GbWRKY65 gene and application thereof in regulation and control of verticillium wilt resistance of plants

Abstract

The invention relates to a GbWRKY65 gene and application of the GbWRKY65 gene in regulation and control of verticillium wilt resistance of plants. The nucleotide sequence of the GbWRKY65 gene is as shown in SEQ ID No. 1 (sequence identifier number 1). The related disease-resistant GbWRKY65 gene is selected from sea island cotton resistant to verticillium wilt by utilizing a multi-omics technology, the expression modes of the gene in a cotton disease-resistant variety Hai 7124 and a susceptible variety Xinhai 14 are analyzed, subcellular localization analysis is carried out in tobacco, meanwhile, a VIGS experiment is carried out on the gene in the Hai 7124, and a result shows that the gene has a disease-resistant characteristic and can be used for preparing a disease-resistant GbWRKY65 gene. The gene is provided for creating an anti-verticillium wilt resource by using a biological breeding means.

Description

Technical Field

[0001] The present application belongs to the technical field of cotton resistance breeding, and specifically relates to a GbWRKY65 gene and its application in regulating plant resistance to Verticillium wilt. Background Art

[0002] Cotton is an essential product and a fundamental industry for the national economy and people's livelihood. Xinjiang's uniquely endowed sunlight and heat resources have made it my country's largest base for high-quality cotton. Currently, the world's most widely cultivated tetraploid cotton varieties are mainly Upland cotton (G. hirsutum) and Sea island cotton (G. barbadense). With the interregional transportation of cotton seeds, year-round continuous cropping, and the return of cotton stalks to the fields, the incidence of Verticillium wilt in cotton has become increasingly severe. The disease now covers more than half of the cotton cultivated area, causing yield reductions ranging from 10% to 30-50%. Currently, no effective control measures have been found, and it has become a major constraint to the sustainable development of cotton. Production practice has shown that cultivating and planting disease-resistant varieties is the most cost-effective way to address the damage caused by Verticillium wilt in cotton. However, there is a lack of highly resistant varieties in Upland cotton. Compared to Upland cotton, Sea island cotton is more resistant to Verticillium wilt. Therefore, identifying resistance genes from Sea island cotton offers a promising avenue for improving Upland cotton.

[0003] The WRKY transcription factor family is one of the most numerous transcription factors in plants. They play a crucial role in plant responses to pathogen invasion, participating in pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) mediated by pattern recognition receptors (PRRs). They regulate plant disease resistance by modulating plant hormone signaling pathways (such as salicylic acid (SA), jasmonic acid (JA), and abscisic acid (ABA)) or by binding their highly conserved WRKY domains to cis-acting elements such as W-box, thereby regulating the expression of downstream defense genes. Studies have shown that WRKY transcription factors coordinate plant defense responses through multiple signaling pathways and complex transcriptional regulatory networks. Summary of the Invention

[0004] In view of this, the main purpose of the present invention is to provide a GbWRKY65 gene and its application in regulating plant resistance to Verticillium wilt. The technical problem to be solved is to select a GbWRKY65 gene related to Verticillium wilt from Verticillium wilt-resistant Sea Island cotton through multi-omics technology. This gene can regulate the resistance of Sea Island cotton to Verticillium wilt, providing a gene for creating Verticillium wilt-resistant resources using biological breeding methods.

[0005] The purpose of the present invention and the technical problem solved are achieved by adopting the following technical solutions: The present invention proposes a GbWRKY65 gene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0006] The objectives and technical problems solved by the present invention can be further achieved by adopting the following technical measures.

[0007] Preferably, the aforementioned GbWRKY65 gene is located in the cell nucleus.

[0008] Preferably, the aforementioned GbWRKY65 gene is expressed in the roots, stems and leaves of cotton.

[0009] The purpose of the present invention and the technical problems solved therein can also be achieved by adopting the following technical solutions: The present invention proposes an application of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt.

[0010] The objectives and technical problems solved by the present invention can be further achieved by adopting the following technical measures.

[0011] Preferably, the aforementioned GbWRKY65 gene is used for regulating plant resistance to Verticillium wilt, wherein the plant is cotton or tobacco.

[0012] Preferably, in the use of the aforementioned GbWRKY65 gene in regulating plant resistance to Verticillium wilt, the cotton is the disease-resistant variety Hai 7124 or the disease-susceptible variety Xinhai 14.

[0013] Preferably, the aforementioned GbWRKY65 gene is used to regulate plant resistance to Verticillium wilt, wherein the use comprises the following steps: regulating the plant's resistance to Verticillium wilt by regulating the transcription and translation levels of the GbWRKY65 gene in the plant.

[0014] Preferably, the use of the aforementioned GbWRKY65 gene in regulating plant resistance to Verticillium wilt comprises the following steps:

[0015] By constructing an overexpression vector of the GbWRKY65 gene and transforming plants through Agrobacterium-mediated genetic transformation, a GbWRKY65 gene overexpression strain was obtained.

[0016] Preferably, the use of the aforementioned GbWRKY65 gene in regulating plant resistance to Verticillium wilt comprises the following steps:

[0017] The GbWRKY65 gene in cotton was silenced by VIGS, which reduced the relative expression level of the GbWRKY65 gene in cotton.

[0018] Preferably, the use of the aforementioned GbWRKY65 gene in regulating plant resistance to Verticillium wilt comprises the following steps:

[0019] The GbWRKY65 gene in cotton was silenced by the VIGS method, reducing the expression level of the GbWRKY65 gene in cotton to 0.21.

[0020] Compared with the prior art, the GbWRKY65 gene of the present invention and its application in regulating plant resistance to Verticillium wilt have the following beneficial effects:

[0021] The present invention uses multi-omics technology to select the relevant disease-resistant GbWRKY65 gene from the Verticillium wilt-resistant sea island cotton, analyzes the expression pattern of the gene in the disease-resistant variety Hai 7124 and the susceptible variety Xinhai 14, and conducts subcellular localization analysis in tobacco. At the same time, VIGS experiments are carried out on this gene in Hai 7124. The results show that this gene has disease-resistant properties. The gene is transferred into tobacco through the Agrobacterium-mediated method. After inoculation with Verticillium wilt, the transgenic plants have improved disease resistance to Verticillium wilt compared with the wild type, providing genes for creating Verticillium wilt-resistant resources using biological breeding methods.

[0022] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a detailed description of the preferred embodiments of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Electrophoresis detection of PCR products of the GbWRKY65 gene of the present invention, wherein the marker size is 200-4500 bp, lanes 1 and 2 are both Hai7124, from left to right are 1, 2, marker;

[0024] Figure 2 The sequence of the GbWRKY65 gene of the present invention was analyzed using the NCBI database for conserved domains.

