Recombinant bacterium for synthesizing lactose and application thereof

Abstract

The invention provides a recombinant bacterium for synthesizing lactose, application of the recombinant bacterium and a method for synthesizing lactose through biotransformation of a glucose raw material by using the bacterium. The recombinant bacterium contains one or more of the following genetic modifications: (1) enhancement of a UDP-galactose synthesis pathway; (2) enhancing a cofactor UTP supply module; and (3) heterologous introduction of a lactose synthase coding gene. The engineering strain has a green, efficient and industrial lactose production prospect by utilizing the lactose synthesis capability of glucose.

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology and gene editing, and specifically relates to the synthesis of lactose by industrial microorganisms using gene recombination editing. Background Art

[0002] Lactose is a disaccharide found only in mammalian milk. It is composed of glucose and galactose linked by a β-1,4 glycosidic bond and has a unique non-reducing sugar structure. Lactose is broken down into glucose and galactose in the human body. Galactose is a component of the glycolipids that make up the brain and nervous system and is crucial for infant intellectual development. Lactose also promotes the growth of beneficial bacteria in the human intestine and inhibits the growth of pathogenic bacteria. Furthermore, in industry, lactose serves as a platform compound for the production of a variety of derivatives, such as galacto-oligosaccharides, epilactose, lactulose, and lactose sucrose.

[0003] Because lactose is only found in mammalian milk, the primary method for producing lactose is currently to extract it from milk. The traditional extraction method involves crystallization: milk → skimming → acidification → whey → pretreatment → concentration → crystallization → washing and recrystallization → drying → lactose. This method is complex and results in low lactose purity. Furthermore, the lactose content in milk is only 4.5-5.0%, which is relatively low, resulting in high production costs. Summary of the Invention

[0004] The present disclosure provides a recombinant Escherichia coli engineered strain and a method for constructing the strain. The engineered strain is capable of synthesizing lactose by enhancing the UDP-galactose synthesis pathway and then introducing / enhancing the lactose synthase encoding gene.

[0005] According to an exemplary embodiment of the present disclosure, the present disclosure provides a lactose synthesis gene cluster comprising or consisting of: Uridine kinase gene or its isoenzyme gene or its functional homolog gene; Genes involved in UDP-galactose synthesis, or isoenzyme genes, or functional homolog genes thereof; and Genes involved in lactose synthesis.

[0006] Optionally or alternatively, according to any of the preceding gene clusters, wherein, The uridine kinase gene or its isoenzyme gene or its functional homolog gene comprises or consists of the sequence shown in SEQ ID NO. 7.

[0007] Optionally or alternatively, according to any of the preceding gene clusters, wherein, The gene involved in UDP-galactose synthesis, or its isoenzyme gene, or its functional homolog gene comprises or consists of a sequence shown in at least one of SEQ ID NOs. 8, 9, and 10.

[0008] Optionally or alternatively, according to any of the preceding gene clusters, wherein, The gene involved in lactose synthesis comprises or consists of a sequence shown in at least one of SEQ ID NOs. 11 and 12.

[0009] Optionally or alternatively, according to any of the preceding gene clusters, wherein, The gene involved in UDP-galactose synthesis or its isoenzyme gene or its functional homolog gene is double or multiple copies Optionally or alternatively, use of the gene cluster according to any of the preceding items in producing lactose.

[0010] Optionally or alternatively, according to any of the aforementioned uses, the use is to produce lactose by fermentation of engineered cells, preferably, the engineered cells are genetically recombinant Escherichia coli.

[0011] Optionally or alternatively, according to any of the preceding claims, wherein, in the engineered cell: The expression of the β-galactosidase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the β-galactosidase gene or its isoenzyme gene is inhibited; The expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the UDP-galactopyranose mutase gene or its isoenzyme gene is inhibited; The expression of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene is inhibited; The expression of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene is inhibited, or / and the activity of the protein encoded by the 6-phosphate glucose isomerase gene or its functional fragment is inhibited.

[0012] According to an exemplary embodiment of the present disclosure, the present disclosure provides a genetically recombinant engineered cell, wherein the engineered cell contains the following modifications: (1) β-galactosidase gene or its isoenzyme gene or its functional homolog gene deletion, nonsense mutation, inactivation mutation or expression inhibitory nucleic acid fragment; (2) The expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene is deleted, has a nonsense mutation, has an inactivating mutation, or has an expression-inhibiting nucleic acid fragment; (3) Deletion, nonsense mutation, inactivation mutation, or expression-inhibiting nucleic acid fragment of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene; (4) Deletion, nonsense mutation, inactivation mutation or expression-inhibiting nucleic acid fragment of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene; (5) Introducing and / or enhancing the expression of the uridine kinase gene or its isoenzyme gene or its functional homolog gene, and / or enhancing the activity of the protein, domain or functional fragment encoded by the uridine kinase gene or its isoenzyme gene or its functional homolog gene; (6) introducing and / or enhancing the expression of genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes; and (7) Introducing and / or enhancing the expression of genes involved in lactose synthesis, their isoenzyme genes, or their functional homologous genes, and / or enhancing the activity of proteins, domains, or their functional fragments encoded by genes involved in lactose synthesis, their isoenzyme genes, or their functional homologous genes.

[0013] Optionally or alternatively, the engineered cell according to any of the preceding items is Escherichia coli.

[0014] Optionally or alternatively, the engineered cell according to any of the preceding claims, wherein The uridine kinase gene is the ndk gene, and preferably the ndk gene comprises or consists of the sequence shown in SEQ ID NO. 7.

[0015] Optionally or alternatively, according to any of the foregoing engineered cells, wherein the gene involved in the synthesis of UDP-galactose is selected from the group consisting of at least one of the following genes: gene pgm encoding phosphoglucomutase, gene galU encoding UTP-glucose-1-phosphate uridylyltransferase, gene galE encoding UDP-glucose 4-epimerase.

