-PAPαΔRRM stably expressing cell line from a liquid nitrogen tank and rapidly thaw in a 37°C water bath. Transfer the cell suspension to a 1.5 mL centrifuge tube in a clean bench and centrifuge at low speed at 290 g for 5 minutes. Discard the supernatant and add 5 mL of 1640 medium containing 10% FBS. Incubate in a 5% CO2, 37°C atmosphere.

[0193] 1.3 Cell treatment and transfection experiments

[0194] The adherent SW620-dPspCas13b-PAPαΔRRM cells were digested and resuspended, plated into 12-well plates, 2x105 cells were added to each well, and the culture plates were pre-cultured in the incubator for 24 hours. When the cell density reached 50-60% confluence, transfection was performed using jetPRIME DNA / siRNA transfection reagent. The main steps are: dilute 1.5μg of crRNA overexpression plasmid (three crRNAs targeting the same gene) with 150μL jetPRIME buffer, add 3μL jetPRIME and vortex to mix, incubate at room temperature for 10 minutes, and then add to each well of the culture plate containing cells and culture medium. After the cells were cultured in a CO2 incubator at 37°C for 4-6 hours, the culture medium containing the transfection reagent was removed and replaced with fresh cell culture medium containing 10% FBS and continued to be cultured for 48 hours.

[0195] The crRNA overexpression plasmid was U6-BsmBI-crRNA plasmid, the same as in Example 3.

[0196] crRNA was designed for SMAD4 and COL1A2 genes, and the specific sequences are as follows:

[0197] SMAD4-crRNA1: attgatggcaaagggcttagaat (SEQ ID NO: 20);

[0198] SMAD4-crRNA2: caaagtcactgccaattgatatg (SEQ ID NO: 21);

[0199] SMAD4-crRNA3:ttctacttaaattctctatacaa (SEQ ID NO: 22);

[0200] COL1A2-crRNA1: aatccttctttttctcttttgcc (SEQ ID NO: 23);

[0201] COL1A2-crRNA2: atgaaactgtattgcacaatgct (SEQ ID NO: 24);

[0202] COL1A2-crRNA3:tttgggggagcgggggaaggagt (SEQ ID NO: 25).

[0203] 1.4 Total RNA extraction from cells and RT-qPCR detection of target mRNA APA editing

[0204] Total RNA was extracted from cells using TRIzol reagent (Invitrogen), and the extracted RNA was reverse transcribed using a high-temperature premixed first-strand cDNA synthesis kit (TransGen Biotech). The reverse transcription reaction was performed at 50°C for 5 minutes to obtain cDNA, which was then analyzed by quantitative real-time PCR using a SYBR Green Pro Taq HS premixed qPCR kit (AG). After the completion of the quantitative real-time PCR reaction, the amplification curve and melting curve of the quantitative real-time PCR were confirmed, and the results were statistically analyzed using the △△Ct method. Where △Ct = mRNA proximal PAS Ct value - mRNA distal PAS Ct value, △△Ct = experimental group △Ct - control group △Ct, gene relative expression = 2 -△△Ct .

[0205] 2 Results

[0206] In this embodiment, the crRNA targeting SMAD4 is located 60-120 bp upstream of the proximal poly(A) site of endogenous SMAD4 ( Figure 7 ), the crRNA targeting COL1A2 is located 60-130 bp upstream of the proximal poly(A) site of endogenous COL1A2 ( Figure 8RT-qPCR analysis showed that crRNA combined with dPspCas13b-PAPαΔRRM targeting the upstream of the corresponding gene significantly increased the ratio of proximal PAS usage to distal PAS usage ( Figure 9 ), indicating that the simultaneous application of multiple crRNAs by the dPspCas13b-PAPαΔRRM fusion protein can significantly promote single-gene APA.

[0207] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. A PAPα truncated protein, characterized in that: The amino acid sequence of the PAPα truncated protein is shown in SEQ ID NO:

1.

2. A fusion protein, characterized in that: Comprising the PAPα truncated protein and dPspCas13b protein according to claim 1; The amino acid sequence of the dPspCas13b protein is shown in SEQ ID NO:

2.

3. A polyadenylation site editing tool, characterized in that: The polyadenylation site editing tool includes the PAPα truncated protein according to claim 1, as well as the dPspCas13b protein, a nuclear import signal, a screening protein, and a tag protein.

4. The polyadenylation site editing tool according to claim 3, wherein: The structure of the polyadenylation site editing tool is as follows: Nuclear import signal-A-Nuclear import signal-B-Tag protein-Screening protein; or Nuclear import signal-BA-nuclear import signal-tag protein-screening protein; Among them, A and B are dPspCas13b protein and PAPα truncated protein, respectively.

5. The polyadenylation site editing tool according to claim 4, wherein: The nuclear import signal is selected from at least one of nucleoplasmin NLS and SV40 NLS.

6. The polyadenylation site editing tool according to claim 4, wherein: The screening protein is selected from at least one of BSD protein, PAC protein, Hygro protein and Neo protein.

7. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the PAP A truncated protein according to claim 1, the fusion protein according to claim 2, and / or the polyadenylation site editing tool according to any one of claims 3 to 6. A vector comprising the nucleic acid molecule according to claim 7 .

9. Use of the PAPα truncated protein according to claim 1, the fusion protein according to claim 2, the polyadenylation site editing tool according to any one of claims 3 to 6, the nucleic acid molecule according to claim 7, and / or the vector according to claim 8 in selective polyadenylation regulation; The selective polyadenylation regulation is to promote the poly (A) site of the target gene.

10. A method for promoting the poly(A) site of target gene pre-mRNA, comprising treating a sample with the polyadenylation site editing tool according to any one of claims 3 to 6 or the vector according to claim 8.

Images