[0025] Figure 3 The expression of GFP::GbWRKY65 fusion protein was observed 48 hours after the transient transformation of tobacco leaves mediated by Agrobacterium of the present invention;

[0026] Figure 4 The present invention used the cotton database (http: / / cotton.zju.edu.cn / ) to analyze the expression levels of the GbWRKY65 gene in different cotton tissues (roots, stems, and leaves) of Hai7124;

[0027] Figure 5The results of the analysis of the GbWRKY65 expression pattern of the present invention are as follows: RT-PCR analysis results of the GbWRKY65 gene expression pattern of the roots of Xinhai 14 and Hai7124 at 0, 1, 2, 3, 5 and 7 dpi after infection with Verticillium dahliae V592;

[0028] Figure 6 This is the electrophoresis detection of the PCR product of the VIGS vector fragment of the GbWRKY65 gene of the present invention. The marker size is 100-2000bp, and lanes 1 and 2 are the GbWRKY65 gene silencing fragments;

[0029] Figure 7 The GBCLA1 gene silencing effect in cotton plants after VIGS injection is performed on the cotton plants of the present invention;

[0030] Figure 8 The GbWRKY65 gene of the present invention positively regulates cotton resistance to Verticillium dahliae. (A) Detection of the silencing efficiency of the GbWRKY65 gene, and detection of the expression level of the GbWRKY65 gene two weeks after injection; (B) Disease index of TRV:00 plants and TRV:GbWRKY65 plants 25 days and 35 days after infection with Verticillium dahliae, and the disease levels of more than 30 cotton seedlings were counted; (C) Phenotypes of TRV:00 plants and TRV:GbWRKY65 plants 20 days after infection with Verticillium dahliae, scale bar = 2 cm. (D) Recovery culture test of Verticillium dahliae in the stems after inoculation of TRV:00 plants and TRV:GbWRKY65 plants. The t-test was used to analyze the difference in gene expression, and * indicates significant difference (*p<0.05; **p<0.01; ***p<0.001);

[0031] Figure 9 This is a comparative diagram of CAT enzyme activity, PAL enzyme activity and lignin content between the silenced plants of the present invention and the control;

[0032] Figure 10 This is the identification of disease resistance of transgenic tobacco with the GbWRKY65 gene of the present invention. DETAILED DESCRIPTION

[0033] To further illustrate the technical means and efficacy of the present invention to achieve its intended objectives, the following, in conjunction with preferred embodiments, describes in detail the specific embodiments, structures, features, and efficacy of the GbWRKY65 gene and its application in regulating plant resistance to Verticillium wilt. In the following description, different references to "one embodiment" or "embodiment" do not necessarily refer to the same embodiment. Furthermore, specific features, structures, or characteristics of one or more embodiments may be combined in any suitable manner.

[0034] Unless otherwise specified, the materials and reagents mentioned below are all commercially available products familiar to those skilled in the art; unless otherwise specified, the methods described are all methods well known in the art. Unless otherwise defined, technical or scientific terms used should have the same meanings as those of ordinary skill in the art. Where specific experimental procedures or conditions are not specified below, the procedures or conditions described in the literature in this field can be followed.

[0035] Some embodiments of the present invention provide a GbWRKY65 gene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0036] In some optional embodiments, the subcellular localization results indicate that the GbWRKY65 gene is localized in the cell nucleus.

[0037] The operation process of the subcellular localization is as follows: 1. Tobacco culture: sow a number of tobacco seeds, culture them at 26°C under light conditions (16h / 8h: day / night), and culture them for 3 weeks before use in experiments; 2. Agrobacterium culture: the constructed vector plasmid is transformed into Agrobacterium (GV3101) by electroporation and cultured at 30°C for 2 days; 3. Suspend Agrobacterium: use a 0.5mm inoculation loop to remove Agrobacterium from a 1cm bacterial cake on a solid culture dish, and place the obtained bacterial cake into 1ml LB liquid medium of the corresponding resistance (2ml centrifuge tube), pipet evenly, and culture on a shaker at 180rpm / min for 1h; 4. Collect the bacteria: centrifuge at 5000rpm / min for 5min, and remove the supernatant; 5. Resuspend: use 10mM MgCl2 (containing 120μM Resuspend the cells in the AS suspension, adjust the OD600 to approximately 0.6, and incubate at room temperature for 4 hours. 6. Conventional localization: Target protein culture solution; Colocalization: The volume ratio of the target protein culture solution to the maker protein culture solution is 1:1. The target protein culture solution includes the protein encoded by the GbWRKY65 gene as shown in SEQ ID No. 2 (referred to as GbWRKY65 protein) and the green fluorescent protein (GFP). The maker protein culture solution includes the red fluorescent protein. 7. Injection: Select tobacco plants in good growth condition and inject into the lower epidermis of tobacco leaves using a 1 ml syringe without a pipette tip. Label the leaves. 8. Cultivation: Cultivate the injected tobacco plants under low light (light intensity of approximately 0.2 lx) (16 h / 8 h: day / night) for 2 days. 9. Observation: Take the labeled Agrobacterium-injected tobacco leaves, prepare slides, observe under a laser confocal microscope, and photograph. Fluorescence signal description: Green fluorescent protein GFP: excitation wavelength 488nm; chloroplast excitation wavelength: 640nm; red fluorescent protein mCherry: excitation wavelength 561nm.

[0038] In some optional embodiments, the gene expression detection results indicate that the GbWRKY65 gene is expressed in the roots, stems, and leaves of cotton.

[0039] The specific operation of the gene expression detection is as follows: open the Hai7124 database (http: / / cotton.zju.edu.cn / ) through a browser, enter the ID of the GbWRKY65 gene as GB_A06G1560 into the search box, then select the tissue name root, stem, leaf, click search, and display the results.

[0040] When cotton was infected by Verticillium dahliae, the expression level of this gene increased significantly. This result indicated that this gene played an important role in the signal transduction pathway of cotton Verticillium dahliae biological stress.

[0041] Further application results of VIGS technology showed that after silencing the GbWRKY65 gene, the wilt disease index of the silenced plants was increased compared with the control (plants only injected with TRV::00, TRV::00 was an empty vector).