[0016] Optionally or alternatively, the engineered cell according to any of the preceding claims, wherein The pgm gene comprises or consists of the sequence shown in SEQ ID NO. 8.

[0017] Optionally or alternatively, the engineered cell according to any of the preceding claims, wherein The galU gene comprises or consists of the sequence shown in SEQ ID NO. 9.

[0018] Optionally or alternatively, the engineered cell according to any of the preceding claims, wherein The galE gene comprises or consists of the sequence shown in SEQ ID NO. 10.

[0019] Optionally or alternatively, according to any of the aforementioned engineered cells, the UDP galactose synthesis-related genes are enhanced in the form of double or multiple copies in the genome.

[0020] Optionally or alternatively, the engineered cell according to any of the preceding items, wherein the gene involved in lactose synthesis encodes one or more of the following enzymes: EC 2.4.1.275, EC 2.4.1.38, EC 2.4.1.22, EC 2.4.1.90.

[0021] Optionally or alternatively, according to any of the aforementioned engineered cells, the gene involved in lactose synthesis is the β-1,4-galactosyltransferase I gene B4GALT1.

[0022] Optionally or alternatively, according to any of the foregoing engineered cells, wherein the Escherichia coli strain 5, wherein the exogenous β-1,4-galactosyltransferase I gene B4GALT1 is derived from cow, human, or a fusion gene of cow and human.

[0023] The engineered cells described above can be obtained from the following Escherichia coli: Escherichia coli MG1655, Escherichia coli BW25113, and Escherichia coli MC02 (CGMCC No. 34378). MG1655 and BW25113 can be obtained from the Yale University Escherichia coli Genetic Collection (CGSC), and MC02 can be obtained from CGMCC.

[0024] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for producing lactose, comprising using any one of the aforementioned engineered cells to ferment and produce lactose.

[0025] Optionally or alternatively, the method according to any of the preceding claims further comprises synthesizing lactose using glucose as a substrate.

[0026] Optionally or alternatively, use of the engineered cell according to any preceding claim in producing lactose.

[0027] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for producing lactose, comprising performing the following genetic recombination modification on an engineered cell: (1) Inhibiting the expression of the β-galactosidase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the β-galactosidase gene or its isoenzyme gene; (2) Inhibiting the expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the UDP-galactopyranose mutase gene or its isoenzyme gene; (3) Inhibiting the expression of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene; (4) Inhibiting the expression of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene; (5) Enhancing the expression of the uridine kinase gene or its isoenzyme gene or its functional homolog gene, and / or enhancing the activity of the protein, domain or functional fragment encoded by the uridine kinase gene or its isoenzyme gene or its functional homolog gene; (6) enhancing the expression of genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes; and (7) enhancing the expression of genes involved in lactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in lactose synthesis or their isoenzyme genes or their functional homolog genes; and The genetically engineered cells are placed in a culture medium to ferment and produce lactose.

[0028] Optionally or alternatively, according to any of the preceding methods, wherein the carbon source of the culture medium contains glucose and / or can be decomposed into glucose.

[0029] Through at least one aspect of the present disclosure, the present disclosure provides a method for synthesizing lactose using glucose as a raw material using the above-mentioned engineered strain. The engineered strain acquires the ability to efficiently synthesize lactose by optimizing the lactose synthesis pathway. The genetically engineered strain capable of efficiently producing lactose provides a low-cost production route for lactose production through microbial fermentation, thereby reducing the production cost and difficulty of industrial production of lactose. This method has the following advantages in industrial production: (1) it can ferment and convert glucose using inexpensive raw material; and (2) it has the advantages of a short production cycle and simple operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The figure shows the yield of lactose produced by a recombinant Escherichia coli engineered strain using glucose as a raw material according to an exemplary embodiment of the present disclosure. DETAILED DESCRIPTION

[0031] definition Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0032] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.

[0033] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.

[0034] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.

[0035] The term "carbon source" refers to a source of carbon, preferably a compound or molecule comprising carbon. Preferably, the carbon source is a carbohydrate, a fatty acid, an amino acid and derivatives thereof, etc. Carbohydrates are understood herein to be organic compounds composed of carbon, oxygen and hydrogen.

[0036] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.

[0037] As used herein, the term "recombination" / "engineered" (e.g., mentioning "recombinant E. coli," "recombinant cell," "recombinant microorganism," and / or "recombinant strain") can refer to cells, microorganisms, or strains containing nucleic acids that are the result of one or more genetic modifications. Briefly, cells, microorganisms, or strains contain different combinations of nucleic acids from one or more parents (any of which). In order to construct recombinant cells, microorganisms, or strains, one or more recombinant DNA techniques and / or one or more other mutagenesis techniques can be used. For example, recombinant E. coli and / or recombinant E. coli cells can comprise nucleic acids that are not present in corresponding wild-type E. coli and / or cells, recombinant DNA techniques have been used to introduce this nucleic acid into this E. coli or E. coli cells (i.e., transgenic E. coli and / or cells), or this nucleic acid that is not present in the wild-type E. coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in the nucleotide sequence (such as a gene encoding a wild-type polypeptide) present in the wild-type E. coli and / or E. coli cells. Furthermore, the term "recombinant" may suitably refer to a cell, microorganism or strain from which a nucleic acid sequence has been removed, for example using recombinant DNA techniques.

[0038] In this article, the recombinant E. coli comprising or having a certain activity is understood to mean that the recombinant E. coli may comprise one or more nucleic acid sequences encoding a protein having such activity, thereby allowing the recombinant E. coli to functionally express such a protein or enzyme.