[0042] The specific operation of the VIGS technology application is as follows: based on the non-conserved region of GbWRKY65, a silencing primer GbWRKY65-VIGS was designed, and the VIGS vector was constructed by enzyme ligation. The constructed pTRV2-GbWRKY65 recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 by electroporation. The specific method is as follows: 20 μL of Agrobacterium and 0.5 μL of plasmid were mixed and added to a 4 mm electroporation cuvette using a gun; electroporation was performed on an electric shocker at 2500V / 6ms to promote the plasmid to enter the Agrobacterium; after electroporation, the liquid was transferred to a 2 mL centrifuge tube containing 500 mL of LB culture medium using a gun; and the mixture was incubated at 28°C. Shake and culture in a biochemical incubator for about 4 hours to allow the bacteria to recover under certain conditions; centrifuge the centrifuge tube for 1 minute at a speed of 5000r / min to allow the bacteria to settle on the tube wall; prepare LB plates, write labels, wipe the triangular glass rod with 75% (v / v) alcohol, and then burn it on a flame (1200℃) for about 10 seconds to sterilize; let it cool for later use, use a gun to aspirate 100μL of supernatant, pour out the remaining liquid, then inject the liquid in the gun into the centrifuge tube, and repeatedly aspirate with the gun to flush the bacteria off the wall to mix, aspirate the bacterial liquid, drop it on the plate, and spread it evenly with a glass rod; place it in a biochemical incubator at 28℃ for 48 hours (2 days) to grow colonies. The positive strains were screened and identified by PCR. TRV is a binary RNA virus, so a binary virus vector was needed to co-infect cotton. Agrobacterium GV3101 containing the recombinant plasmids pTRV2-GBCLA1 and pTRV2-GbWRKY65 was added to 10 ml LB (containing 25 mg L –1 Gentamycin and 50mg L –1After overnight culture at 28°C and 180 rpm, the bacterial suspension was added to 150 mL of LB (containing 25 mg / L gentamicin, 50 mg / L kanamycin, 10 mmol / L MES and 20 μmol L –1 The cells were cultured in acetosyringone (Acetosyringone) medium at 28°C and 180 r / min overnight. The next day, the bacterial precipitate was collected by centrifugation (5000 r / min, 10 min), resuspended with a resuspension solution (10 mmol / L MES, 200 μmol / L Acetosyringone and 10 mmol / L MgCl2), and placed at room temperature for 3 h. The bacterial solutions containing the pTRV2 vector, pTRV2-GBCLA1 recombinant plasmid, and pTRV2-GbWRKY65 recombinant plasmid were mixed with the bacterial solution containing the pTRV1 vector in equal volumes (configured as a TRV mixture). The back of the cotton leaves was pressed with a syringe and 1 ml of the TRV mixture was injected. After inoculation, the plants were cultured at 25°C / 20°C (16h / 8h (light / dark)). After 15 days, the gene-silenced plants were inoculated with cotton Verticillium dahliae V592. The disease index was calculated 20 and 30 days after inoculation. The method for infecting cotton was to use a concentration of 1×10 7 Verticillium wilt V59 was watered at the base of cotton plants with 25 ml of spores / mL. The incidence of Verticillium wilt in cotton was measured when the true leaves began to yellow and wilt. The cotton disease index was calculated according to the method described in "Quarantine, Detection, and Identification of Verticillium Wilt in Cotton" (GB / T 28084-2011): Disease Index = ∑ (Number of Diseased Plants × Representative Value) × 100 / Total Number of Plants Surveyed × Representative Value of the Most Severe Disease Level. Analysis showed that the disease index of the control plants was 17 and 25, respectively, 25 and 35 days after inoculation with the pathogen. However, the disease index of the silenced plants was 41 and 58, respectively, 25 and 35 days after inoculation with the pathogen. Compared to the control, the disease index of the silenced plants was higher.

[0043] The activities of catalase (CAT) and phenylalanine ammonia lyase (PAL), as well as the lignin content in the silenced plants were further evaluated. After silencing the GbWRKY65 gene, the PAL enzyme activity, CAT enzyme activity, SOD enzyme activity and lignin content in the silenced plants were significantly reduced.

[0044] Specifically, the activities of catalase (CAT), superoxide dismutase (SOD), and phenylalanine ammonialyase (PAL) were determined using kits produced by Nanjing JiCe Biotechnology Co., Ltd. The specific determination and calculation methods are as follows.

[0045] Catalase (CAT) Assay Method: Extracts and standards were prepared according to the instructions for the Catalase Kit (Cat. No. JC0103-S) from Nanjing JiCe Biotechnology Co., Ltd. The absorbance of each sample at 240 nm was measured in triplicate. Record the absorbance of each sample by adding 35 μL of sample and 1 mL of working solution to a 1 mL quartz cuvette, mixing thoroughly. Immediately measure the initial absorbance at 240 nm, A1, and the absorbance after 1 minute, A2, at room temperature. Calculate ΔA = A1 - A2. CAT (U / g fresh weight) = [ΔA × V total ÷ (ε × d) × 106] ÷ (W × V sample ÷ V total) ÷ T = 678 × ΔA ÷ W. Vreaction: total volume of the reaction system, 1.035 × 10-3 L; ε: molar extinction coefficient of H2O2, 43.6 L / mol / cm; d: optical diameter of the cuvette, 1 cm; Vsample: volume of sample added, 0.035 mL; Vsample: total volume of extract added, 1 mL; T: reaction time, 1 min; W: sample mass, g; 106: unit conversion factor, 1 mol = 10 6 μmol.

[0046] Superoxide dismutase (SOD) assay method: Extracts and standards were prepared according to the instructions for the Superoxide Dismutase Kit (Cat. No. JC0101-M) from Nanjing JiCe Biotechnology Co., Ltd. The absorbance of each sample was measured at a wavelength of 560 nm, with triplicate measurements for each sample. SOD enzyme activity was calculated based on the fresh weight of the sample: SOD activity (U / g fresh weight) = [Percentage Inhibition ÷ (1 - Percentage Inhibition) × V Total] ÷ (W × V Sample ÷ V Total) = 11.11 × Percentage Inhibition ÷ (1 - Percentage Inhibition) ÷ W. V Total: Total reaction volume, 0.2 mL; V Sample: Volume of sample added to the reaction, 0.018 mL; V Total: Volume of extract added, 1 mL; W: Sample weight (g).

[0047] Phenylalanine ammonia lyase (PAL) assay method: Extracts and standards were prepared according to the instructions for the Phenylalanine Ammonia Lyase Kit (Cat. No. JC0114-M) from Nanjing JiCe Biotechnology Co., Ltd. The absorbance of each sample was measured at a wavelength of 290 nm in triplicate. PAL enzyme activity was calculated based on the sample fresh weight. Unit definition: One unit of enzyme activity is defined as a 0.05 change in absorbance at 290 nm per minute per gram of tissue per mL of reaction system. PAL (U / g fresh weight) = ΔA × V total ÷ (W × V sample ÷ V total) ÷ 0.05 ÷ T = 26.67 × ΔA ÷ W. V total: total reaction volume, 0.2 mL; V sample: added sample volume, 0.005 mL; V total: added extract volume, 1 mL; T: reaction time, 30 min; W: sample weight (g).

[0048] Lignin content was determined using a kit from Beijing Solaibao Technology Co., Ltd. The procedure is as follows: Lignin content determination method: Extracts and standards were prepared according to the instructions for the lignin content determination kit (Cat. No. BC4205) from Beijing Solaibao Technology Co., Ltd. The absorbance of each sample was measured at a wavelength of 280 nm, with three replicates for each sample. Calculation using a microquartz cuvette / 96-well UV plate: Lignin content (mg / g) = ΔA ÷ ε ÷ d × V assay ÷ (V supernatant × W ÷ V acetylation). Lignin percentage (%) = lignin content ÷ 1000 × 100%. V acetylation: acetylation reaction volume, 0.612 mL; ε: lignin extinction coefficient, 23.35 mL / mg / cm; d: cuvette optical path, 1 cm; V supernatant: supernatant volume, 0.012 mL; V assay: assay volume, 0.6 mL; W: sample mass, g; 1000: conversion factor, 1 g = 1000 mg.