[0039] The term "functionally expressed" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example resulting in the synthesis of a protein.

[0040] As used herein, the term "transgenic" (e.g., with reference to "transgenic E. coli" and / or "transgenic cells") refers to E. coli and / or cells, respectively, that contain a nucleic acid that is not naturally present in the E. coli and / or cells and that has been introduced into the E. coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0041] As used herein with respect to a protein or polypeptide, the term "mutation" means that at least one amino acid has been replaced, inserted into, or deleted from an amino acid sequence compared to a wild-type or naturally occurring protein or polypeptide sequence. Amino acid substitution, insertion, or deletion can be achieved, for example, via mutagenesis of nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in Sambrook et al., Molecular Cloning-A Laboratory Manual, 2nd edition, Vols. 1-3 (1989), published by Cold Spring Harbor Publishing.

[0042] As used herein with respect to a gene, the term "mutation" means that at least one nucleotide in the nucleic acid sequence of a gene or its regulatory sequence has been replaced, inserted into, or deleted from a nucleic acid sequence by a different nucleotide compared to a wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of an amino acid can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence having a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0043] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.

[0044] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0045] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0046] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, such as those exhibited by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. An essential property of such analogues of naturally occurring amino acids is that, when incorporated into a protein, the protein is specifically reactive with antibodies elicited against a protein composed entirely of the same naturally occurring amino acids. The terms "polypeptide," "peptide," and "protein" also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0047] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the International Union of Biochemistry and Molecular Biology Nomenclature Committee (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet been classified in a given category but can be so classified.

[0048] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0049] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes, it describes every possible silent variation of nucleic acid. The term "conservatively modified variant" is applicable to both amino acid and nucleic acid sequences. With regard to a specific nucleic acid sequence, conservatively modified variants refer to those nucleic acids encoding identical amino acid sequences or conservatively modified amino acid sequence variants due to the degeneracy of the genetic code. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Therefore, at each position where a codon specifies alanine, the codon can be changed to any described corresponding codon without changing the encoded polypeptide. This type of nucleic acid variation is a "silent variation" and represents a conservatively modified variation.

[0050] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0051] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.

[0052] Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the compared sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

[0053] When an amino acid or nucleotide sequence exhibits a certain level of similarity, it is said to be homologous. Two sequences being homologous indicate a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by a "percent identity" or "percent similarity," which is high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate "percent identity" or "percent similarity." Comparison of sequences and determination of the percent identity between two sequences can be accomplished using mathematical algorithms. The skilled artisan will be aware of the fact that several different computer programs are available for aligning two sequences and determining homology between them (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", (1983), Society for Industrial and Applied Mathematics (SIAM), Vol. 25, No. 2, pp. 201-237 and in the handbook edited by D. Sankoff and J.B. Kruskal (eds.), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA).

[0054] The percent identity between two amino acid sequences can be determined by aligning two sequences using the Needleman and Wunsch algorithm (Needleman et al. "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. 48, 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics, Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices may be specified. Optional parameters for amino acid sequence alignments are a gap opening penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.

[0055] Homology or identity is the percentage of identical matches between two complete sequences over the total aligned area including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing identical amino acids in the two sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the program's output.

[0056] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing the identical amino acid in the two sequences divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the program's output.

[0057] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0058] Optionally, when determining the degree of amino acid similarity, the skilled person may also consider so-called "conservative" amino acid substitutions, which will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, a conservative amino acid substitution group is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0059] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.

[0060] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into protein.

[0061] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.

[0062] The term "upregulation" and its variants refer to a process by which a cell increases the amount of a cellular component (such as RNA or protein). Such upregulation can be in response to or caused by a genetic modification.

[0063] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.

[0064] The nucleic acid sequence (ie, polynucleotide) or protein (ie, polypeptide) may be native or heterologous to the genome of the host cell.

[0065] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0066] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.

[0067] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.

[0068] As used herein, the term "vector" includes reference to autosomal expression vectors and integration vectors for integration into a chromosome.

[0069] The term "expression vector" refers to a linear or circular DNA molecule comprising a segment encoding a polypeptide of interest, which segment is under the control of (i.e., operably linked to) another nucleic acid segment that provides for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both.

[0070] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.

[0071] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.

[0072] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.

[0073] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0074] In the following examples, Escherichia coli MC02 is a modified strain of Escherichia coli MG1655, which has strong industrial adaptability.

[0075] The recombinant Escherichia coli strain disclosed herein contains the following modifications: (1) inhibition of the expression of the lacZ (NCBI-GeneID: 945006; nucleotide sequence as shown in SEQ ID NO. 1) gene or / and inhibition of the activity of the protein encoded by the lacZ gene, namely β-galactosidase; (2) inhibition of the expression of the glf (NCBI-GeneID: 945235; nucleotide sequence as shown in SEQ ID NO. 2) gene or / and inhibition of the activity of the protein encoded by the glf gene, namely UDP-galactopyranose mutase; (3) inhibition of the expression of the rfbA (NCBI-GeneID: 945154; nucleotide sequence as shown in SEQ ID NO. 3) gene or / and inhibition of the activity of the protein encoded by the rfbA gene, namely glucose-1-phosphate thymidine transferase; (4) inhibition of the pgi (NCBI-GeneID: 948535; nucleotide sequence as shown in SEQ ID NO. NO.6) gene expression or / and inhibit the activity of the protein encoded by the pgi gene, namely glucose-6-phosphate isomerase; (5) enhance the expression of the ndk (NCBI-GeneID: 945611; nucleotide sequence such as SEQ ID NO.7) gene or / and enhance the activity of the protein encoded by the ndk gene, namely uridine kinase; (6) enhance the expression of genes involved in UDP-galactose synthesis or / and enhance the activity of proteins encoded by genes involved in UDP-galactose synthesis; (7) enhance the expression of genes involved in lactose synthesis or / and enhance the activity of proteins encoded by genes involved in lactose synthesis.