[0049] Through the above analysis, the SOD, CAT, PAL enzyme activities and lignin content in the control were 124.12 U / g, 19.22 U / g, 15.63 U / g and 95.63 mg / g, respectively; the SOD, CAT, PAL enzyme activities and lignin content in the silenced plants were 60.1 U / g, 12.84 U / g, 9.14 U / g and 79.63 mg / g, respectively. Compared with the control, the SOD, CAT, PAL enzyme activities and lignin content in the silenced plants were lower.

[0050] Based on the above research results, the GbWRKY65 gene was overexpressed and then transferred into tobacco. The transgenic tobacco was identified as resistant to Verticillium wilt, and compared with wild-type tobacco, the transgenic plants had improved disease resistance. The testing process is as follows:

[0051] The preserved Verticillium dahliae strain V592 0.1 mL bacterial solution was inoculated into PDA medium for activation for 5 days. The activated strain was inoculated into Cha's liquid medium and cultured at 28 °C for 5 days. The concentration of the prepared solution was 1 × 10 7 mL -1 When the tobacco seedlings grow to 5-6 true leaves, select tobacco seedlings at the 5-leaf stage and add the spore suspension to a concentration of 1×10 7 mL -1Tobacco roots were inoculated with Verticillium dahliae by pouring 5ml of the spore suspension onto the soil. Disease activity was observed daily after inoculation, and the disease index was calculated at the peak of disease onset. The disease index was calculated based on the following criteria: disease level 0: no diseased leaves; level 1: diseased on 0.1% to 25% of leaves; level 2: diseased on 25% to 50% of leaves; level 3: diseased on 50% to 75% of leaves; and level 4: diseased on more than 75% of leaves. The disease index was calculated using the formula: disease index = [Σnumber of diseased plants at each level × level / (total number of plants × highest disease level)] × 100. The results showed that, compared to wild-type (non-transgenic) tobacco, transgenic plants exhibited less yellowing and fewer leaf drop after infection with Verticillium dahliae, as observed by morphological observation.

[0052] Based on the above research results, overexpression of the GbWRKY65 gene can be used to cultivate new plant varieties with high resistance to Verticillium wilt.

[0053] Some embodiments of the present invention also provide a use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt.

[0054] In some alternative embodiments, the plant is cotton or tobacco.

[0055] In some optional embodiments, the application includes the following steps: regulating the plant's resistance to Verticillium wilt by regulating the transcription and translation levels of the GbWRKY65 gene in the plant; accordingly, regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in the plant or regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in the plant should fall within the scope of protection of the present invention; accordingly, regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in the plant or regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in the plant should fall within the scope of protection of the present invention.

[0056] In some optional embodiments, the application includes the following steps:

[0057] By constructing an overexpression vector of the GbWRKY65 gene and transforming plants through Agrobacterium-mediated genetic transformation, a GbWRKY65 gene overexpression strain was obtained.

[0058] In some optional embodiments, the application includes the following steps:

[0059] The GbWRKY65 gene in cotton was silenced by the VIGS method, thereby reducing the expression level of the GbWRKY65 gene in cotton; through disease resistance identification and disease index statistical analysis, the silenced plants reduced the resistance of cotton to Verticillium wilt; accordingly, regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in plants or regulating Verticillium wilt resistance by changing the transcription and translation levels of the GbWRKY65 gene in plants should fall within the scope of protection of the present invention.

[0060] The present invention will be further explained below with reference to the following examples. Before introducing the specific examples, a brief description of some of the materials in the following examples is given below.

[0061] The cotton materials include: the sea island cotton variety Xinhai 14 susceptible to Verticillium wilt, the sea island cotton variety Hai 7124 resistant to Verticillium wilt and the Verticillium wilt strain (cotton Verticillium wilt highly pathogenic strain V592), all provided by the Crop Germplasm Resources Conservation and Precision Breeding Team of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences.

[0062] Primer sequences were provided by Bioscientific; other biological materials and reagents used were commercially available.

[0063] Example 1

[0064] The study used transcriptomics technology to analyze the expression level of the cotton GbWRKY65 gene after the Verticillium wilt-resistant sea island cotton variety Hai 7124 and the Verticillium wilt-susceptible variety Xinhai 14 were infected with Verticillium wilt. Therefore, the inventors conducted a detailed analysis of the GbWRKY65 gene based on the sea island cotton Xinhai 14 and Hai 7124. The specific process is briefly described as follows.

[0065] 1. Acquisition of the GbWRKY65 gene

[0066] Cotton planting: Sterilized vermiculite and sandy soil were mixed with purified water in a mass ratio of 3:2 and then placed in a 10 cm flower pot. Seeds with full grains were selected after delinting with 98 wt% concentrated sulfuric acid. They were soaked and disinfected in a 0.1% (v / v) mercuric chloride aqueous solution for 15 min, rinsed 5 times with sterile water, planted in the prepared flower pots, and continued to be cultivated in an incubator at 28°C, 16 h of light and 8 h of darkness.

[0067] RNA was extracted from cotton seedlings at the 3-leaf stage after 15 days of culture and reverse transcribed to obtain cDNA. The RNA extraction steps were as follows:

[0068] 1. Sample preparation

[0069] Collect samples: Select fresh stems of the Hai 7124 variety and process or store them quickly after collection.

[0070] Sample preservation: The collected plant tissues were quickly frozen in liquid nitrogen and then stored at -80°C to maintain the stability of RNA.

[0071] 2. Cell disruption

[0072] 1000 mg of fresh plant tissue was placed in a mortar and pestle, and 20 ml of liquid nitrogen was added for grinding. 800 mg of the ground tissue powder was transferred to a 1.5 mL centrifuge tube, and 500 μl of lysis buffer RLT (with β-mercaptoethanol added) was added to fully grind into a homogenate to release RNA.

[0073] 3. RNA Extraction

[0074] Phase separation: Add 0.2 mL of chloroform and gently shake the tube to mix. Let stand at room temperature for 15 minutes, then centrifuge at 4°C and 12,000 g for 15 minutes to separate the sample into three layers. The upper layer is a colorless aqueous phase, primarily containing RNA; the middle layer is a thin layer containing proteins and DNA; and the lower layer is an organic phase, containing components such as phenol and chloroform.

[0075] Collect the RNA phase: Carefully transfer the upper aqueous phase to a new RNase-free centrifuge tube, avoiding the middle and lower phases.

[0076] IV. RNA Purification

[0077] Precipitate RNA: Add 0.7 mL of isopropanol solution to the collected aqueous phase, mix gently, and let it stand at -20°C or room temperature for 30 minutes to precipitate the RNA.