[0076] The genes involved in the UDP-galactose synthesis described in the present disclosure are selected from the following genes: the gene pgm encoding phosphoglucomutase (NCBI-GeneID: 945271; nucleotide sequence such as SEQ ID NO. 8), the gene galU encoding UTP-glucose-1-phosphate uridylyltransferase (NCBI-GeneID: 945730; nucleotide sequence such as SEQ ID NO. 9), and the gene galE encoding UDP-glucose 4-epimerase (NCBI-GeneID: 945354; nucleotide sequence such as SEQ ID NO. 10).

[0077] The enhancement method of the UDP galactose synthesis related genes disclosed in the present invention is double copy of the genome.

[0078] The exogenous β-1,4-galactosyltransferase I gene disclosed herein is derived from cow B4GALT1 (cow) (NCBI-GeneID: 281781; nucleotide sequence such as SEQ ID NO. 11) or / and human B4GALT1 (hum) (NCBI-GeneID: 2683; nucleotide sequence such as SEQ ID NO. 12).

[0079] It will be understood by those skilled in the art that the genes disclosed herein or their functional homologs comprise nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the exemplified sequences, or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions when compared to the amino acid sequences encoded thereby.

[0080] Preferably, the amino acid sequence encoded by any functional homolog of a gene has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 amino acid mutations, substitutions, insertions and / or deletions compared to the amino acid sequence encoded by a gene.

[0081] By way of example and not limitation, a functional homolog of the gene pgm of the phosphoglucomutase shown in SEQ ID NO. 8 comprises a nucleic acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to any of those nucleic acid sequences, or a functional homolog thereof comprises a nucleic acid sequence having one or more mutations, substitutions, insertions and / or deletions when compared to any of those nucleic acid sequences; preferably, the nucleic acid sequence of any such functional homolog has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 nucleic acid mutations, substitutions, insertions and / or deletions compared to such nucleic acid sequence. More preferably, the functional homolog of phosphoglucomutase comprises an amino acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the polypeptide set forth in SEQ ID NO. 8.

[0082] Those skilled in the art will appreciate that other sequences shown in SEQ ID NOs. 1 to 12 include the above-mentioned situations.

[0083] The present disclosure provides a method for producing lactose, comprising collecting the Escherichia coli strain of the present disclosure and using glucose as a substrate to perform bioconversion using the Escherichia coli strain to synthesize lactose.

[0084] The present disclosure relates to use of the Escherichia coli strain provided by the present disclosure in producing lactose.

[0085] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0086] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, and instruments used in the following examples are all commercially available unless otherwise specified.

[0087] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.

[0088] Example 1 Construction of recombinant Escherichia coli engineered strains Lac07-1 and 2 1. Gene Editing Methods A genetically engineered bacterium for producing lactose was constructed with reference to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic Engineering, 2015, 31: 13-21., which is incorporated herein by reference in its entirety). The genetically engineered bacterium was named Lac10 (the specific construction process is similar to that of Li Y, Lin Z, Huang C, et al.). Figure 1 ), for specific gene manipulation methods, refer to the literature (Xu Qingyang, Li Changgeng, Sun Pengjie. A genetically engineered bacterium for producing orotic acid, its construction method and application: CN114774341A, which is incorporated herein by reference in its entirety); The construction of recombinant E. coli strains Lac07-1 and 2 includes the following eleven steps: (1) Knockout of the lacZ gene Using pTarget-lacZ-F and pTarget-lacZ-R as primers, the pTarget-lacZ plasmid was constructed; then, using lacZ-up-F, lacZ-up-R, lacZ-dw-F, and lacZ-dw-R as primers and the E. coli MC02 genome as a template, the upstream homology arm lacZ-up and the downstream homology arm lacZ-dw were obtained; finally, using lacZ-up-F and lacZ-dw-R as primers, the targeting fragment ∆lacZ was obtained by overlap PCR; finally, the pTarget-lacZ plasmid and the targeting fragment ∆lacZ were electroporated into E. coli MC02 pCas9-electroporated competent cells, and lacZ-uuF and lacZ-ddR were used as identification primers to screen positive transformants to obtain the strain Lac01.

[0089] (2) Knockout of the glf gene First, the pTarget-glf plasmid was constructed using pTarget-glf-F and pTarget-glf-R as primers. Then, the upstream homology arm glf-up and the downstream homology arm glf-dw were obtained using glf-up-F, glf-up-R, glf-dw-F, and glf-dw-R as primers and the E. coli MC02 genome as a template. Finally, the targeting fragment ∆glf was obtained by overlap PCR using glf-up-F and glf-dw-R as primers. Finally, the pTarget-glf plasmid and the targeting fragment ∆glf were electroporated into Lac01 pCas9-electroporated competent cells, and positive transformants were screened using glf-uuF and glf-ddR as identification primers to obtain the strain Lac02.

[0090] (3) Knockout of the rfbA gene First, the pTarget-rfbA plasmid was constructed using pTarget-rfbA-F and pTarget-rfbA-R as primers. Then, the upstream homology arm rfbA-up and the downstream homology arm rfbA-dw were obtained using rfbA-up-F, rfbA-up-R, rfbA-dw-F, and rfbA-dw-R as primers and the E. coli MC02 genome as a template. Finally, the targeting fragment ∆rfbA was obtained by overlap PCR using rfbA-up-F and rfbA-dw-R as primers. Finally, the pTarget-rfbA plasmid and the targeting fragment ∆rfbA were electroporated into Lac02 pCas9-electroporated competent cells, and positive transformants were screened using rfbA-uuF and rfbA-ddR as identification primers to obtain the strain Lac03.

[0091] (4) Knockout of the pgI gene First, the pTarget-pgi plasmid was constructed using pTarget-pgi-F and pTarget-pgi-R as primers. Then, the upstream homology arm pgi-up and the downstream homology arm pgi-dw were obtained using pgi-up-F, pgi-up-R, pgi-dw-F, and pgi-dw-R as primers and the E. coli MC02 genome as a template. Finally, the targeting fragment ∆pgi was obtained by overlap PCR using pgi-up-F and pgi-dw-R as primers. Finally, the pTarget-pgi plasmid and the targeting fragment ∆pgi were electroporated into Lac03 pCas9-electroporated competent cells, and positive transformants were screened using pgi-uuF and pgi-ddR as identification primers to obtain the strain Lac05.

[0092] (5) Overexpression of the NDK gene First, pTarget-mazG-F and pTarget-mazG-R were used as primers to construct the pTarget-mazG plasmid. Then, mazG-up-F, mazG-up-R, ndk-(mazGup)-F, ndk-(mazGdw)-R, mazG-dw-F, and mazG-dw-R were used as primers and the genome of E. coli MC02 was used as a template to obtain the upstream homology arm mazG-up, the target gene ndk, and the downstream homology arm mazG-dw. Finally, mazG-up-F and mazG-dw-R were used as primers to obtain ∆mazG::ndk by overlap PCR. Finally, the pTarget-mazG plasmid and the targeting fragment ∆mazG::ndk were electroporated into Lac05. pCas9 was electroporated into competent cells, and mazG-uuF and mazG-ddR were used as identification primers to screen positive transformants to obtain strain Lac06.

[0093] (6) Strengthening of UDP-galactose synthesis pathway (6-a) Overexpression of the pgm gene First, pTarget-glsA-F and pTarget-glsA-R were used as primers to construct the pTarget-glsA plasmid. Then, glsA-up-F, glsA-up-R, pgm-(glsAup)-F, pgm-(glsAdw)-R, glsA-dw-F, and glsA-dw-R were used as primers and the genome of E. coli MC02 was used as a template to obtain the upstream homologous arm glsA-up, the target gene pgm, and the downstream homologous arm glsA-dw. Finally, glsA-up-F and glsA-dw-R were used as primers to obtain ∆glsA::pgm by overlap PCR. Finally, the pTarget-glsA plasmid and the targeting fragment ∆glsA::pgm were electroporated into Lac06. pCas9 was electroporated into competent cells, and glsA-uuF and glsA-ddR were used as identification primers to screen positive transformants and obtain strain Lac06-1.

[0094] (6-b) Overexpression of the galU gene First, pTarget-glnE-F and pTarget-glnE-R were used as primers to construct the pTarget-glnE plasmid. Then, glnE-up-F, glnE-up-R, galU-(glnEup)-F, galU-(glnEdw)-R, glnE-dw-F, and glnE-dw-R were used as primers and the genome of E. coli MC02 was used as a template to obtain the upstream homology arm glnE-up, the target gene galU, and the downstream homology arm glnE-dw. Finally, glnE-up-F and glnE-dw-R were used as primers to obtain ∆glnE::galU by overlap PCR. Finally, the pTarget-glnE plasmid and the targeting fragment ∆glnE::galU were electroporated into Lac06-1 pCas9 was electroporated into competent cells, and glnE-uuF and glnE-ddR were used as identification primers to screen positive transformants and obtain strain Lac06-2.

[0095] (6-c) Overexpression of the galE gene First, pTarget-glnB-F and pTarget-glnB-R were used as primers to construct the pTarget-glnB plasmid. Then, glnB-up-F, glnB-up-R, galU-(glnBup)-F, galU-(glnBdw)-R, glnB-dw-F, and glnB-dw-R were used as primers and the genome of E. coli MC02 was used as a template to obtain the upstream homology arm glnB-up, the target gene galU, and the downstream homology arm glnB-dw. Finally, glnB-up-F and glnB-dw-R were used as primers to obtain ∆glnB::galU by overlap PCR. Finally, the pTarget-glnB plasmid and the targeting fragment ∆glnB::galU were electroporated into Lac06-2 In the pCas9 electroporated competent cells, glnB-uuF and glnB-ddR were used as identification primers to screen positive transformants and obtain strain Lac07.

[0096] (7) Construction of plasmid overexpressing key genes for lactose synthesis.

[0097] A recombinant expression vector containing the β-1,4-galactosyltransferase I gene B4GALT1(cow / hum) was constructed. First, the linearized pET28a vector was amplified by PCR using pET28a-GJ-F / R as primers and plasmid pET28a as template, using high-fidelity TransStart FastPfu DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd., product catalog number AP221). The target fragment was recovered by agarose gel electrophoresis. Second, B4GALT1(cow)+ and B4GALT1(hum)+ were amplified by PCR using B4GALT1(cow)-F / R and B4GALT1(hum)-F / R as primers and the synthetic genes B4GALT1(cow) and B4GALT1(hum) as templates, respectively, using high-fidelity TransStart FastPfu DNA Polymerase. The target fragments were recovered by agarose gel electrophoresis. The B4GALT1(cow)-F / R and B4GALT1(hum)-F / R primers introduced base sequences that overlapped with pET28a. Finally, the linearized pET28a vector fragments of B4GALT1(cow)+ and B4GALT1(hum)+ were ligated using the Gibson assembly method. Escherichia coli DH5 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd., catalog number CD201) were transformed using the CaCl2 method. The cells were plated on LB plates containing kanamycin and cultured overnight at 37°C. Clones were selected and identified using primers pET28a-jd-F / R. Those capable of amplifying the target fragment were sequenced and isolated. Positive clones were selected for plasmid extraction, resulting in the pET28a-Lactose-cow / hum plasmid.