[0078] Centrifugal precipitation: Centrifuge the tube at 4°C and 10,000 g for 10 min to precipitate the RNA into a gel-like precipitate.

[0079] Wash the precipitate: discard the supernatant, add 0.6 mL of 75% (the volume ratio of anhydrous ethanol to water is 3:4) alcohol to wash the RNA precipitate, then centrifuge at 4°C and 10,000 g for 2 minutes and discard the supernatant.

[0080] Drying and dissolving RNA: Invert the centrifuge tube on a clean paper towel and let the RNA precipitate dry naturally for 30 minutes. Then add 0.1 mL of DEPC-treated water and gently shake the centrifuge tube to completely dissolve the RNA precipitate. After softening, store it at -80°C for later use.

[0081] Reverse transcription was performed using the Takara cDNA First-Strand Synthesis Kit. To a 200-μL RNase-free centrifuge tube, add 1 μg of the extracted RNA from the previous step, 4 μL of 5× PrimeScript IV cDNA Synthesis Mix, 1 μL of random 6mers (50 μM), and RNase-free ddH₂O to a volume of 20 μL. Reverse transcription was performed in a PCR instrument at 30°C for 10 min, 42°C for 15 min, and 95°C for 5 min.

[0082] Using cDNA as a template, primers were designed and gene amplification was performed. The primer sequences were: GbWRKY65-F: 5′-ATGGACGCTAGTGACAGTAATTTC-3′, GbWRKY65-R: 5′-TCAGCACATCCCAACTTGTGGT-3′;

[0083] The PCR amplification system was designed as follows: Total volume: 20 μL

[0084] 2xTaq PCR MasterMix II, 10μL;

[0085] Upstream primer (10 μM), 1 μL;

[0086] downstream primer (10 μM), 1 μL;

[0087] cDNA, 1 μL;

[0088] ddH2O, 7 μL;

[0089] PCR amplification program: 95°C, 5 min; 95°C, 30 s; 55°C, 20 s; 72°C, 60 sec / kb, 30 cycles; 72°C, 10 min.

[0090] The PCR electrophoresis products were detected by electrophoresis. Figure 1 As shown. Figure 1 As can be seen from the results, the GbWRKY65 gene is 832 bp in size, which is consistent with the expected result. The sequence of the GbWRKY65 gene was analyzed for conserved domains using the NCBI database. Figure 2 ; The specific steps are as follows: (1) Open the database website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi); (2) Enter the gene sequence in the input box, and use the default parameters; (3) Click Submit and wait for the results to be output.

[0091] 2. Subcellular localization of GbWRKY65 protein in cells

[0092] Design primers for the GbWRKY65 gene to insert into the vector pEGOEP35S-H.

[0093] F:ACTAGGGTCTCGCACCATGGACGCTAGTGACAGTAATTTC

[0094] R:ACTAGGGTCTCTACCGTCAGCACATCCCAACTTGTGGT

[0095] NOS-R:ATCATCGCAAGACCGGCAAC

[0096] The PCR reaction system is as follows:

[0097]

[0098]

[0099] Add ddH2O to 50 μl. PCR reaction conditions: 98°C, 3 min; 98°C, 10 sec; 57°C, 30 sec, 32 cycles; 68°C, 2 min; 68°C, 4 min. After PCR, the target band was recovered using the Tiangen Biochemical Technology Co., Ltd. Agarose Gel DNA Recovery Kit (DP209-03). The procedure was performed in full accordance with the kit instructions.

[0100] The enzyme digestion-ligation method is used to connect to the vector. The enzyme digestion-ligation reaction system is as follows:

[0101]

[0102] The parameters for the enzyme digestion-ligation reaction are as follows:

[0103]

[0104] The constructed vector was transferred into Escherichia coli DH5α, and the positive clones sequenced correctly by the company were cultured at 30℃, 180r / min shaking for 12h, and then glycerol was used to preserve the bacteria (bacterial liquid volume: glycerol volume = 1:4). 10mL of bacterial liquid was aspirated and centrifuged at 5000r / min for 10min. The supernatant was discarded and the plasmid was extracted using the Tiangen Plasmid Extraction Kit. The operation steps were carried out in full accordance with the instructions. For specific steps, please refer to the instructions. After plasmid detection, the Agrobacterium GV3101 was transformed by electroporation. The specific method is as follows: 20μL of Agrobacterium and 0.5μL of plasmid were mixed and added to a 4mm electroporation cup with a gun; electroporation was performed at 2500V / 6ms on the electric shock device to promote the plasmid to enter the Agrobacterium; after electroporation, the liquid was moved to a 2mL centrifuge tube containing 500mL LB culture medium with a gun; the culture was shaken in a biochemical incubator at 28℃ for about 4h to allow the bacteria to recover under certain conditions; the centrifuge tube was centrifuged for 1min at a speed of 5 000r / min to allow the bacteria to settle on the tube wall; prepare LB plates, write labels, wipe the triangular glass rod with 75% (v / v) alcohol, and then burn it on the flame for about 10s to sterilize; let it cool for use, use a gun to aspirate 100μL of supernatant, pour out the remaining liquid, then inject the liquid in the gun into the centrifuge tube, and repeatedly aspirate with the gun to wash off the bacteria on the wall and mix them, aspirate the bacterial liquid, drop it on the plate, and spread it evenly with a glass rod; put it in a biochemical incubator at 28℃ for 48h (2 days) to grow colonies.

[0105] The above colonies were subjected to PCR detection. The positive clones (the size was consistent with the target gene) were cultured with shaking at 30°C / 180 rpm for 12 h, expanded, and then maintained in glycerol and stored in a -80°C ultra-low temperature refrigerator.

[0106] Five-leaf-stage Nicotiana benthamiana leaves were selected as recipient plants for transient expression analysis. Nicotiana benthamiana was grown in nutrient soil, and leaves of tobacco plants with normal growth (5-7 leaves) were selected for the experiment. Agrobacterium was removed from a -80°C freezer and placed in liquid YEB medium (pre-added with 50 mg / L rifampicin and 100 mg / L kanamycin) and cultured at 28°C and 220 rpm. The formula of liquid YEB medium is: beef extract 5g / L, yeast extract 1g / L, peptone 5g / L, sucrose 5g / L, MgSO4.7H2O 0.4g / 100ml, agar 1.5g / 100ml, and pH 7.4. Collect the bacterial suspension and add 50 mL of the resuspension to the centrifuge tube containing the bacteria. Mix thoroughly and measure the absorbance of the suspension at any time to ensure an OD600 of 0.8. Then, place the resuspension in the dark for about 2 hours before injecting 1 mL into the tobacco leaves. The infected tobacco plants were cultured in a dark room for 3 days, and the green fluorescence signal was collected using a Leica TCS SP8 laser confocal microscope. Figure 3 shown. Figure 3 The detection results showed that the GFP protein transformed by the p35S-GFP vector was strongly expressed in all parts of tobacco cells; GFP::GbWRKY65 was expressed in the cell nucleus, which preliminarily indicated that the GbWRKY65 gene was located in the cell nucleus.