[0098] (8) Construction of recombinant Escherichia coli Lac07-1.

[0099] Prepare competent cells from strain Lac07 and transform them with the plasmid pET28a-Lactose-cow using the CaCl2 method. Plate the cells onto LB plates containing kanamycin and incubate at 37°C overnight. Select a clone and designate it Lac07-1.

[0100] (9) Construction of recombinant Escherichia coli Lac07-2.

[0101] Prepare competent cells from strain Lac07 and transform them with the plasmid pET28a-Lactose-hum using the CaCl2 method. Plate the cells onto LB plates containing kanamycin and incubate at 37°C overnight. Select a clone and designate it Lac07-2.

[0102] Table 1. Primer sequence list Primers sequence use pTarget-lacZ-F CACATCCCCCTTTCGCCAGCgttttagagctagaaatagcaagttaaaataag Step (1) pTarget-lacZ-R ctaaaacGCTGGCGAAAGGGGGATGTGactagtattatacctaggactgagctag Step (1) lacZ-up-F GCAAATGCTGAATGAGGGCATC Step (1) lacZ-up-R TATTTTTGACACCAGACCAACATGGTCATAGCTGTTTCCTGTGTG Step (1) lacZ-dw-F ATGACCATGTTGGTCTGGTGTCAAAAATAATAATAACCGG Step (1) lacZ-dw-R GCCAACACAGCCAAACATCCG Step (1) lacZ-uuF TTAAGTTCTGTCTCGGCGCGT Step (1) lacZ-ddR ATTAATGATCAGTGGCGCAAAGAAC Step (1) pTarget-glf-F CGGTGGAAATGCGTACACAGgttttagagctagaaatagcaagttaaaataag Step (2) pTarget-glf-R ctaaaacCTGTGTACGCATTTCCACCGactagtattatacctaggactgagctag Step (2) glf-up-F AATTTTAATGCGGCCAATACTATAAGAAACGC Step (2) glf-up-R CTAACTCTCTATATTTAATCGTACATAAAATCCTCAGCAAACCAGTA Step (2) glf-dw-F GTACGATTAAATATAGAGAGTTAGCTAGCAGAGAAGACAAG Step (2) glf-dw-R GCTAGTCCCGAACTGGTAGTTACTT Step (2) glf-uuF TCTTTAGCAGACGGTTTTCATGTTTTTATTTCC Step (2) glf-ddR AGATGATAACCATAAAGACAATTTGCTTACCAGTAT Step (2) pTarget-rfbA-F AAAGTGCAACCTAGCCCAGAgttttagagctagaaatagcaagttaaaataag Step (3) pTarget-rfbA-R ctaaaacTCTGGGCTAGGTTGCACTTTactagtattatacctaggactgagctag Step (3) rfbA-up-F ACCAGCTGGGTCTATGCAGGA Step (3) rfbA-up-R ATCCCTGGCCGCTTCACGCATTTTCATTTCATCATTCCTTTTAATTCATCT Step (3) rfbA-dw-F AATGAAAATGCGTGAAGAGCGCCAGGGATTGAAG Step (3) rfbA-dw-R TCAGACAGAACCAAAAAGCCATGAGC Step (3) rfbA-uuF TGGCTGGAGACGGATGCAA Step (3) rfbA-ddR AGCTCATCTAACGTAAAGAGCCTTTCATC Step (3) pTarget-pgi-F TTCTGACCTCGGCCCATACAgttttagagctagaaatagcaagttaaaataag Step (4) pTarget-pgi-R ctaaaacTGTATGGGCCGAGGTCAGAAactagtattatacctaggactgagctag Step (4) pgi-up-F TAACTACCTCGTGTCAGGGGATCC Step (4) pgi-up-R CGGCGTGAACGCCTTATCTGCGTTGGATTGATGTTTTTCATTAGCAA Step (4) pgi-dw-F ACATCAATCCAACGCAGATAAGGCGTTCACGCCGCA Step (4) pgi-dw-R CAGATATGGCAAAAATGCCATACAGAACTTT Step (4) pgi-uuF GAGAGGACAACTAAACGCACGTT Step (4) pgi-ddR GTGGTGGTCCCGGTATTAGAACC Step (4) pTarget-mazG-F TATGCAGCGCCTGCGCGATCgttttagagctagaaatagcaagttaaaataag Step (5) pTarget-mazG-R ctaaaacGATCGCGCAGGCGCTGCATAactagtattatacctaggactgagctag Step (5) mazG-up-F ATTTACGCTTGCTGAACTGGTCAAC Step (5) mazG-up-R AGCtgctagcattatacctaggactgagctagctgtcaaATTCATTGAATTGTCCTGAAAATTGCGG Step (5) ndk-(mazGup)-F tcctaggtataatgctagcaGCTAACAGGAGGAATTAACCatggctattgaacgtactttttccatcatc Step (5) ndk-(mazGdw)-R GCGTAATTCCCttaacgggtgcgcgggca Step (5) mazG-dw-F gcgcacccgttaaGGGAATTACGCGGTCAAGCG Step (5) mazG-dw-R AGAGTAGATACGACCCGTGGTG Step (5) mazG-uuF ATTTACAACCTGCAAGTGCTGGG Step (5) mazG-ddR GTCCAGCCCCTGAGATTTCAACA Step (5) pTarget-glsA-F CAGTGATTACCGCTTTGCACgttttagagctagaaatagcaagttaaaataag Step (6-a) pTarget-glsA-R ctaaaacGTGCAAAGCGGTAATCACTGactagtattatacctaggactgagctag Step (6-a) glsA-up-F ttgtcagcggtgaccatcatgttatc Step (6-a) glsA-up-R tcctgttagctgctagcattatacctaggactgagctagctgtcaaatagatgcgggaggtaattcctca Step (6-a) pgm-(glsAup)-F aggtataatgctagcagctaacaggaggaattaaccatggcaatccacaatcgtgca Step (6-a) pgm-(glsAdw)-R gtgttcatcatttacgcgtttttcagaacttcgcta Step (6-a) glsA-dw-F aagttctgaaaaacgcgtaaatgatgaacacggaaggtaataacggt Step (6-a) glsA-dw-R ttattcattagcttcggcagttcg Step (6-a) glsA-uuF ttatcaggccgataaccaacc Step (6-a) glsA-ddR cgtcatcagcataatcaacacc Step (6-a) pTarget-glnE-F GCTGCCAGAGCCTTTAGCCGgttttagagctagaaatagcaagttaaaataag Step (6-b) pTarget-glnE-R ctaaaacCGGCTAAAGGCTCTGGCAGCactagtattatacctaggactgagctag Step (6-b) glnE-up-F GCGTAAAGCGAGCACTCACTT Step (6-b) glnE-up-R ctgctagcattatacctaggactgagctagctgtcaaGTCTGCCAGTACTGCTGTAACG Step (6-b) galU-(glnEup)-F tcagtcctaggtataatgctagcagctaacaggaggaattaaccatggctgccattaatacgaaagt Step (6-b) galU-(glnEdw)-R CGCGCGATAATACCATACTttacttcttaatgcccatctcttcttcaagc Step (6-b) glnE-dw-F gggcattaagaagtaaAGTATGGTATTATCGCGCGCAAAT Step (6-b) glnE-dw-R AACAATCTCTTCTTCGGTCTTACATTTACCG Step (6-b) glnE-uuF GCAAAAGCCGATGTGGAACAGG Step (6-b) glnE-ddR GCGCTTGGGTTGGCATATGC Step (6-b) pTarget-glnB-F GATTATAAAACCCTTCAAGCgttttagagctagaaatagcaagttaaaataag Step (6-c) pTarget-glnB-R ctaaaacGCTTGAAGGGTTTTATAATCactagtattatacctaggactgagctag Step (6-c) glnB-up-F AAATCACCTGTTGCGCCAGG Step (6-c) glnB-up-R tagctgctagcattatacctaggactgagctagctgtcaaCATGCTATTCCTTGAAAAGGTCGC Step (6-c) galE-(glnBup)-F cagtcctaggtataatgctagcagctaacaggaggaattaaccatgagagttctggttaccggtgg Step (6-c) galE-(glnBdw)-R CTTGACCGGTttaatcggggatatccctgtggatgg Step (6-c) glnB-dw-F atatcccgattaaACCGCGTCAAGGGTTGC Step (6-c) glnB-dw-R AACGCCAATGCTGGCAATGC Step (6-c) glnB-uuF GCGGAGCGCACAGAAGACATT Step (6-c) glnB-ddR CACACCAGTGACGTTAATCTCTGC Step (6-c) pET28a-GJ-F tacagattaaatcagaacgcagaagcg Step (7) pET28a-GJ-R ggttaattcctcctgttagcccaaaaaa Step (7) pET28a-jd-F taagattagcggatcctacctgacg Step (7) pET28a-jd-R tggcagttccctactctcgc Step (7) B4GALT1cow)-F ggctaacaggaggaattaaccATGTCAAGGTTGCTAGGAGGTACAT Step (7) B4GALT1(cow)-R TTAGCTGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAATTAACCACGCGGAGGCCA Step (7) B4GALT1(hum)-F ggctaacaggaggaattaaccATGTCAAGGCTATTGGGGGGAA Step (7) B4GALT1(hum)-R TTAGCTGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAATTAGCCTCTAGGCGGCCA Step (7) Example 2 Lactose was produced using glucose as raw material using recombinant Escherichia coli strains Lac07-1 and 2.

[0103] (11) A. Components of culture medium.

[0104] The components and final concentrations of medium A are as follows: NaHPO4: 25 mM KH2PO4: 25 mM NH4Cl: 50 mM Na2SO4: 5 mM MgSO4: 2 mM Glycerin: 0.5% Yeast powder: 0.5% Trace elements: 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM each of CoCl2, NiCl2, Na2MO4, Na2SeO3 and H3BO3; (14) Bacterial culture, enzyme induction, and whole-cell catalysis of lactose The engineered strain was cultured overnight Lac07-1, 2 A 1% inoculum was inoculated into a shake flask containing 20 ml of LB medium, and kanamycin was added to the medium. The cells were cultured at 37°C for 12 hours and then harvested. The cells were transferred to a shake flask containing 100 ml of A medium and cultured at 37°C for 6 hours. Arabinose was added to a final concentration of 0.2% and induced at 30°C for 12 hours. After induction, glucose was added to the medium at a final concentration of 50 g / L to initiate whole-cell catalytic lactose production. Lactose production was detected at a wavelength of 600 nm. The results are as follows: Figure 1 shown.

Claims

1. A lactose synthesis gene cluster comprising or consisting of: Uridine kinase gene or its isoenzyme gene or its functional homolog gene; Genes involved in UDP-galactose synthesis, or isoenzyme genes, or functional homolog genes thereof; and Genes involved in lactose synthesis.

2. A gene cluster according to any preceding claim, wherein The uridine kinase gene or its isoenzyme gene or its functional homolog gene comprises or consists of the sequence shown in SEQ ID NO.

7.

3. A gene cluster according to any preceding claim, wherein: The gene involved in UDP-galactose synthesis, or its isoenzyme gene, or its functional homolog gene comprises or consists of a sequence shown in at least one of SEQ ID NOs. 8, 9, and 10.