[0107] Example 2

[0108] Based on the understanding of the basic characteristics of the GbWRKY65 gene in Example 1 above, the inventors further analyzed the tissue expression pattern of this gene in cotton tissue under natural conditions and its tissue expression after stress. The relevant experiments are briefly described below.

[0109] 1. Tissue expression pattern of the GbWRKY65 gene under natural conditions (wild type)

[0110] The expression characteristics of GbWRKY65 gene in the root, stem and leaf tissues of Hai7124 were analyzed using the Hai7124 database (http: / / cotton.zju.edu.cn / ).

[0111] Each reaction consisted of three replicates, using a single template diluted to different concentrations. Data were analyzed using 2 -ΔΔCT The relative expression of target genes was calculated using the PCR method.

[0112] Test results such as Figure 4 shown. Figure 4 The analysis showed that the expression level of Hai7124 was higher in roots and stems, indicating that the expression of GbWRKY65 has certain tissue differences.

[0113] 2. Expression pattern of GbWRKY65 under biotic stress (Verticillium dahliae infection)

[0114] The inventors used transcriptome technology to analyze the expression characteristics of GbWRKY65 in the Verticillium wilt-resistant Hai7124 and the Verticillium wilt-susceptible Xinhai14. The results showed that the expression levels of GbWRKY65 in the Verticillium wilt-resistant Hai7124 and the Verticillium wilt-susceptible Xinhai14 were 2.88 and 0.74, respectively, when the cotton was not inoculated with Verticillium wilt. When the cotton was inoculated with Verticillium wilt for 1 day, 2 days, 3 days, 5 days and 7 days, the expression levels of GbWRKY65 in the Verticillium wilt-resistant Hai7124 were 1.22, 7.44, 5.71 and 7.81, respectively. .15, 4.02, and 0.59, and the expression levels of GbWRKY65 in Xinhai 14 susceptible to Verticillium dahliae were 0.68, 1.13, 0.67, 0.53, and 0.68, respectively. Before and after inoculation with Verticillium dahliae, the expression levels of GbWRKY65 gene in disease-resistant and disease-susceptible materials changed significantly. To further analyze the expression pattern of this gene in cotton after infection with Verticillium dahliae, the inventors further analyzed this gene using qRT-PCR technology. The specific process is as follows.

[0115] The root of the three-leaf-extending sea island cotton varieties Xinhai 14 and Hai 7124 was inoculated with conidia of Verticillium wilt fungus V592. 7 Spores / mL. Cotton hypocotyls were selected at 1, 2, 3, 5, and 7 days after inoculation, RNA was extracted, and cDNA was reverse transcribed for expression analysis. qPCR amplification was performed using GBUBQ7 as an internal reference gene using the following fluorescent quantitative PCR primers:

[0116] GbWRKY65qPCRF: 5'-ACAGAAGCGGAGACACCAAC-3',

[0117] GbWRKY65qPCRF: 5'-TTCCGTCAGATCAGCGAACC-3';

[0118] GBUBQ7 was selected as the internal reference gene, and the primer sequences were designed as follows:

[0119] UBQ7F 5'-AGGCATTCCACCTGACCAAC-3',

[0120] UBQ7R 5'-CCCTGAGACGGAGGACAAGG-3';

[0121] RNA was extracted and cDNA was obtained using a reverse transcription kit.

[0122] The full-form gold universal high-sensitivity dye quantitative PCR detection kit ( Top GreenqPCR SuperMix Top Top Green qPCR Supermix). qRT-PCR reactions were performed using an ABI7500Fast fluorescent quantitative PCR instrument. The reaction system was as follows:

[0123] 2× Terswerle Green qPCR super mix, 10 μL;

[0124] Primer 1 (10 μM), 0.4 μL;

[0125] Primer 2 (10 μM), 0.4 μL;

[0126] cDNA, 1 μL;

[0127] Inert reference dye (50x), 0.4 μL

[0128] ddH2O, 7.8 μL;

[0129] The reaction procedure was: denaturation at 94°C for 30 seconds, followed by 40 cycles of (94°C for 5 seconds, 60°C for 30 seconds). The specificity of the amplified product after 40 cycles was determined by melting curve analysis.

[0130] The experimental results are as follows Figure 5 shown. Figure 5 qRT-PCR results showed that after treatment with V592 conidia, the expression level of GbWRKY65 in cotton hypocotyls in Hai7124 was continuously upregulated, reaching a peak of 6 on day 3 after infection, and then decreasing to 1.8 and 2, respectively. In Xinhai14, the expression level of GbWRKY65 in cotton roots was lower than that in Hai7124 at multiple treatment time points.

[0131] The above results showed that the expression level of GbWRKY65 gene changed significantly after the roots of the Verticillium wilt-susceptible Sea Island cotton variety Xinhai 14 and the Verticillium wilt-resistant Sea Island cotton variety Hai 7124 were infected by Verticillium dahliae.

[0132] Example 3

[0133] Furthermore, the inventors used VIGS technology to construct a VIGS interference vector to silence the GbWRKY65 gene. Observing the phenotypic changes in cotton plants infected with Verticillium wilt after gene silencing, the results further demonstrated that the GbWRKY65 gene is highly correlated with resistance to Verticillium wilt. The relevant experimental results are briefly described below.

[0134] 1. Construction of VIGS Interference Vector

[0135] The gene silencing fragment was designed by inputting the CDS sequence of the gene on the website https: / / vigs.solgenomics.net / . The primers were designed using Primer5.0 software. The primer sequences were:

[0136] GbWRKY65-VIGS-F: 5'-CGGGATCCCGAACACAATCACCCTTGG

[0137] C-3',GbWRKY65-VIGS-R:5'-GGGGTACCGTCCCATCTTCCG

[0138] TTGGTGT-3′; The target fragment was amplified by PCR using the cDNA of Hai7124 material as a template. The reaction system and reaction procedure refer to “Obtaining the GbWRKY65 gene”, as shown in Figure 6 As shown, the fragment sizes are correct.

[0139] Inoculate 0.1 mL of a culture solution of competent E. coli cells transformed with the pTRV2 vector stored at -80°C in the laboratory into 50 mL of LB liquid medium in a clean bench and incubate at 30°C / 180 rpm with shaking for 12 hours. Centrifuge the resulting culture at 5000 rpm for 10 minutes, discard the supernatant, and extract the plasmid using the Tiangen Plasmid Extraction Kit. Follow the instructions exactly as they are provided. For specific steps, refer to the manufacturer's instructions. Digest the extracted pTRV2 vector plasmid with the enzyme digestion system in a 200 μL centrifuge tube and incubate in a 37°C water bath for 2 hours. The digestion system is as follows: vector plasmid, 14 μL; BamH1, 1 μL; Kpn1, 1 μL; and buffer, 4 μL. The target gene fragment and the digestion product were subjected to 1% (m / v) agarose gel electrophoresis, and the target sequence was recovered and the digestion-ligation reaction system method was the same as that of "Subcellular localization of GbWRKY65 protein in cells" to construct the VIGS interference vector pTRV::GbWRKY65.

[0140] 2. Response of cotton to Verticillium dahliae after silencing the GbWRKY65 gene in the Verticillium wilt-resistant sea island cotton variety Hai 7124

[0141] pTRV1, pTRV2, pTRV::GBCLA1, and pTRV::GbWRKY65 were transformed into Agrobacterium tumefaciens LBA4404 and cultured overnight in 50 mL YEB liquid medium flasks at 28°C and 200 rpm. The bacterial suspension was poured into a 50 mL centrifuge tube and centrifuged at 8000 g for 10 min at room temperature. The supernatant was discarded and the cells in the centrifuge tube were resuspended in VIGS vector suspension solution. The OD value was adjusted to 0.8. The Agrobacterium suspension containing pTRV1 was mixed with the Agrobacterium suspension containing pTRV2, pTRV::GBCLA1, and pTRV::GbWRKY65, respectively, in equal volumes and allowed to stand at 25°C in the dark for 3 h.

[0142] Use a 1mL syringe for injection. Use the needle to gently scratch the back of the cotton seedling cotyledon (be careful not to scratch the leaf). Then draw up the bacterial solution with the syringe and gently push it into the cotton cotyledon to fill the entire cotyledon. Place the injected cotton in a dark place at 25℃ for 24 hours and then continue to culture. Two weeks after injection, observe the leaf phenotype of the GBCLA1-silenced cotton plant. The true leaf phenotype of the cotton plant injected with pTRV2::GBCLA1 begins to show a whitening phenomenon ( Figure 7 ) was used as a reference to detect the silencing rate of the target gene. The relative expression level of the GbWRKY65 gene in the silenced cotton was 0.21, and the relative expression level of the GbWRKY65 gene in the non-silenced cotton was 1, and the silencing rate of the GbWRKY65 gene was 79%.

[0143] Two weeks after the injection of VIGS vector resuspension (pTRV1 and pTRV::GbWRKY65), true leaves of cotton plants were taken, RNA was extracted and reverse transcribed into cDNA, and the silencing rate of the target gene was detected by qRT-PCR. The method was the same as that of "Tissue expression pattern of GbWRKY65 gene under natural conditions (wild type)".

[0144] The method of infecting cotton is to use the root wound inoculation method, using the spore solution of Verticillium wilt fungus V592 (1×10 7 spores / mL) infect cotton. Cotton Verticillium wilt incidence was counted when true leaves began to yellow and wilt. The cotton disease index was calculated according to the method in "Quarantine, Detection, and Identification of Cotton Verticillium Wilt" (Standard No.: GB / T28084-2011): Disease Index = ∑ (Number of Diseased Plants × Representative Value) × 100 / Total Number of Plants Surveyed × Representative Value of the Most Severe Disease Level.

[0145] Stem segments of TRV:00 and TRV:GbWRKY65 were recovered. Approximately 1 cm long stem segments above the cotyledonary node were excised and sterilized in 75% (v / v) ethanol for 30 seconds, soaked in 10% (v / v) sodium hypochlorite for 8 minutes, and rinsed five times with sterile ddH2O for 30 seconds each. The segments were then plated on PDA medium (recipe: 200 g potato, 20 g glucose, 15-20 g agar, 1000 ml distilled water, pH: natural) supplemented with 100 mg / L streptomycin sulfate and incubated in the dark at 25°C for 5 days.

[0146] The results showed that the expression level of GbWRKY65 gene in TRV:GbWRKY65 cotton plants was significantly lower than that in TRV:00 cotton plants. The relative expression level of GbWRKY65 gene in the silenced plants was 0.21, while the relative expression level of GbWRKY65 gene in the non-silenced plants was 1( Figure 8 A). After infection with Verticillium dahliae, the disease index of TRV:GbWRKY65 cotton plants was significantly higher than that of TRV:00 cotton plants ( Figure 8 B), Morphological observation showed that the leaves of TRV:GbWRKY65 plants turned yellow and dropped leaves more seriously than those of the control cotton ( Figure 8 C). At the same time, the recovery culture experiment showed that more stem segments of TRV:GbWRKY65 plants grew Verticillium dahliae on the culture medium than those of the control plants ( Figure 8 D). Physiological and biochemical analysis showed that the CAT enzyme activity, PAL enzyme activity and lignin content in TRV:GBWRKY65 plants were lower than those in TRV::00 plants ( Figure 9 ).

[0147] Based on the above results, it can be seen that in the disease-resistant variety Hai 7124, after silencing the GbWRKY65 gene, the disease index of cotton was significantly increased when infected with Verticillium wilt, which indicates that silencing the GbWRKY65 gene reduced the resistance of cotton to Verticillium wilt.

[0148] Using virus-induced gene silencing technology, the GbWRKY65 gene was silenced in the Verticillium wilt-resistant sea island cotton variety Hai 7124. After the silenced plants were inoculated with Verticillium wilt, the disease index increased compared with the control, proving that the expression of the GbWRKY65 gene is related to cotton's resistance to Verticillium wilt. Based on the above, further experiments were designed to prove that the GbWRKY65 gene has potential beneficial effects.

[0149] The beneficial effects of the present invention are demonstrated through test examples.

[0150] (1) Obtaining transgenic tobacco seedlings

[0151] Tobacco genetic transformation medium

[0152] Sterile seedling culture medium: 8g / L agar powder + 15g / L sucrose + 39.45g1 / 2MS (pH 6.0).

[0153] Co-culture medium: 8 g / L agar powder + 30 g / L sucrose + 4.74 g MS (pH 6.0).

[0154] The culture medium formula was selected as follows: 4.74 g MS + 2 mg / L 6BA + 0.3 mg / LIAA + 500 mg / LCef (cephalosporin antibiotics) + 50 mg / L Hyg (hygromycin) + 30 g / L sucrose + 2.5 g / LPhytagel (plant gel) (pH 6.0).

[0155] Rooting medium: 39.45 g 1 / 2 MS + 0.3 mg / LIAA + 400 mg / LCef + 50 mg / L Hyg (hygromycin) + 15 g / L sucrose + 2.5 g / L Phytagel (plant gel) (pH 6.0).

[0156] Induction of sterile tobacco seedlings using mature tobacco embryos

[0157] 1. Disinfection: Select seeds with full grains and disinfect them with 70% (v / v) alcohol for 3 minutes.

[0158] 2. Induce sterile seedlings: sow 100 sterilized seeds on sterile seedling culture medium with 0.1% (m / v) sterile agar solution.