4. A gene cluster according to any preceding claim, wherein: The gene involved in lactose synthesis comprises or consists of a sequence shown in at least one of SEQ ID NOs. 11 and 12.

5. A gene cluster according to any preceding claim, wherein: The gene involved in UDP-galactose synthesis, its isozyme gene, or its functional homolog gene is present in duplicate or multiple copies.

6. Use of the gene cluster according to any preceding claim in the production of lactose.

7. The use according to any one of the preceding claims, wherein the use is the fermentation production of lactose by engineered cells, preferably, the engineered cells are genetically recombinant Escherichia coli.

8. Use according to any one of the preceding claims, wherein In the engineered cells: The expression of the β-galactosidase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the β-galactosidase gene or its isoenzyme gene is inhibited; The expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the UDP-galactopyranose mutase gene or its isoenzyme gene is inhibited; The expression of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene is inhibited, and / or the activity of the protein, domain or functional fragment encoded by the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene is inhibited; The expression of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene is inhibited, or / and the activity of the protein encoded by the 6-phosphate glucose isomerase gene or its functional fragment is inhibited.

9. A genetically recombinant engineered cell comprising the following modifications: (1) β-galactosidase gene or its isoenzyme gene or its functional homolog gene deletion, nonsense mutation, inactivation mutation or expression inhibitory nucleic acid fragment; (2) The expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene is deleted, has a nonsense mutation, has an inactivating mutation, or has an expression-inhibiting nucleic acid fragment; (3) Deletion, nonsense mutation, inactivation mutation, or expression-inhibiting nucleic acid fragment of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene; (4) Deletion, nonsense mutation, inactivation mutation or expression-inhibiting nucleic acid fragment of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene; (5) Introducing and / or enhancing the expression of the uridine kinase gene or its isoenzyme gene or its functional homolog gene, and / or enhancing the activity of the protein, domain or functional fragment encoded by the uridine kinase gene or its isoenzyme gene or its functional homolog gene; (6) introducing and / or enhancing the expression of genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes; and (7) Introducing and / or enhancing the expression of genes involved in lactose synthesis, their isoenzyme genes, or their functional homologous genes, and / or enhancing the activity of proteins, domains, or their functional fragments encoded by genes involved in lactose synthesis, their isoenzyme genes, or their functional homologous genes.

10. The engineered cell according to any preceding claim, which is Escherichia coli.

11. An engineered cell according to any preceding claim, wherein The uridine kinase gene is the ndk gene, and preferably the ndk gene comprises or consists of the sequence shown in SEQ ID NO.

7.

12. An engineered cell according to any preceding claim, wherein The gene involved in UDP-galactose synthesis is selected from the group consisting of at least one of the following genes: gene pgm encoding phosphoglucomutase, gene galU encoding UTP-glucose-1-phosphate uridylyltransferase, and gene galE encoding UDP-glucose 4-epimerase.

13. An engineered cell according to any preceding claim, wherein The pgm gene comprises or consists of the sequence shown in SEQ ID NO.

8.

14. An engineered cell according to any preceding claim, wherein The galU gene comprises or consists of the sequence shown in SEQ ID NO.

9.

15. An engineered cell according to any preceding claim, wherein The galE gene comprises or consists of the sequence shown in SEQ ID NO.

10.

16. The engineered cell according to any one of the preceding claims, wherein the UDP galactose synthesis-related gene is enhanced in the form of double or multiple copies in the genome.

17. The engineered cell of any preceding claim, wherein the genes involved in lactose synthesis encode one or more of the following enzymes: EC 2.4.1.275, EC 2.4.1.38, EC 2.4.1.22, EC 2.4.1.

90.

18. An engineered cell according to any preceding claim, wherein The gene involved in lactose synthesis is the β-1,4-galactosyltransferase I gene B4GALT1.

19. An engineered cell according to any preceding claim, wherein The Escherichia coli strain of claim 5, wherein the exogenous β-1,4-galactosyltransferase I gene B4GALT1 is derived from cow, human, or a fusion gene of cow and human.

20. A method for producing lactose, comprising fermenting and producing lactose using the engineered cell according to any one of the preceding claims.

21. The method according to any one of the preceding claims, further comprising synthesizing lactose using glucose as a substrate.

22. Use of an engineered cell according to any preceding claim in the production of lactose.

23. A method for producing lactose, comprising performing the following genetic recombinant modification on an engineered cell: (1) Inhibiting the expression of the β-galactosidase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the β-galactosidase gene or its isoenzyme gene; (2) Inhibiting the expression of the UDP-galactopyranose mutase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the UDP-galactopyranose mutase gene or its isoenzyme gene; (3) Inhibiting the expression of the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the glucose-1-phosphate thymidine transferase gene or its isoenzyme gene or its functional homolog gene; (4) Inhibiting the expression of the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene, and / or inhibiting the activity of the protein, domain or functional fragment encoded by the 6-phosphate glucose isomerase gene or its isoenzyme gene or its functional homolog gene; (5) Enhancing the expression of the uridine kinase gene or its isoenzyme gene or its functional homolog gene, and / or enhancing the activity of the protein, domain or functional fragment encoded by the uridine kinase gene or its isoenzyme gene or its functional homolog gene; (6) enhancing the expression of genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in UDP-galactose synthesis or their isoenzyme genes or their functional homolog genes; and (7) enhancing the expression of genes involved in lactose synthesis or their isoenzyme genes or their functional homolog genes, and / or enhancing the activity of proteins, domains or their functional fragments encoded by genes involved in lactose synthesis or their isoenzyme genes or their functional homolog genes; and The genetically engineered cells are placed in a culture medium to ferment and produce lactose.

24. A method according to any preceding claim, wherein: The carbon source of the culture medium contains glucose and / or can be decomposed into glucose.

Images