[0159] 3. Agrobacterium culture: Pick a single colony of Agrobacterium, place it in culture medium, and culture it at 28°C and 200 rpm for 36 hours.

[0160] 4. Agrobacterium and leaf co-culture: 1) Place the cultured bacterial solution in a centrifuge tube and centrifuge at 5000 rpm for 10 minutes. Take the supernatant and prepare an Agrobacterium suspension. 2) Cut tobacco leaves with a diameter of 3 cm into leaves of approximately 5 x 5 mm in size and infect them with the Agrobacterium suspension for 5 minutes. 3) Place the tobacco leaves in the co-culture medium and culture for 36 hours.

[0161] 5. Screening and Differentiation: 1) Remove leaf tissue using forceps in a clean bench; 2) Transfer the co-cultivated leaves to screening medium and culture (12h / 12h, day / night) for approximately 7 days; 3) Transfer the selected leaves to selective medium supplemented with antibiotics (50mg / mL) and wait for seedlings to emerge. The screening medium formula is: 4.74g MS + 2mg / L 6BA + 0.3mg / L LIAA + 400mg / L Cef (cephalosporin antibiotic) + 40mg / L Hygromycin + 30g / L sucrose + 2.5g / L Hytagel (phytagel) (pH 6.0).

[0162] 6. Rooting of resistant seedlings: Cut the grown tobacco seedlings and inoculate them onto new rooting medium and then conduct molecular identification after about 10 days.

[0163] (2) Identification of transgenic positive plants

[0164] Extract plant DNA using the CTAB method:

[0165] 1. Grinding: Take a sample, add 1.5 mL of CTAB and grind it, then add 500 μL of CTAB solution, the formula of which is: CTAB: 4 g, NaCl: 16.364 g, 1 M Tris-HCl (pH 8.0): 20 ml, 0.5 M EDTA (pH 8.0): 8 ml, ddH2O: 70 ml.

[0166] 2. Water-soluble: 30 minutes, shake every 10 minutes;

[0167] 3. After the sample is cooled to room temperature, add chloroform isoamyl alcohol with the same volume as CTAB and shake at 1500 rpm for 20 minutes;

[0168] 4. Centrifuge at 5000 rpm for 10 minutes and transfer the supernatant to a new EP tube;

[0169] 5. Using the supernatant from step 4 as the standard, add 0.7 times the volume of isopropanol (pre-cooled in a -20°C refrigerator in advance), shake gently until filaments can be observed, and place in a -20°C refrigerator to rest for 30 minutes;

[0170] 6. Centrifuge at 5000 rpm for 5 minutes and discard the supernatant;

[0171] 7. Wash with 70% (v / v) alcohol and suspend with a pipette. Add ddH2O and RNA-eliminating ribonuclease to each tube.

[0172] 8. Detection: The agar content in the gel is 1 wt%;

[0173] PCR detection of hygromycin resistance gene

[0174] Hygromycin B band size: 385 bp

[0175] H+: TGTAGTGTATTGACCGATTCCTTGC

[0176] H-:GTTCCGACAG C GTCTCCGACCTGAT

[0177] PCR amplification conditions:

[0178] 1. 95℃ for 10 min

[0179] 2. 95℃ 30s

[0180] 3. 58℃ 30s

[0181] 4. 72℃ 30s

[0182] 5. 72℃ for 10 minutes

[0183] 6. 16℃ for 10 minutes

[0184] Repeat steps 2-4 for 30 cycles and perform positive and negative controls.

[0185] Through the above steps, transgenic tobacco containing the hygromycin selection marker and the target gene GbWRKY65 was obtained.

[0186] (3) Identification of disease resistance of transgenic tobacco

[0187] The preserved Verticillium dahliae strain V5920 (1 mL of bacterial solution) was inoculated into PDA medium (formula: potato: 200 g, glucose: 20 g, agar: 15-20 g, distilled water: 1000 ml, pH: natural) and activated for 5 days. The activated strain was inoculated into Czapek liquid medium and cultured at 28°C for 5 days. The concentration of the prepared strain was 1×10 7 mL -1 The spore suspension was set aside for use. When tobacco seedlings had 5 to 6 true leaves, select tobacco plants of uniform growth and inoculate them with Verticillium wilt by root dredging. The tobacco plants were observed daily for disease activity after inoculation. The disease index was calculated at the peak of disease onset. The disease index was calculated according to the following criteria: disease level 0: no diseased leaves; level 1: 0.1% to 25% of plant leaves diseased; level 2: 25% to 50% of plant leaves diseased; level 3: 50% to 75% of plant leaves diseased; and level 4: more than 75% of plant leaves diseased. The disease index was calculated as follows: disease index = [Σnumber of diseased plants at each level × level / (total number of plants × highest disease level)] × 100.

[0188] The results showed that compared with wild-type tobacco (non-transgenic tobacco), after infection with Verticillium dahliae, morphological observation showed that the leaves of transgenic plants were less yellow and the number of fallen leaves was less than that of wild-type tobacco ( Figure 10 ).

[0189] In the description of the present invention, a large number of specific details are described. However, it is understood that embodiments of the present invention can be practiced without these specific details. In some embodiments, well-known methods, structures and techniques are not shown in detail so as not to obscure the understanding of this description.

[0190] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0191] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

[0192] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Any simple modifications, equivalent changes and modifications made to the above embodiment based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A GbWRKY65 gene, characterized in that Its nucleotide sequence is shown in SEQ ID No.

1.

2. The GbWRKY65 gene according to claim 1, wherein The GbWRKY65 gene is located in the cell nucleus.

3. The GbWRKY65 gene according to claim 1, wherein The GbWRKY65 gene is expressed in the roots, stems and leaves of cotton.

4. Application of a GbWRKY65 gene in regulating plant resistance to Verticillium wilt.

5. The use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt according to claim 4, characterized in that: The plant is cotton or tobacco.

6. Use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt as claimed in claim 5, wherein the cotton is the disease-resistant variety Hai 7124 or the disease-susceptible variety Xinhai 14.

7. The use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt according to claim 4, wherein: The application comprises the following steps: regulating the plant's resistance to Verticillium wilt by regulating the transcription and translation levels of the GbWRKY65 gene in the plant.

8. The use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt according to claim 4, wherein: The application comprises the following steps: By constructing an overexpression vector of the GbWRKY65 gene and transforming plants through Agrobacterium-mediated genetic transformation, a GbWRKY65 gene overexpression strain was obtained.

9. The use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt according to claim 4, wherein: The application comprises the following steps: The GbWRKY65 gene in cotton was silenced by the VIGS method, which reduced the expression level of the GbWRKY65 gene in cotton.

10. The use of the GbWRKY65 gene in regulating plant resistance to Verticillium wilt according to claim 9, wherein: The application comprises the following steps: The GbWRKY65 gene in cotton was silenced by the VIGS method, reducing the expression level of the GbWRKY65 gene in cotton to 0.21.

Images